Search Results

Search found 10277 results on 412 pages for 'mail 22'.

Page 302/412 | < Previous Page | 298 299 300 301 302 303 304 305 306 307 308 309  | Next Page >

  • PHPMailer attachment type and size limit

    - by SomeoneS
    i have one form and i am using PHPMailer to send data from that form to my email. Users can send attachments as well, but i have one rpoblem: how to make PHPMailer to deny attachments larger than 2Mb and to allow only iamge attachments (no other types of documents)? This is code i using for multiply email attachments with PHPMailer: foreach(array_keys($_FILES['fileAttach']['name']) as $key) { $source = $_FILES['fileAttach']['tmp_name'][$key]; $filename = $_FILES['fileAttach']['name'][$key]; $mail->AddAttachment($source, $filename); }

    Read the article

  • Drupal how to set session or cookie?

    - by Gobi
    Hi, i jus friend reference function so i pass the user id through url like below www.example.com?fid=22 i need to set this as a session or cookie which access to all modules in drupal 6. if i set session it return for tht particular module . set cookie is not workin at all. $user-new_property works only on particular page where set if i move to another page no new_property in $user variable object list . Thanxs in advance, Gobi

    Read the article

  • MBR status confusion

    - by Ahmed Ghoneim
    EB 58 90 6D 6B 64 6F 73 66 73 00 00 02 08 20 00 02 00 00 00 00 F8 00 00 3E 00 83 00 00 00 00 00 94 88 7E 00 98 1F 00 00 00 00 00 00 02 00 00 00 01 00 06 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 29 A9 38 B1 34 57 61 76 65 20 20 20 20 20 20 20 46 41 54 33 32 20 20 20 0E 1F BE 77 7C AC 22 C0 74 0B 56 B4 0E BB 07 00 CD 10 5E EB F0 32 E4 CD 16 CD 19 EB FE 54 68 69 73 20 69 73 20 6E 6F 74 20 61 20 62 6F 6F 74 61 62 6C 65 20 64 69 73 6B 2E 20 20 50 6C 65 61 73 65 20 69 6E 73 65 72 74 20 61 20 62 6F 6F 74 61 62 6C 65 20 66 6C 6F 70 70 79 20 61 6E 64 0D 0A 70 72 65 73 73 20 61 6E 79 20 6B 65 79 20 74 6F 20 74 72 79 20 61 67 61 69 6E 20 2E 2E 2E 20 0D 0A 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 55 AA Learning disk records, this is my USB MBR record viewed by bless on ubuntu formatted with disk utility as MBR table and FAT partition, referring to this Wiki of first record status (0x80 = bootable (active), 0x00 = non-bootable, other = invalid ) but my MBR shows first offset as EB. What's this record stands for ? also, can you provide me with good tables/images tutorials for MBR and other disks' records :)

    Read the article

  • Placeholder for UITextView

    - by Gill Bates
    Anyone ever implements something in UITextView that stopping it from receiving future inputs when the text length is smaller than certain threshold? I plan to implement a textview like we have in the mail composer interface. We have a placeholder "Subject" there, and the cursor starts after. Placeholder in UITextView Inspired from this question, I wonder if there are some methods which could be used to stop changing the text in the UITextView once the cursor is moving back to the placeholder string. Any ideas?

    Read the article

  • iPhone apps for company-internal use - possible?

    - by Michael Stum
    I hope this is still programming related, as SuperUser doesn't seem the appropriate place. Basically I wonder if it is possible to have Applications that are internal to a company on the iPhone? That is something like a companion Application to an Intranet (when Safari and Mail just don't cut it) which wouldn't make sense on the AppStore (and likely wouldn't get approved anyway). Is something like that possible (without Jailbreaking or doing anything else that Apple doesn't normally want)?

    Read the article

  • Add/delete row from a table

    - by yogsma
    I have this table with some dependents information and there is a add and delete button for each row to add/delete additional dependents. When I click "add" button, a new row gets added to the table, but when I click the "delete" button, it deletes the header row first and then on subsequent clicking, it deletes the corresponding row. Here is what I have: Javascript code function deleteRow(row){ var d = row.parentNode.parentNode.rowIndex; document.getElementById('dsTable').deleteRow(d); } HTML code <table id = 'dsTable' > <tr> <td> Relationship Type </td> <td> Date of Birth </td> <td> Gender </td> </tr> <tr> <td> Spouse </td> <td> 1980-22-03 </td> <td> female </td> <td> <input type="button" id ="addDep" value="Add" onclick = "add()" </td> <td> <input type="button" id ="deleteDep" value="Delete" onclick = "deleteRow(this)" </td> </tr> <tr> <td> Child </td> <td> 2008-23-06 </td> <td> female </td> <td> <input type="button" id ="addDep" value="Add" onclick = "add()"</td> <td> <input type="button" id ="deleteDep" value="Delete" onclick = "deleteRow(this)" </td> </tr> </table>

    Read the article

  • Advanced Form Validation in JavaScript

    - by Kaji
    I'm already familiar with how to use onSubmit to evaluate form content against RegEx to ensure it meets static parameters for acceptable content. What I'm wondering is if there is a way to further provide validation against a MySQL database, such as if you want to make sure an e-mail address hasn't been used yet before submitting a form and having to re-load the field data back into the proper places for correction.

    Read the article

  • Is it possible to create a service like Feed My Inbox on my own server?

    - by Mark Bowen
    I was just wondering if it's at all possible to create a service like Feed My Inbox on my own server using PHP? Basically I have a site which has RSS feeds which are dynamic in nature and can search from thousands of posts based on many different criteria. I have the RSS feed working fine and bringing back data dynamically for whatever criteria I want so that bits fine. I am using the ExpressionEngine CMS to handle the site and there will be thousands of users on the site (currently there are around 2,0000) but that number is exponentially growing every single day. What I want to be able to do is allow the users to choose from certain criteria which will then build a dynamic RSS URL which will then be stored in a database table (one row for each user). This bit I will be able to do myself but then I want to be able to send out new RSS feed items via e-mail to each user. This is the part I'm a little stuck on. I'm guessing I would somehow need to run a cron job to hit a page which would check each users RSS feed and then if there are new items to send them to the user via e-mail. That's where I am totally stuck though and I'm just wondering what the best way to go about it would be? That or any software in PHP that already does this sort of thing would be great. I tried out phpList but it has severe problems working with RSS and I only ever got it to work once and now never again and I've read that lots of people have had this same problem so unfortunately it's not just me :-( I know there are services such as Feed My Inbox which I could easily set up so that users click a link and their RSS feed URL is added to go and use that service but I want to keep users from seeing the dynamic nature of the feed or they will easily be able to modify it to get at other items in the feed. I need this so that I can charge for access to the feeds but if people can see the URL of the feed then I will be totally unstuck as they will be able to get at whatever they want very easily. Therefore I'd like to be able to send the items out to them. Would really love to hear if anyone knows if this kind of thing is possible at all and what would be involved?

    Read the article

  • IIS 7.5 receive emails?

    - by Cine
    In the good old days with IIS 6, it was possible to use the SEOLib to make a managed hook in the SMTP service that would run whenever a mail got delivered. In Vista and W7 they stopped shipping SEOLib, so we can no longer develop for it. What is the replacement for this functionality?

    Read the article

  • How do you encourage users to fill out their profile?

    - by mattdell
    Hello, I wanted to open up the topic to discuss ways to encourage or incentivize users to fill in information in a user profile on a website, such as skills, location, organization, etc. More information in a user profile can give a website an improved capability for its users to search, network, and collaborate. Without bugging users to fill in their profiles (ie - via annoying e-mail reminders), what other ways have you guys come up with to encourage user input? Best, -Matt

    Read the article

  • itertools.product eliminating repeated reversed tuples

    - by genclik27
    I asked a question yesterday and thanks to Tim Peters, it is solved. The question is here; itertools.product eliminating repeated elements The new question is further version of this. This time I will generate tuples inside of tuples. Here is an example; lis = [[(1,2), (3,4)], [(5,2), (1,2)], [(2,1), (1,2)]] When I use it in itertools.product function this is what I get, ((1, 2), (5, 2), (2, 1)) ((1, 2), (5, 2), (1, 2)) ((1, 2), (1, 2), (2, 1)) ((1, 2), (1, 2), (1, 2)) ((3, 4), (5, 2), (2, 1)) ((3, 4), (5, 2), (1, 2)) ((3, 4), (1, 2), (2, 1)) ((3, 4), (1, 2), (1, 2)) I want to change it in a way that if a sequence has (a,b) inside of it, then it can not have (b,a). In this example if you look at this sequence ((3, 4), (1, 2), (2, 1)) it has (1,2) and (2,1) inside of it. So, this sequence ((3, 4), (1, 2), (2, 1)) should not be considered in the results. As I said, I asked similar question before, in that case it was not considering duplicate elements. I try to adapt it to my problem. Here is modified code. Changed parts in old version are taken in comments. def reverse_seq(seq): s = [] for i in range(len(seq)): s.append(seq[-i-1]) return tuple(s) def uprod(*seqs): def inner(i): if i == n: yield tuple(result) return for elt in sets[i] - reverse: #seen.add(elt) rvrs = reverse_seq(elt) reverse.add(rvrs) result[i] = elt for t in inner(i+1): yield t #seen.remove(elt) reverse.remove(rvrs) sets = [set(seq) for seq in seqs] n = len(sets) #seen = set() reverse = set() result = [None] * n for t in inner(0): yield t In my opinion this code should work but I am getting error for the input lis = [[(1,2), (3,4)], [(5,2), (1,2)], [(2,1), (1,2)]]. I could not understand where I am wrong. for i in uprod(*lis): print i Output is, ((1, 2), (1, 2), (1, 2)) Traceback (most recent call last): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 39, in <module> for i in uprod(*lis): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 32, in uprod for t in inner(0): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 22, in inner for t in inner(i+1): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 25, in inner reverse.remove(rvrs) KeyError: (2, 1) Thanks,

    Read the article

  • Cross-site request forgery protections: Where do I put all these lines?

    - by brilliant
    Hello, I was looking for a python code that would be able to log in from "Google App Engine" to some of my accounts on some websites (like yahoo or eBay) and was given this code: import urllib, urllib2, cookielib url = "https://login.yahoo.com/config/login?" form_data = {'login' : 'my-login-here', 'passwd' : 'my-password-here'} jar = cookielib.CookieJar() opener = urllib2.build_opener(urllib2.HTTPCookieProcessor(jar)) form_data = urllib.urlencode(form_data) # data returned from this pages contains redirection resp = opener.open(url, form_data) # yahoo redirects to http://my.yahoo.com, so lets go there instead resp = opener.open('http://mail.yahoo.com') print resp.read() Unfortunately, this code didn't work, so I asked another question here and one supporter among other things said this: "You send MD5 hash and not plain password. Also you'd have to play along with all kinds of CSRF protections etc. that they're implementing. Look: <input type="hidden" name=".tries" value="1"> <input type="hidden" name=".src" value="ym"> <input type="hidden" name=".md5" value=""> <input type="hidden" name=".hash" value=""> <input type="hidden" name=".js" value=""> <input type="hidden" name=".last" value=""> <input type="hidden" name="promo" value=""> <input type="hidden" name=".intl" value="us"> <input type="hidden" name=".bypass" value=""> <input type="hidden" name=".partner" value=""> <input type="hidden" name=".u" value="bd5tdpd5rf2pg"> <input type="hidden" name=".v" value="0"> <input type="hidden" name=".challenge" value="5qUiIPGVFzRZ2BHhvtdGXoehfiOj"> <input type="hidden" name=".yplus" value=""> <input type="hidden" name=".emailCode" value=""> <input type="hidden" name="pkg" value=""> <input type="hidden" name="stepid" value=""> <input type="hidden" name=".ev" value=""> <input type="hidden" name="hasMsgr" value="0"> <input type="hidden" name=".chkP" value="Y"> <input type="hidden" name=".done" value="http://mail.yahoo.com"> <input type="hidden" name=".pd" value="ym_ver=0&c=&ivt=&sg="> I am not quite sure where he got all these lines from and where in my code I am supposed to add them. Do You have any idea? I know I was supposed to ask him this question first, and I did, but he never returned, so I decided to ask a separate question here.

    Read the article

  • Cell contents changing for rows present outside the height of tableview(to see this cells, we shud s

    - by wolverine
    I have set the size of the tableView that I show as the popoverController as 4*rowheight. And I am using 12cells in the tableView. Each cell contains an image and a label. I can see all the cells by scrolling. Upto 5th cell its ok. After th2 5th cell, the label and the image that I am using in the first four cells are being repeated for the remaining cells. And If I select the cell, the result is accurately shown. But when I again take the tableView, the image and labels are not accurate even for the first 5 cells. All are changed but the selection is giving the correct result. Can anyone help me?? - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [self tableviewCellWithReuseIdentifier:CellIdentifier rowNumber:indexPath.row]; } //tableView.backgroundColor = [UIColor clearColor]; return cell; } - (UITableViewCell *)tableviewCellWithReuseIdentifier:(NSString *)identifier rowNumber:(NSInteger)row { CGRect rect; rect = CGRectMake(0.0, 0.0, 360.0, ROW_HEIGHT); UITableViewCell *cell = [[[UITableViewCell alloc] initWithFrame:rect reuseIdentifier:identifier] autorelease]; UIImageView *myImageView = [[UIImageView alloc] initWithFrame:CGRectMake(10.00, 10.00, 150.00, 100.00)]; myImageView.tag = IMAGE_TAG; [cell.contentView addSubview:myImageView]; [myImageView release]; UILabel *label = [[UILabel alloc] initWithFrame:CGRectMake(170.00, -10.00, 170.00, 80.00)]; label.tag = LABEL_TAG; [label setBackgroundColor:[UIColor clearColor]]; [label setTextColor:[UIColor blackColor]]; [label setFont:[UIFont fontWithName:@"AmericanTypewriter" size:22]]; [label setTextAlignment:UITextAlignmentLeft]; [cell.contentView addSubview:label]; [label release]; if (row == 0) { UIImageView *imageView = (UIImageView *)[cell viewWithTag:IMAGE_TAG]; imageView.image = [UIImage imageNamed:[NSString stringWithFormat:@"cover_v.jpg"]]; UILabel *mylabel = (UILabel *)[cell viewWithTag:LABEL_TAG]; mylabel.text = [NSString stringWithFormat:@"COVER PAGE"]; } }

    Read the article

  • due at midnight - program compiles but has logic error(s)

    - by Leslie Laraia
    not sure why this program isn't working. it compiles, but doesn't provide the expected output. the input file is basically just this: Smith 80000 Jones 100000 Scott 75000 Washington 110000 Duffy 125000 Jacobs 67000 Here is the program: import java.io.File; import java.io.FileNotFoundException; import java.util.Scanner; /** * * @author Leslie */ public class Election { /** * @param args the command line arguments */ public static void main(String[] args) throws FileNotFoundException { // TODO code application logic here File inputFile = new File("C:\\Users\\Leslie\\Desktop\\votes.txt"); Scanner in = new Scanner(inputFile); int x = 0; String line = ""; Scanner lineScanner = new Scanner(line); line = in.nextLine(); while (in.hasNextLine()) { line = in.nextLine(); x++; } String[] senatorName = new String[x]; int[] votenumber = new int[x]; double[] votepercent = new double[x]; System.out.printf("%44s", "Election Results for State Senator"); System.out.println(); System.out.printf("%-22s", "Candidate"); //Prints the column headings to the screen System.out.printf("%22s", "Votes Received"); System.out.printf("%22s", "%of Total Votes"); int i; for(i=0; i<x; i++) { while(in.hasNextLine()) { line = in.nextLine(); String candidateName = lineScanner.next(); String candidate = candidateName.trim(); senatorName[i] = candidate; int votevalue = lineScanner.nextInt(); votenumber[i] = votevalue; } } votepercent = percentages(votenumber, x); for (i = 0; i < x; i++) { System.out.println(); System.out.printf("%-22s", senatorName[i]); System.out.printf("%22d", votenumber[i]); System.out.printf("%22.2f", votepercent[i]); System.out.println(); } } public static double [] percentages(int[] votenumber, int z) { double [] percentage = new double [z]; double total = 0; for (double element : votenumber) { total = total + element; } for(int i=0; i < votenumber.length; i++) { int y = votenumber[i]; percentage[i] = (y/total) * 100; } return percentage; } }

    Read the article

  • How to get "Data Type" value of Body of a Lotus Notes Item using .NET?

    - by Pari
    I am trying to get Data Type (Body Format) of Mail,Calendar e.t.c. Body. Getting Body content as: String Body = (string)((object[])docInbox.GetItemValue("Body"))[0]; or String Body = docInbox.GetFirstItem("Body").Text; I tried it using: String bodyFormat = ((object[])docInbox.GetItemValue("Body"))[0].GetType().ToString(); But in this case i am getting "System.String" value.But actually it is : "Rich Text".

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How do you perform address validation?

    - by Kevin Pang
    Is it even possible to perform address (physical, not e-mail) validation? It seems like the sheer number of address formats, even in the US alone, would make this a fairly difficult task. On the other hand, it seems like a task that would be necessary for several business requirements.

    Read the article

< Previous Page | 298 299 300 301 302 303 304 305 306 307 308 309  | Next Page >