Search Results

Search found 10798 results on 432 pages for 'port scanning'.

Page 31/432 | < Previous Page | 27 28 29 30 31 32 33 34 35 36 37 38  | Next Page >

  • How to access a port via OpenVpn only

    - by Andy M
    I've set up an openvpn server alongside an apache website that can only be accessed on port 8100 on the same machine. My /etc/openvpn/server.conf file looks like this: port 1194 proto tcp dev tun ca ./easy-rsa2/keys/ca.crt cert ./easy-rsa2/keys/server.crt key ./easy-rsa2/keys/server.key # This file should be kept secret dh ./easy-rsa2/keys/dh1024.pem # Diffie-Hellman parameter server 10.8.0.0 255.255.255.0 ifconfig-pool-persist ipp.txt # make sure clients can still connect to the internet push "redirect-gateway def1 bypass-dhcp" keepalive 10 120 comp-lzo persist-key persist-tun status openvpn-status.log verb 3 Now I tried to let only clients connected to the vpn network access the website on apache via port 8100. So I defined a few iptables rules: #!/bin/sh # My system IP/set ip address of server SERVER_IP="192.168.0.2" # Flushing all rules iptables -F iptables -X # Setting default filter policy iptables -P INPUT DROP iptables -P OUTPUT DROP iptables -P FORWARD DROP # Allow incoming access to port 8100 from OpenVPN 10.8.0.1 iptables -A INPUT -i tun0 -p tcp --dport 80 -m state --state NEW,ESTABLISHED -j ACCEPT iptables -A OUTPUT -o tun0 -p tcp --sport 80 -m state --state ESTABLISHED -j ACCEPT # outgoing http iptables -A OUTPUT -o tun0 -p tcp --dport 80 -m state --state NEW,ESTABLISHED -j ACCEPT iptables -A INPUT -i tun0 -p tcp --sport 80 -m state --state ESTABLISHED -j ACCEPT Now when I connect to the server from my client computer and try to access the website on 192.168.0.2:8100, my browser can't open it. Will I have to forward traffic from tun0 to eth0? Or is there anything else I'm missing?

    Read the article

  • Ubuntu 12.04 open port 80 inside WLAN

    - by Eduard
    I have an nginx server running on ubuntu 12.04 that serves http through port 80 and https through port 443. Everything works fine if I access it from the same computer via localhost, 127.0.0.1 or the local IP 192.168.0.11. If I try to access the server from another computer in the same VLAN it does not work for http; it works for https. I have changed my nginx configuration to also listen to port 8000 for http; I can then access http from the other computer in the same VLAN via "http://192.168.0.11:8000". I also have a web server running on port 80 on a windows machine and can access it from another device in the same VLAN, therefore the router is not blocking incoming http traffic. The nginx process is run by root. I have used tcpdump and I see that packets are arriving to Ubuntu: 192.168.0.16.49735 192.168.0.11.80 and that some response is being given 192.168.0.11.80 192.168.0.16.49735 (I do not know what the response is though). There is no request arriving at the nginx web server (I have checked the access log). I have iptables empty. I have unsuccessfully tried to find a solution for a long time to this, it has now become a matter of happiness or bitterness :).

    Read the article

  • Controlling QR Code Scanning Actions

    - by Elijah
    I am looking to create a QR code that does the following: When scanned from inside an application, it dislpays a custom alert, (Ex. "You won $5") When scanned with a different QR code reader (non app) it goes to a mobile web page that directs the user to download the application. My main question is: Can you control what happens when a QR code is scanned by a reader that is not your own? (A 'default' action, if you will)

    Read the article

  • Specify directory for tasks scanning in Netbeans

    - by hsz
    Hello ! Is it possible in Netbeans to specify a list of directories that it should scan for tasks (@todo) ? I want to be able to exclude some subdirectories from my project - for example /lib/Zend - and only allow to scan /lib/Cms /config /app ... Is it possible to do this ?

    Read the article

  • Hibernate configuration - session factory scanning?

    - by Marcus
    We have this hibernate.cfg.xml file. Is there a way to tell Hibernate to just scan a directory instead of having to add an entry here for each class? <hibernate-configuration> <session-factory> <mapping class="com.abc.domain.model.A" /> <mapping class="com.abc.domain.model.B" /> <mapping class="com.abc.domain.model.C" /> <mapping class="com.abc.domain.model.D" /> <mapping class="com.abc.domain.model.E" /> </session-factory> </hibernate-configuration>

    Read the article

  • What does opening a serial port do?

    - by reve_etrange
    What does opening the standard PC serial port do, in electrical terms (i.e. what voltages on which pins)? For example, the ancient VB6 program which controls an apparatus I am tasked with maintaining toggles .PortOpen to control some TTL. The connection only used 2 pins (bad solders fell apart), so which pins do I solder to? The only labels / documentation refer to pins 7 and 9, saying 0V and 5V parenthetically, but does .PortOpen really just put 5V between RI and RTS?. As a post script, this isn't the weirdest thing about the set up. The TTL I referred to above also connects to an instrument via a BNC to DB9 (!), with only 1 pin used. I guess there was an assumption about a common ground, since the BNC shielding isn't connected to the GND pin? The connection is to the instrument's 'foot pedal' pin, it was a way to remotely trigger the device. Update According to this page, the DTR and RTS pins can go high when the port is opened. If they were so configured, they will subsequently go low when the port is closed. If DTR and RTS are not enabled, opening the port should set both to low (and keep them low).

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Scanning string in perl

    - by Alphaneo
    What is the best way to achieve sscanf like functionality in perl? I am looking now looking at the sscanf module, Which is better, Option-1: Going sscanf way? Option-2: Regex way? [I am a beginner when it comes to Regex]

    Read the article

  • Svchost.exe connecting to different IPs with remote port 445

    - by Coll911
    Im using Windows XP Professional SP2. Whenever I start my Windows, svchost.exe starts connecting to all the possible IPs on LAN like from 192.168.1.2 to 192.168.1.200. The local port ranges from 1000-1099 and the remote port being 445. After it's done with the local IPs, it starts connecting to other random IPs. I tried blocking connections to the port 445 using the local security polices but it didn't work. Is there any possible way I could prevent svchost from connecting to these IPs without involving any firewall installed? My PC slows down due to the load. I scanned my PC with MalwareBytes and found out it was infected with a worm, it's deleted now but still svchost is connecting to the IPs. I also found out that in my Windows Firewall settings, under Internet Control Message Protocol (ICMP), there's a tick on "allow incoming echo request" (usually disabled) which is locked and I can't disable it. Its description is as follows Messages sent to this computer will be repeated back to the sender. This is used for trouble shooting for e.g to ping a machine. Requests of this type are automatically allowed if TCP port 445 is enabled. Any solutions? I can't bear going with the reinstalling Windows phase again.

    Read the article

  • I can't change mysql port (5.6.12) changing the lines of my.ini (windows 8)

    - by videador
    I was trying to change the port of my mysql server in my local machine but i can't. The version of mysql is 5.6.12, is an installation from wamp and I am on Windows 8. I change these lines in my my.ini file located in (C:\wamp\bin\mysql\mysql5.6.12). [client] #password = your_password port = 3307 socket = /tmp/mysql.sock [wampmysqld] port = 3307 socket = /tmp/mysql.sock key_buffer = 16M max_allowed_packet = 1M The previous values were 3306. Ok then I've reset the server installed, but it doesn't works, the mysql server is still running on 3306. Then, I rename the path of the services with this, to make sure that the my.ini is read by the mysql instance. c:\wamp\bin\mysql\mysql5.6.12\bin\mysqld.exe --defaults-file="C:\wamp\bin\mysql\mysql5.6.12\my.ini" wampmysqld But nothing, it stil doesn't works. My last bullet was to copy the content of my.ini to a file my-default.ini (a file that is placed in C:\wamp\bin\mysql\mysql5.6.12\ and that I don't know what is its mission). However it still doesn't work and the port is still 3306.

    Read the article

  • C/C++: Scanning a TIFF file using LIBTIFF

    - by Matt07
    My problem is to scan a tiff image in C and get all the pixel value (let's say for saving them in a txt file) in C/C++. I scanned the web and i found a library named "TIFFLIB" that should do what i was looking for. I downloaded it using the ubuntu package manager, but the gcc doesn't recognize the library. How do i link the library to the compiler? Have I installed it correctly? Is there any better/easier way to do that?

    Read the article

  • Redirect traffic from 127.0.0.1 to 127.0.0.1 on port 53 to port 5300 with iptables

    - by Zagorax
    I'm running a local dns server on port 5300 to develop a software. I need my machine to use that dns but I wasn't able to tell /etc/resolv.conf to check on a different port. I searched a bit on google and I didn't find a solution. I set 127.0.0.1 as nameserver on /etc/resolv.conf. This is my whole /etc/resolv.conf: nameserver 127.0.0.1 Could you please tell me how can I redirect outbound traffic on port 53 to another port? I tried the following but it didn't work: iptables -t nat -A PREROUTING -p tcp --dport 53 -j DNAT --to 127.0.0.1:5300 iptables -t nat -A PREROUTING -p udp --dport 53 -j DNAT --to 127.0.0.1:5300 Here is the output of iptables -t nat -L -v -n (with suggested rules): Chain PREROUTING (policy ACCEPT 0 packets, 0 bytes) pkts bytes target prot opt in out source destination 0 0 REDIRECT tcp -- * * 0.0.0.0/0 0.0.0.0/0 tcp dpt:53 redir ports 5300 0 0 REDIRECT udp -- * * 0.0.0.0/0 0.0.0.0/0 udp dpt:53 redir ports 5300 Chain POSTROUTING (policy ACCEPT 302 packets, 19213 bytes) pkts bytes target prot opt in out source destination Chain OUTPUT (policy ACCEPT 302 packets, 19213 bytes) pkts bytes target prot opt in out source destination

    Read the article

  • PortForwarding to IIS in Linux

    - by Simon
    Hi, I am trying to set up port forwarding on a linux box to a IIS webserver on my internal network. The web server sits on Windows 2003 Server. My linux box has eth0 - Internet connection eth1 - internal subnet (10.10.10.x) eth2 - 2nd internal subnet (129.168.0.x) dhcp interface my webserver is on the eth2 interface (192.168.0.6) I am doing port forwarding for port 80 with no avail. I use the same set of rules to port forward to a different webserver and it works. The webapplication is available on the internal network but not for external users. iptables -t nat -A PREROUTING -p tcp -i eth0 -d $PUBLIC_IP --dport 80 -j DNAT --to 192.168.0.6:80 iptables -A FORWARD -p tcp -i eth0 -o eth2 -d 192.168.0.6 --dport 80 -m state --state NEW -j ACCEPT iptables -A FORWARD -t filter -o eth0 -m state --state NEW,ESTABLISHED,RELATED -j ACCEPT iptables -A FORWARD -t filter -i eth0 -m state --state ESTABLISHED,RELATED -j ACCEPT iptables -t nat -A POSTROUTING -o eth0 -j MASQUERADE Any Ideas?

    Read the article

  • One IP, One Port, Multiple Servers

    - by Adrian Godong
    I am looking for a solution to forward one public IP address and one specific port to different machines based on hostname (as of now, I need it only for HTTP). The current setup is NAT on a commodity router (it only provide simple public port to private IP address / port forwarding). I can add a Windows Server 2008 R2 machine before the router if required, but prefer not to do so. So ideally, I would like to have the current setup and the forwarding is done on one of the Windows Servers. Is it possible to do this?

    Read the article

  • Custom BizTalk, Orchestration SMTP Adapter Dynamic send port

    How to build a BizTalk application that will allow run time configuration and sending of SMTP email from within an orchestration  read moreBy BiZTech KnowDid you know that DotNetSlackers also publishes .net articles written by top known .net Authors? We already have over 80 articles in several categories including Silverlight. Take a look: here.

    Read the article

  • Dedicated NIC or dedicated port for iSCSI?

    - by Newt
    When spec'ing and configuring a machine that will utilise shared iSCSI storage, I've read a lot of documentation which suggests a dedicated network adapter should be used for iSCSI communication. That makes a lot of sense and I have no problem with it. The question I do have, is this - should that suggestion be taken to mean that a separate physical NIC should be used, or will a dedicated port/ports on a dual/quad port NIC be just as good? My suspicion is that simply using dedicated port(s) on a shared NIC would be just as good. Any input greatly appreciated.

    Read the article

  • Port forwarding (portmap) works only locally

    - by Tag Wint
    There are four hosts hostA winXP hostB Win2003 hostC Linux RHEL hostD Linux RHEL hostA cannot connect to C and D directly, but B can hostA connects to hostB using VPN hostB and hostC belong to the same subnet1 hostD is in subnet2 From hostA I need to connect to hostC and hostD by SSH. Now I can do it as follows: 1.connecting from hostA to hostB by RDP logon and there: 2.start putty client. I'd like to omit step 1 and connect from A to C and D directly On hostB I have admin acoount and configure port forwarding as follows: netsh interface portproxy add v4tov4 listenport=N1 connectaddress=hostC_IP connectport=N2 netsh interface portproxy add v4tov4 listenport=N3 connectaddress=hostD_IP connectport=N2 netsh interface portproxy show all: Listen on IPv4: Connect to IPv4: Address Port Address Port --------------- ---------- --------------- ---------- * N1 hostC_IP N2 * N3 hostD_IP N2 Now from hostB I can connect to either C and D: ssh localhost:N1 ssh localhost:N3 from hostA ssh hostB:N1 works too, but ssh hostB:N3 DON'T I guess the reason might be different subnets, still have no idea how to fix it. What should I do?

    Read the article

  • Re-Route Mail to a port other than 25

    - by Ken
    Is there a way to route mail to another port? I have an email account attached to my laptop that I'd like to be able to send and receive mail from. Due to mobility, I'll be passing through various networks that will probably block this port. My dynamic DNS provider allows me to utilize web-forwards for MX domains; is this possible? where I can web forward to a domain:port which is managed by my DNS provider when I traverse between networks. If not, is there a way? Of course i could use web-mail or relay-forwarding from my home server, but that's not geeky enough.

    Read the article

  • Running multiple services on Port 443, Tunnel SSH over HTTPS

    - by lajuette
    Situation: I want to tunnel SSH sessions through HTTPS. I have a very restrictive firewall/proxy which only allows HTTP, FTP and HTTPS traffic. What works: Setting up a tunnel through the proxy to a remote linux box that has a sshd listening at port 443 The problem: I have to have a web server (lighty) running at port 443. HTTPS traffic to other ports is forbidden by the proxy. Ideas so far: Set up a virtual host and proxy all incoming requests to localhost: (e.g. 22) $HTTP["host"] == "tunnel.mylinux.box" { proxy.server = ( "" => (("host" => "127.0.0.1", "port" => 22)) ) } Unfortunately this won't work. Am i doing something wrong, or is there a reason, that this won't work?

    Read the article

  • Trouble with setting up Mac SSH with TP-LINK router

    - by arxanas
    I have a Mac running OS X 10.7.2, and a TP-Link TL-WR740N (whose control panel looks like this). Remote Login is on in the Mac's System Preferences, and port 22 is set to forward on the router. I can access my Mac as a web server using the external IP on port 80, which I have set up through the same port-forwarding mechanism provided by the router, but when I try to ssh server@external-ip, it just times out after a long while. (The same thing happens when I try vnc.) I can, however, ssh and vnc successfully into that computer while I'm on the same network when using its internal IP. Since ssh appears to work and port forwarding appears to work, I can't figure out what's causing the problem. Does anyone have any idea what might cause this?

    Read the article

  • Custom BizTalk, Orchestration SMTP Adapter Dynamic send port

    How to build a BizTalk application that will allow run time configuration and sending of SMTP email from within an orchestration  read moreBy BiZTech KnowDid you know that DotNetSlackers also publishes .net articles written by top known .net Authors? We already have over 80 articles in several categories including Silverlight. Take a look: here.

    Read the article

  • Dell PR03X port replicator and DisplayPort to DVI adapter not detecting second monitor

    - by yothenberg
    I have a Dell M4400 connected to a PR03X port replicator/docking station. I use the DVI port to connect it to a first Dell 2208WFP monitor and I'm trying to use a DisplayPort-to-DVI adapter to connect it to a second Dell 2208WFP monitor. The second monitor, connected via the DisplayPort-to-DVI adapter immediately goes into sleep mode and the laptop doesn't detect it. What is really weird is that it did detect it the first time I plugged it in but after I unplugged the monitor and plugged it back in it stopped working. I swapped the monitors round and it detected them both but after unplugging the monitor connected via the DisplayPort-to-DVI and plugging it in again it stopped working. Both monitors work if plugged in directly to the DVI port. Is there some way to force re-detection? Any ideas?

    Read the article

  • Url rewriting stops working after changing default port on iis7

    - by Somesh
    I have migrated the IIS6 webserver 2003 websites to IIS7 webserver 2008 using msdeploy tool. Application pool setting are changed with "Enable 32-bit Applications=true", "Managed_Pipeline_Mode=Classic","Identity=NetworkService" Framework=v1.1/2.0. All the websites are working fine on default port along with url rewriting migrated from iis6. When I start the webserver on port other than default port by changing bindings, url rewriting stops workings and get 404 error in logs. I think I don't have to change the handler mapping cause I am running it in classic mode. How can I troubleshoot this?

    Read the article

< Previous Page | 27 28 29 30 31 32 33 34 35 36 37 38  | Next Page >