Search Results

Search found 22521 results on 901 pages for 'output redirect'.

Page 302/901 | < Previous Page | 298 299 300 301 302 303 304 305 306 307 308 309  | Next Page >

  • HTML block nested in PHP if statement - is this considered bad practice?

    - by JYelton
    Consider the following example: <table> <tr> <td>Row One</td> </tr> <?php if ($rowtwo) { ?> <tr> <td>Row Two</td> </tr> <?php } ?> </table> If $rowtwo is true, the second row is output, otherwise it is skipped. The code works as desired, however I am evaluating Netbeans (7 beta) as a PHP IDE (instead of just using a text editor). Netbeans flags the code with an error: Misplaced non-space characters insided [sic] a table. Should I consider an alternate way of writing this code, or is Netbeans incapable of understanding this flow control wrapper for HTML output?

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • VC++ - Asynchronous Thread

    - by JVNR
    I am working on VC++ project, in that my application process a file from input path and generates 3 output "*.DAT" files in the destination path. I will FTP these DAT file to the destination server. After FTP, I need to delete only two output .DAT files the folder. I am able to delete those files, because there one Asynchronous thread running behind the process. Since the thread is running, while deleting it says, "Cannot delete, the file is used by another person". I need to stop that thread and delete the files. Multiple files can also be taken from the input path to process. Please help me in resolving this issue. Its very high priority issue for me. Please help me ASAP.

    Read the article

  • Firing events in script task

    - by Anonymouslemming
    I've got an SSIS project where I am constructing an SQL command based on some variables. I'm constructing the command in a script task, and want to output the constructed SQL to the 'Execution Results' window. I am trying to do this using a FireInformation line from inside my script as follows: Dts.Events.FireInformation(99, "test", "Make this event appear!", "", 0, true); However, in the script editor when editing ScriptMain.cs, that line is underlined in red, and on mouseover, I get the following message: Error: The best overloaded method match for 'Microsoft.SqlServer.Dts.Tasks.ScriptTask.EventsObjectWrapper.FireInformation(int, string, string, string, int, ref bool') has some invalid arguments As a result, my script does not compile and I cannot execute it. Any idea what I'm doing wrong here, or what I need to change to be able to see the values of my variables at this point in the Execution output?

    Read the article

  • Concatinate integer arrays iteratively

    - by Ojtwist
    I have a methode in2.getImagesOneDim() which gives me an array of integers, to be more precise the pixel values of an image. Now i want to create one big array with all the pixel values of all the images. Therefore I have to call this method several times. Now I would like to concatenate the previous output to the current output until all images are read. In some kind of pseudo code, where the + is a concatination ... : for (int i = 1; i < 25; i++) { ConArray = ConArray + in2.getImagesOneDim("../images/"+i); } How would I do this in java ?

    Read the article

  • Why doesn't list.get(0).equals(null) work?

    - by Jessy
    The first index is set to null (empty), but it doesn't print the right output, why? //set the first index as null and the rest as "High" String a []= {null,"High","High","High","High","High"}; //add array to arraylist ArrayList<Object> choice = new ArrayList<Object>(Arrays.asList(a)); for(int i=0; i<choice.size(); i++){ if(i==0){ if(choice.get(0).equals(null)) System.out.println("I am empty"); //it doesn't print this output } }

    Read the article

  • My rewrite rule is not working

    - by DijkeMark
    I need to make a rewrite rule for a page, but it does not work. I do have mod_rewrite for apache enabled This is my .htacces file: <IfModule mod_rewrite.c> RewriteEngine on RewriteRule ^gameofthrones/(full|house|characters)\.(all|Stark|Lannister)\.(html|xml|json)$ index.php?output=$3&house=$2&info=$1 </IfModule> But when I enter this url: localhost/school/str-webservices/eindopdracht/index.php?output=html&house=all&info=full It stays that way, but it should be something like: localhost/school/str-webservices/eindopdracht/gameofthrones/full/all/html What am I doing wrong? Thanks in advance, Mark

    Read the article

  • Most efficient method of generating PNG as HTTP response

    - by awj
    I've built an ASP.NET page whose output stream is a dynamically-generated PNG image containing only text on a transparent background. The text is based upon database IDs contained in the querystring. There will be a limited number of variations. Which one of the following would be the most efficient means of returning the image to the client? Store each variation upon the first generation, and thenceforth retrieve this from the drive. Simply generate the image each time. Cache the output response based upon the querystring.

    Read the article

  • Temporary animations

    - by Max
    I've been trying to find a tutorial on how to best make animations in Android. I already have some animations for my enemies and my character that are controlled by rectangles and changing rectangleframe between updates using a picture like this: When I'm shooting my enemies they lose HP, and when their HP == 0 they get removed. aslong as im using an arrayList (which I do for all enemies and bullets) I'm fine, since I can just use list.remove(i). But when I'm on a boss-level and the Boss's HP == 0, I want to remove him and play an animation of an explosion of stars before the "End-screen". Is there a preferred way to do temporary animations like this? If you can give me an example or redirect me to a tutorial, I'd be really grateful!

    Read the article

  • CakePHP Form Helper - Show error class, but not error message

    - by Jeremy Penrod
    I'm attempting to customize the error output on the CakePHP 2.0 form helper. Currently, the form renders error messages below the input and applies an 'error' class to the input's label. I have found that I can either disable error reporting altogether for an input, or output the error class and message. I would like the error class to be applied to the label of the offending inputs WITHOUT any message below. How do you turn off the error message outputting for a form, BUT still apply error classes to offending labels?

    Read the article

  • Is there a way to specify java annotations in antlr grammar files?

    - by Steve B.
    I'm looking for a way to include a few additional strings in output .java files generated from antlr. Is there a comprehensive listing of available directives? For example, given parser output like this: package com.foo.bar; //<-- this can be generated with @header { .... } //antlr generated import org.antlr.runtime.*; ... //<-- is there a way to generate anything here? public class MyParser { //<--- or here? public void f1(){ ... } } Is there a way to generate strings that appear after the import statements (e.g. class-level annotations) or possibly method annotations?

    Read the article

  • Linux How to print all the files with the same prefix after searching for them?

    - by Alyx
    I need to search through a directory which contains many sub directories, each which contain files. The files read as follows question1234_01, where 1234 are random digits and the suffix _01 is the number of messages that contain the prefix, meaning they are apart of the same continuing thread. find . -name 'quest*' | cut -d_ -f1 | awk '{print $1}' | uniq -c | sort -n example output: 1 quest1234 10 quest1523 This searches for all the files then sorts them in order. What I want to do is print all the files which end up having the most occurrences, in my example the one with 10 matches. So it should only output quest1523_01 - 11

    Read the article

  • Detecting when a process has finished (but not exited)

    - by Egwor
    I have a program that's run in unix (that I have no control over) that when finished prints 'Completed successfully' but does not exit. I want to automatically detect when the process finishes (by checking the output of the command), so that I can kill the process and so that I can proceed do other activities. The complexity comes because I want to be able to run multiples of these scripts concurrently. (One activity I need to do requires the script to be called with various inputs, but each time the script runs it takes a while to return, and so I want to do them in parallel) Has anyone done something similar to this? I could redirect the stderr and stdout output of the command to a temporary file which has a random file name, then tail the file and pipe to grep for the end conditions (I.e. the certain log lines). The problem is, surely tail -f would keep running, and so it would never exit. Should I poll? If so, what's the best approach?

    Read the article

  • Mysql query problem

    - by Lost_in_code
    Below is a sample table: fruits +-------+---------+ | id | type | +-------+---------+ | 1 | apple | | 2 | orange | | 3 | banana | | 4 | apple | | 5 | apple | | 6 | apple | | 7 | orange | | 8 | apple | | 9 | apple | | 10 | banana | +-------+---------+ Following are the two queries of interest: SELECT * FROM fruits WHERE type='apple' LIMIT 2; SELECT COUNT(*) AS total FROM fruits WHERE type='apple'; // output 6 I want to combine these two queries so that the results looks like this: +-------+---------+---------+ | id | type | total | +-------+---------+---------+ | 1 | apple | 6 | | 4 | apple | 6 | +-------+---------+---------+ The output has to be limited to 2 records but it should also contain the total number of records of the type apple. How can this be done with 1 query?

    Read the article

  • Increment number in string

    - by iform
    Hi, I am stumped... I am trying to get the following output until a certain condition is met. test_1.jpg test_2.jpg .. test_50.jpg The solution (if you could remotely call it that) that I have is fileCount = 0 while (os.path.exists(dstPath)): fileCount += 1 parts = os.path.splitext(dstPath) dstPath = "%s_%d%s" % (parts[0], fileCount, parts[1]) however...this produces the following output. test_1.jpg test_1_2.jpg test_1_2_3.jpg .....etc The Question: How do I get change the number in its current place (without appending numbers to the end)? Ps. I'm using this for a file renaming tool.

    Read the article

  • how to find and add a string to a file in linux

    - by user2951644
    How can I check a file for a string if missing the string automatically add it for example Input Input file test.txt this is a test text for testing purpose this is a test for testing purpose this is a test for testing purpose this is a test text for testing purpose I would like to add "text" to all the lines Desired Output this is a test text for testing purpose this is a test text for testing purpose this is a test text for testing purpose this is a test text for testing purpose Is it possible? many thanks in advance Hi guys thanks for all the help, for my case is not that simple. I wont know which line will be different and in the middle string it will not only have a single string. i will give a clearer case Input file test.txt Group: IT_DEPT,VIP Role: Viewer Dept: IT Group: IT_DEPT,VIP Dept: IT Group: FINANCE LOAN VIEWER Role: Viewer Dept: FINANCE Group: FINANCE LOAN VIEWER Dept: FINANCE Desired output file test2.txt Group: IT_DEPT,VIP Role: Viewer Dept: IT Group: IT_DEPT,VIP Role: - Dept: IT Group: FINANCE LOAN VIEWER Role: Viewer Dept: FINANCE Group: FINANCE LOAN VIEWER Role: - Dept: FINANCE So those that are missing "Role:" will be added "Role: - ", hope this clear things out, thanks in advance again

    Read the article

  • Python structure mistake

    - by jaddy123
    I'm writing a program in which I can Reverse the sequence and Replace all As with Ts, all Cs with Gs, all Gs with Cs, and all Ts with As. the program is to read a sequence of bases and output the reverse complement sequence. I am having trouble to do it so can anyone please help me with this by having a look on my code: word = raw_input("Enter sequence: ") a = word.replace('A', 'T') b = word.replace('C', 'G') c = word.replace('G', 'C') d = word.replace('T', 'A') if a == word and b == word and c == word and d == word: print "Reverse complement sequence: ", word And I want this sort of output: Enter sequence: CGGTGATGCAAGG Reverse complement sequence: CCTTGCATCACCG Regards

    Read the article

  • Is apparent NULL pointer dereference in C actually pointer arithmetic?

    - by karthik A
    hey ive got this piece of code. It dereferences a null pointer here. But then there is an and with unsigned int. I really dont understand the whole part. Can someone explain the output.?? struct hi { long a; int b; long c; }; int main() { struct hi ob={3,4,5}; struct hi *ptr=&ob; int num= (unsigned int) & (((struct hi *)0)->b); printf("%d",num); printf("%d",*(int *)((char *)ptr + (unsigned int) & (((struct hi *)0)->b))); } The output I get is 44. But how does it work?

    Read the article

  • PHP exec problem with s3-put

    - by schneck
    Hi there, I use the s3-bash-project to upload data to an S3-Bucket. My command looks like this: /mypath/s3_bash/s3-put -v -k '123456789' -s '/mypath/secret' -T '/mypath/upload/myuploadfile' '/my.bucket/mykeyname' I can run the command from the command line (Mac OS X), and it works well. Now I want to execute it from a PHP-Script: exec($command, $output); but in output, the "s3-put"-command only returns the command's help text. I log the command, and it works if I c&p it from the log the the command line, so there not a problem. It seems that PHP does not pass all the parameters to the command line, although I run escapeshellarg() over all the parameters. I'm using a local XAMPP-Test environment, safe_mode is off. Any ideas?

    Read the article

  • How can I get the JSON array data from nsstring or byte in xcode 4.2?

    - by user1471568
    I'm trying to get values from nsdata class and doesn't work. here is my JSON data. { "count": 3, "item": [{ "id": "1", "latitude": "37.556811", "longitude": "126.922015", "imgUrl": "http://175.211.62.15/sample_res/1.jpg", "found": false }, { "id": "3", "latitude": "37.556203", "longitude": "126.922629", "imgUrl": "http://175.211.62.15/sample_res/3.jpg", "found": false }, { "id": "2", "latitude": "37.556985", "longitude": "126.92286", "imgUrl": "http://175.211.62.15/sample_res/2.jpg", "found": false }] } and here is my code -(NSDictionary *)getDataFromItemList { NSData *dataBody = [[NSData alloc] initWithBytes:buffer length:sizeof(buffer)]; NSDictionary *iTem = [[NSDictionary alloc]init]; iTem = [NSJSONSerialization JSONObjectWithData:dataBody options:NSJSONReadingMutableContainers error:nil]; NSLog(@"id = %@",[iTem objectForKey:@"id"]); //for Test output = [[NSString alloc] initWithBytes:buffer length:rangeHeader.length encoding:NSUTF8StringEncoding]; NSLog(@"%@",output); return iTem; } how can I access every value in the JSON? Please help me.

    Read the article

  • Find -type d with no subfolders

    - by titatom
    Good morning ! This is a simple one I believe, but I am still a noob :) I am trying to find all folders with a certain name. I am able to do this with the command find /path/to/look/in/ -type d | grep .texturedata The output gives me lots of folders like this : /path/to/look/in/.texturedata/v037/animBMP But I would like it to stop at .texturedata : /path/to/look/in/.texturedata/ I have hundreds of these paths and would like to lock them down by piping the output of grep into chmod 000 I was given a command with the argument -dpe once, but I have no idea what it does and the Internet has not be able to help me determine it's usage Thanks you very much for your help !

    Read the article

  • multiple languages same pages shall I change the page URL path as well?

    - by Athanatos
    We own multiple country code top-level domains for our website e.g DE, UK ,FR. When someone visits for one of those domains they redirect to .com and the language automatically changes for the first time to the one from the originating domain. Also users can change the language from the .com website using a dropdown, however the page URI stays exactly the same e.g service.php. How will that be indexed in Google ? Will all the different language will be indexed or only the default lang (English) ? Is it recommended for SEO purposes to do something with the page URL (even using the htaccess maybe) so that I can also append to the title or page name the language ? e.g service.php?lang=fr

    Read the article

  • Getting Null value with JSON from MySQL, how to retrive data from MySQL to JSON correctly?

    - by sky
    I'm using following code but cannot return data from MySQL. This is the output: <script type="text/javascript"> var somethings= [null,null,null]; </script> It does have three post, but I couldn't get the title(message) output. EDIT: this is the code I'm using: <?php $session = mysql_connect('localhost','name','pass'); mysql_select_db('dbname', $session); $result= mysql_query('SELECT * FROM posts', $session); $somethings= array(); while ($row= mysql_fetch_assoc($result)) { $somethings[]= $row['something']; } ?> <script type="text/javascript"> var somethings= <?php echo json_encode($somethings); ?>; </script> This is the table: message Try iPhone post! Welcome to Yo~ :) ??!

    Read the article

< Previous Page | 298 299 300 301 302 303 304 305 306 307 308 309  | Next Page >