Search Results

Search found 29101 results on 1165 pages for 'open basedir'.

Page 316/1165 | < Previous Page | 312 313 314 315 316 317 318 319 320 321 322 323  | Next Page >

  • Including configuration files while compiling a Flex application with MXMLC

    - by Daniel
    Hello there, I'm using: - Flex SDK 3.5.0 - Parsley 2.2.2. - Flash Builder 4 Down in my src folder (which is configured as part of the source path in the Flash Builder), I have a logging.xml which I configure via Parsley: FlexLoggingXmlSupport.initialize(); XmlContextBuilder.build("com/company/product/util/log/logging.xml"); When I run my application through Flash Builder, the XmlContentBuilder seems to locate the logging.xml (the implementation is a regular URLLoader one). When I compile my application using MXMLC (whether in Ant or command-line), and then run the swf, I get the following error: Cause(0): Error loading com/company/product/util/log/logging.xml: Error in URLLoader - cause: Error #2032: Stream Error. URL: file:///C|/workspace/folder01/product/target/com/company/product/util/log/logging.xml - cause: Error #2032: Stream Error. URL: file:///C|/workspace/folder01/product/target/com/company/product/util/log/logging.xml Here is the MXMLC tag in Ant: <mxmlc file="${product.src.dir}/com/company/product/view/Main.mxml" output="${product.target.dir}/${product.release.filename}" keep-generated-actionscript="false"> <load-config filename="${FLEX_HOME}/frameworks/flex-config.xml" /> <!-- source paths --> <source-path path-element="${FLEX_HOME}/frameworks" /> <compiler.source-path path-element="${product.src.dir}" /> <compiler.source-path path-element="${product.locale.dir}/{locale}" /> <compiler.library-path dir="${product.basedir}" append="true"> <include name="libs" /> </compiler.library-path> <warnings>false</warnings> <debug>false</debug> </mxmlc> And here is the command line: \mxmlc.exe -output "C:\temp\Rap.swf" -load-config "C:\Program Files\Adobe\Adobe Flash Builder 4 Plug-in\sdks\3.5.0\frameworks\flex-config.xml" -source-path "C:\Program Files\Adobe\Adobe Flash Builder 4 Plug-in\sdks\3.5.0\frameworks" C:\workspace\folder01\product\src C:\workspace\folder01\product\locale\en_US -library-path+=C:\workspace\folder01\product\libs -file-specs C:\workspace\folder01\product\src\com\company\product\view\main.mxml Now perhaps I don't get this correctly, but as far as I understand the SWF should be compiled with all of the resources in the paths I give MXMLC as source-paths. For some reason it seems that the XML file is not compiled into the SWF, hence the relative path of the XmlContentBuilder isn't located successfully. I could not find any argument to provide the MXMLC with that might solve this. I tried using the -dump-config option with the Flash Builder's compiler, then giving that configuration to MXMLC, but it didn't work either. I tried providing the XmlContentBuilder with an absolute path. That worked fine when I compiled with MXMLC via Ant, but still didn't work when I used MXMLC in the command-line... I'd be happy to be enlightened here, regarding all subjects - using MXMLC, accessing resources with relative paths, configuring logging in Parsley, etc. Many thanks in advance, Daniel

    Read the article

  • Error running java -jar command

    - by dmantamp
    Hi all, I created a jar file using the following ANT script <manifestclasspath property="jar.classpath" jarfile="${bin.dir}/${jar.app.name}" maxparentlevels="0"> <classpath refid="main.class.path" /> </manifestclasspath> <target name="jar"> <mkdir dir="${build.dir}/lib/isp"/> <mkdir dir="${build.dir}/lib/jasper"/> <copy todir="${build.dir}/lib/jasper"> <fileset dir="${lib.jasper.dir}"> <include name="**/*.jar" /> </fileset> </copy> <copy todir="${build.dir}/lib/isp"> <fileset dir="${lib.isp.dir}"> <include name="**/*.jar" /> </fileset> </copy> <jar jarfile="${bin.dir}/${jar.app.name}" index="true" basedir="${classes.dir}" excludes="lib/mytest.jar " > <manifest> <attribute name="Main-Class" value="${main.class}" /> <attribute name="Class-Path" value="${jar.classpath}" /> </manifest> </jar> </target> The resulting jar file has the following MANIFEST.MF entry. Main-Class: dm.jb.Main Class-Path: lib/isp/OfficeLnFs_2.2.jar lib/isp/RXTXcomm.jar lib/isp/ba rbecue-1.0.6d.jar lib/isp/commons-logging-1.1.jar lib/isp/forms-1.0.5 .jar lib/isp/gnujaxp.jar lib/isp/helpUI.jar lib/isp/inspInstaller.jar lib/isp/itext-2.0.1.jar lib/isp/itext-2.0.2.jar lib/isp/jcalendar-1. 3.2.jar lib/isp/jcl.jar lib/isp/jcommon-1.0.10.jar lib/isp/jcommon-1. 0.9.jar lib/isp/jdnc-0_7-all.jar lib/isp/jdnc-runner.jar lib/isp/jdom .jar lib/isp/jfreechart-1.0.6.jar lib/isp/jlfgr-1_0.jar lib/isp/junit .jar lib/isp/log4j-1.2.9.jar lib/isp/looks-1.3.2.jar lib/isp/msbase.j ar lib/isp/mssqlserver.jar lib/isp/msutil.jar lib/isp/mysql-connector When I try to run the command java -jar mytest.jar, it fails and throws error saying dm.jb.Main not found. But I could run the class by specifying the classpath java -classpath dm.jb.Main Please help me DM

    Read the article

  • Problem in Rail Casts Episode 190

    - by Gautam
    Hello, This is the code I have written require 'rubygems' require 'nokogiri' require 'open-uri' url = "http://timesofindia.indiatimes.com/rssfeeds/-2128838597.cms" doc = Nokogiri::HTML(open(url)) puts doc.at_css("title").text and I am getting this output. I have installed Nokogiri. I use Windows 7 C:\Ruby>ruby hello.rb C:/Ruby/lib/ruby/gems/1.9.1/gems/nokogiri-1.4.2-x86-mingw32/lib/nokogiri/nokogiri.rb:1:in `require': 127: The specified procedure could not be found. - Init_nokogiri (LoadError) C:/Ruby/lib/ruby/gems/1.9.1/gems/nokogiri-1.4.2-x86-mingw32/lib/nokogiri/1.9/nokogiri.so from C:/Ruby/lib/ruby/gems/1.9.1/gems/nokogiri-1.4.2-x86-mingw32/lib/nokogiri/nokogiri.rb:1:in `<top (required)>' from C:/Ruby/lib/ruby/gems/1.9.1/gems/nokogiri-1.4.2-x86-mingw32/lib/nokogiri.rb:13:in `require' from C:/Ruby/lib/ruby/gems/1.9.1/gems/nokogiri-1.4.2-x86-mingw32/lib/nokogiri.rb:13:in `<top (required)>' from hello.rb:2:in `require' from hello.rb:2:in `<main>'

    Read the article

  • Firefox-Addon: Restart and save all current tabs and windows

    - by nokturnal
    Hello guys / gals, First off, this is my first attempt at writing an add-on. That being said, I am attempting to write an add-on that makes some configuration changes and needs to restart Firefox in order to have the changes take effect. I am currently restarting Firefox using the following code: var boot = Components.classes["@mozilla.org/toolkit/app-startup;1"].getService(Components.interfaces.nsIAppStartup); boot.quit(Components.interfaces.nsIAppStartup.eForceQuit|Components.interfaces.nsIAppStartup.eRestart); The problem is, it restarts and opens the browser window(s) to whatever the users homepage is currently set to. I want it to re-open all windows / tabs that were previously open before the restart (similar to what happens when you install a new add-on). Anyone ever messed with this type of functionality before?

    Read the article

  • glassfish v3.0 hangs no app is ever deployed and no error is ever shown

    - by Samuel Lopez
    I have a web app that uses JSF 2.0 with richFaces and primeFaces, hibernate and java and I use NetBeans 7.1.2 as the IDE when I run the app the glassfish server is started and the log shows this: Launching GlassFish on Felix platform Información: Running GlassFish Version: GlassFish Server Open Source Edition 3.1.2 (build 23) Información: Grizzly Framework 1.9.46 started in: 20ms - bound to [0.0.0.0:4848] Información: Grizzly Framework 1.9.46 started in: 32ms - bound to [0.0.0.0:8181] Información: Grizzly Framework 1.9.46 started in: 59ms - bound to [0.0.0.0:8080] Información: Grizzly Framework 1.9.46 started in: 32ms - bound to [0.0.0.0:3700] Información: Grizzly Framework 1.9.46 started in: 21ms - bound to [0.0.0.0:7676] Información: Registered org.glassfish.ha.store.adapter.cache.ShoalBackingStoreProxy for persistence-type = replicated in BackingStoreFactoryRegistry Información: SEC1002: Security Manager is OFF. Información: SEC1010: Entering Security Startup Service Información: SEC1143: Loading policy provider com.sun.enterprise.security.provider.PolicyWrapper. Información: SEC1115: Realm [admin-realm] of classtype [com.sun.enterprise.security.auth.realm.file.FileRealm] successfully created. Información: SEC1115: Realm [file] of classtype [com.sun.enterprise.security.auth.realm.file.FileRealm] successfully created. Información: SEC1115: Realm [certificate] of classtype [com.sun.enterprise.security.auth.realm.certificate.CertificateRealm] successfully created. Información: SEC1011: Security Service(s) Started Successfully Información: WEB0169: Created HTTP listener [http-listener-1] on host/port [0.0.0.0:8080] Información: WEB0169: Created HTTP listener [http-listener-2] on host/port [0.0.0.0:8181] Información: WEB0169: Created HTTP listener [admin-listener] on host/port [0.0.0.0:4848] Información: WEB0171: Created virtual server [server] Información: WEB0171: Created virtual server [__asadmin] Información: WEB0172: Virtual server [server] loaded default web module [] Información: Inicializando Mojarra 2.1.6 (SNAPSHOT 20111206) para el contexto '/test' Información: Hibernate Validator 4.2.0.Final Información: WEB0671: Loading application [test] at [/test] Información: CORE10010: Loading application test done in 4,885 ms Información: GlassFish Server Open Source Edition 3.1.2 (23) startup time : Felix (1,848ms), startup services(5,600ms), total(7,448ms) Información: JMX005: JMXStartupService had Started JMXConnector on JMXService URL service:jmx:rmi://SJ007:8686/jndi/rmi://SJ007:8686/jmxrmi Información: WEB0169: Created HTTP listener [http-listener-1] on host/port [0.0.0.0:8080] Información: Grizzly Framework 1.9.46 started in: 14ms - bound to [0.0.0.0:8080] Información: WEB0169: Created HTTP listener [http-listener-2] on host/port [0.0.0.0:8181] Información: Grizzly Framework 1.9.46 started in: 12ms - bound to [0.0.0.0:8181] but right there it hangs and the deploy bar keeps running but no more actions are shown, nothing else is logged either it just stays there until I stop the deploy Is there any other error log to debug glassfish server? Any thoughts? I have re installed glassfish and NetBeans but it all seems the same. I think this started happening after I had to force-restart my computer with NetBeans stil open and the app deployed, but it's hard to know for sure if this was the real catalyst. Any thoughts or help is appreciated thanks. Is it an app error? if so why no errors in the log are shown?

    Read the article

  • sqlite - any improvements for this attach code (running multiple sql commands transactionally in sql

    - by Greg
    Hi, Is this code solid? I've tried to use "using" etc. Basically a method to pass as sequenced list of SQL commands to be run against a Sqlite database. I assume it is true that in sqlite by default all commands run in a single connection are handled transactionally? Is this true? i.e. I should not have to (and haven't got in the code at the moment) a BeginTransaction, or CommitTransaction. It's using http://sqlite.phxsoftware.com/ as the sqlite ADO.net database provider. private int ExecuteNonQueryTransactionally(List<string> sqlList) { int totalRowsUpdated = 0; using (var conn = new SQLiteConnection(_connectionString)) { // Open connection (one connection so should be transactional - confirm) conn.Open(); // Apply each SQL statement passed in to sqlList foreach (string s in sqlList) { using (var cmd = new SQLiteCommand(conn)) { cmd.CommandText = s; totalRowsUpdated = totalRowsUpdated + cmd.ExecuteNonQuery(); } } } return totalRowsUpdated; }

    Read the article

  • Python (Twisted) - reading from fifo and sending read data to multiple protocols

    - by SpankMe
    Hi, Im trying to write some kind of multi protocol bot (jabber/irc) that would read messages from fifo file (one liners mostly) and then send them to irc channel and jabber contacts. So far, I managed to create two factories to connect to jabber and irc, and they seem to be working. However, I've problem with reading the fifo file - I have no idea how to read it in a loop (open file, read line, close file, jump to open file and so on) outside of reactor loop to get the data I need to send, and then get that data to reactor loop for sending in both protocols. I've been looking for information on how to do it in best way, but Im totally lost in the dark. Any suggestion/help would be highly appreciated. Thanks in advance!

    Read the article

  • Have Button re-appear immediately after clicking button in ListView row

    - by Soeren
    I have 4 buttons on a page. Each button opens a modal window and let’s the user input data in a form. When the user hits the save button in the modal, a ListView appears on the page with the submitted data. The button the user clicked to open the modal window is set to visible=false, so it’s gone when the row is added to the ListView. Now there are 3 buttons and the same goes for those; when the user hits a button, a modal appears, and when the modal form is submitted, the button disappears and a row is added to the ListView. In the ListView row, there is a delete button. When this button is clicked, the row is deleted and the button that was initially clicked to add this row (and open the modal), SHOULD reappear, but it doesn’t. The row disappears, but I have to refresh the page before the button comes back. There is a ScriptManager on the masterpage, so I guess this is an AJAX partial refresh issue. I tried adding different events, but I can’t find the one that fires at the right time. I use an ObjectDataSource to fill the ListView, and the data comes from a database, wrapped in a business object. This code loads a business object in a List< and checks if the user inserted an item of a specific type. If he did, the button he used to open the modal is hidden. This works fine (maybe not the most elegant) _goals = GoalManager.GetGoalsByUser(UserID); if (_goals != null) { foreach (Goal _goalinlist in _goals) { if (_goalinlist.GoalType == 1) { Button1.Visible = false; goalid1 = true; } if (_goalinlist.GoalType == 2) { Button2.Visible = false; goalid2 = true; } if (_goalinlist.GoalType == 3) { Button3.Visible = false; goalid3 = true; } if (_goalinlist.GoalType == 4) { Button4.Visible = false; goalid4 = true; } } } As you can see, I tried setting a boolean, and then check it when the page is re-loaded. But the problem (I guess) is that the whole page isn't refreshed when the delete button is clicked in the ListView. This is the delete button in the ListView: <asp:ImageButton ID="ImageButton2" runat="server" CommandName="Delete" CausesValidation="false" ToolTip="Delete" CommandArgument='<%#Eval("GoalID")%>' ImageUrl="delete.gif" OnClientClick="return confirm('Delete this post?');" CssClass="button"/> I guess the question is, how do I make the button re-appear right after the ListView button is clicked?

    Read the article

  • How to configure a session timeout for Grails application?

    - by curd0
    In one of controllers in my Grails application I'm preserving a parameter value in a session variable like this: session.myVariable = params.myValue After that, I can access the saved value from different controllers/GSP-pages as long as I actively use the app. However, if I don't use my app for a while, even though my browser window is still open, the session variable looses it's value. Does this happens because the session expires? I was under impression that a session lives until the browser window is still open, but apparently I was wrong. What should I do to ensure all session variables I define in my Grails app don't expire until the browser is closed? Is there any way to set session timeout manually? Thank you in advance for your answers!

    Read the article

  • I keep getting a "System InvalidOperationException occurred in System Windows Forms dll" error in VB

    - by Heartrent
    I've just started learning VB.NET with VS 9.0; a small application I'm working on keeps returning an "A first chance exception of type System InvalidOperationException occurred in System Windows Forms dll" error from the Immediate Window. The application has almost zero functionality so far, it consists of a menu strip with: File About |Open |Save |Save As |Quit The only code I have written opens an Open File dialog, a Save As dialog, an About window with background sound and an OK button, and the Quit button which exits. Since there is almost no code for me to search through, I can't understand why there would be an error. The program runs just fine when I'm debugging it too.

    Read the article

  • Bing Maps - how to link to a push pin from a link outside the map

    - by Rajah
    I have a Virtual Earth Maps (Bing Maps??) to which I have added a set of pushpins. Each pushpin is labelled 1 to n. In addition to adding pushpins to the map, I also add text to the web-page that contains the description to each pushpin. I would like to add a link to the text outside the map, that when clicked will open the balloon associated with the corresponding pushpin. How do I open the balloon associated with a pushpin, through a link that exists outside the map? To get a better understanding, look at my map: link. When you click load, PushPins are added to the map. I would like to have a link from the list on the right of the map, that opens the corresponding PushPin. Thanks in advance!

    Read the article

  • known memory leaks in 3ds max?

    - by Denise
    I've set up a script in 3ds max to render a bunch of animations into frames. To do this, I open up a file with all of the materials, load an animation (as a bip) onto the figure, then render. We were seeing a problem where eventually the script would fail because it was unable to open the next file-- max had consumed all of the system memory. Closing max, of course, freed the memory, and we were able to continue with the script. I checked out the heapfree variable, hoping to see a memory leak within my script, hoping to see a memory leak within my own (maxscript) code-- but the amount of free space was the same after every animation. Then, it must be 3ds max which is consuming all of that memory. Nothing in max need be saved from animation to animation-- is there some way to get max to free that memory? (I've tried resetMaxFile() and manually deleting all of the objects in the scene). Is there any known sets of operations that cause max to grow out of control?

    Read the article

  • flex combobox hide and show down arrow

    - by crazy horse
    I am looking to implement a search text box as follows: When user starts typing in and there are non-zero results, the text box will open up and display the results below it. When the user selects a result, the text box closed, but this time with a down-arrow (like a combobox) so that the user can re-open the list. I suspect what I really need is a combobox with ability to hide/show the down arrow. How do I do this in Flex? Thanks in advance.

    Read the article

  • jquery boxy plugin: prevent multiple instances of the same dialog when clicking the link multiple ti

    - by Lyon
    Hi, I'm using the Boxy jQuery plugin to open dialog windows and populating it through ajax. http://onehackoranother.com/projects/jquery/boxy/ Here's my code so far: $("a.create").click(function (e) { url = $(e.target).attr('href'); Boxy.load(url, {title:'Test'}); }); This opens up a dialog alright. However, if I click the link again, another dialog will open. How can I make it such that the previously opened Boxy dialog will come into focus? I only want one instance of this dialog. I tried assigning a variable to var ele = Boxy.load(); but the variable ele returns undefined... Alas, I can't make out much from the limited Boxy documentation available. Enabling the option modal: true would prevent the user from clicking on the link multiple times, but I don't want the overlay to show. Thanks for any light you can shed on this. -Lyon

    Read the article

  • C# file Decryption - Bad Data

    - by Jon
    Hi all, I am in the process of rewriting an old application. The old app stored data in a scoreboard file that was encrypted with the following code: private const String SSecretKey = @"?B?n?Mj?"; public DataTable GetScoreboardFromFile() { FileInfo f = new FileInfo(scoreBoardLocation); if (!f.Exists) { return setupNewScoreBoard(); } DESCryptoServiceProvider DES = new DESCryptoServiceProvider(); //A 64 bit key and IV is required for this provider. //Set secret key For DES algorithm. DES.Key = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Set initialization vector. DES.IV = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Create a file stream to read the encrypted file back. FileStream fsread = new FileStream(scoreBoardLocation, FileMode.Open, FileAccess.Read); //Create a DES decryptor from the DES instance. ICryptoTransform desdecrypt = DES.CreateDecryptor(); //Create crypto stream set to read and do a //DES decryption transform on incoming bytes. CryptoStream cryptostreamDecr = new CryptoStream(fsread, desdecrypt, CryptoStreamMode.Read); DataTable dTable = new DataTable("scoreboard"); dTable.ReadXml(new StreamReader(cryptostreamDecr)); cryptostreamDecr.Close(); fsread.Close(); return dTable; } This works fine. I have copied the code into my new app so that I can create a legacy loader and convert the data into the new format. The problem is I get a "Bad Data" error: System.Security.Cryptography.CryptographicException was unhandled Message="Bad Data.\r\n" Source="mscorlib" The error fires at this line: dTable.ReadXml(new StreamReader(cryptostreamDecr)); The encrypted file was created today on the same machine with the old code. I guess that maybe the encryption / decryption process uses the application name / file or something and therefore means I can not open it. Does anyone have an idea as to: A) Be able explain why this isn't working? B) Offer a solution that would allow me to be able to open files that were created with the legacy application and be able to convert them please? Thank you

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • gdb+osx: no output when using printf/CFShow

    - by yairchu
    I attached to a program with gdb in OSX and I want to use CFShow in the gdb console etc. However, nothing shows up. printf shows nothing as well: (gdb) call (int) printf("Hello\n") $10 = 6 (gdb) call (int) printf("Hello World!\n") $11 = 13 Apple suggests the following tip for when attaching with gdb, to make the output appear in the gdb console: (gdb) call (void) close(1) (gdb) call (void) close(2) (gdb) shell tty /dev/ttyp1 (gdb) call (int) open("/dev/ttyp1", 2, 0) $1 = 1 (gdb) call (int) open("/dev/ttyp1", 2, 0) $2 = 2 In xcode's gdb console tty gives "not a tty", so I tried it in gdb in a terminal. There tty does work but after redirecting stdout there's still no output. Also no output if I direct stdout to a file.. :/ Any salvation?

    Read the article

  • Calling a .NET web service (WSE 3.0, WS-Security) from JAXWS-RI

    - by elduff
    I'm writing a JAXWS-RI client that must call a .NET Web Service that is using WS-Security. The service's WSDL does not contain any WS-Security info, but I have an example soap message from the service's authors and know that I must include wsse:Security headers, including X:509 tokens. I've been researching, and I've seen example of folks calling this type of web service from Axis and CXF (in conjunction with Rampart and/or WSS4J), but nothing about using plain JAXWS-RI itself. However, I'm (unfortunately) constrained to using JAXWS-RI by my gov't client. Does anyone have any examples/documentation of doing this from JAXWS-RI? I need to ultimately generate a SOAP header that looks something like the one below - this is a sample soap:header from a .NET client written by the service's authors. (Note: I've put the 'VALUE_HERE' string in places where I need to provide my own values) <soapenv:Envelope xmlns:iri="http://EOIR/IRIES" xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xenc="http://www.w3.org/2001/04/xmlenc#"> <soapenv:Header xmlns:wsa="http://www.w3.org/2005/08/addressing"> <wsse:Security xmlns:wsse="http://docs.oasis-open.org/wss/2004/01/oasis-200401- wss-wssecurity-secext-1.0.xsd"> <xenc:EncryptedKey Id="VALUE_HERE"> <xenc:EncryptionMethod Algorithm="http://www.w3.org/2001/04/xmlenc#rsa-oaep-mgf1p"/> <ds:KeyInfo xmlns:ds="http://www.w3.org/2000/09/xmldsig#"> <wsse:SecurityTokenReference> <wsse:KeyIdentifier EncodingType="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-soap-message-security-1.0#Base64Binary" ValueType="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-x509-token-profile-1.0#X509v3"> VALUE_HERE </wsse:KeyIdentifier> </wsse:SecurityTokenReference> </ds:KeyInfo> <xenc:CipherData> <xenc:CipherValue>VALUE_HERE</xenc:CipherValue> </xenc:CipherData> <xenc:ReferenceList> <xenc:DataReference URI="#EncDataId-8"/> </xenc:ReferenceList> </xenc:EncryptedKey> </wsse:Security>

    Read the article

  • Why is LOGON_USER Server Variable is blank on New Windows / New Tab?

    - by Alex Papadimoulis
    We are noticing some very strange behavior on an installation of a .NET2-based webapp on Server 2008. Our app uses "old school" Integrated Windows Authentication and simply reads the LOGIN_USER server variable from the request collection. There's a good reason for this, but that's somewhat irrelevant to the question, since the underlying WindowsAuthentication code from ASP.NET does the same thing. Anyway... When you enter the URL in the browser, it loads up just fine and displays the username (from LOGIN_USER) no problem. When you click on a link within the web app, it loads the page just fine and authenticates without any problems. When you "hard refresh" (Ctrl-F5) it also works just fine. However, when you click "open in a new window" or "open in a new tab", the LOGON_USER variable is blank Any ideas? Am I missing some IIS7 setting somewhere? Tested clients are Windows 7 with IE8 or Windows XP with IE6.

    Read the article

  • which ASP.NET hosting site allows listening on different ports than 80 and uses .NET 4?

    - by ijjo
    I'm trying to take advantage of HTML 5 web sockets in .NET and the easiest way appears to be something like what this guy does. I've already tested this myself and it works great, but there are a few problems if I try to deploy this to my hosting site (discountasp.net). Basically, I am not allowed to open up a port on 8080 and listen on it. I then tried to figure out a way to listen on port 80 with IIS as well, but using the HTTPListener, I run into sercurity issues as well. This doesn't seem like it will help since I can't mess with this stuff on the hosting site server either. So to make my life easier, I think I need to find a hosting site that simply allows me to open up a socket on port 8080 and listen on it. Anyone know of one? Or does anyone know of a workaround (besides sniffing all the traffic on port 80)?

    Read the article

  • Serial Mac OS X constantly freezes/locks/dissappears for USB to Arduino

    - by Niraj D
    I have a problem with my C++ code running in Xcode with both the AMSerial library as well as the generic C (ioctl, termios). After a fresh restart, my application works well but after I "kill" the program the Serial (I think) is not released. I have checked my open files under /dev and have killed the connection to serial USB from there, but my C++ still can't open the USB port. I have narrowed this down to being a low level Mac OS X issue, regarding blocking the port indefinitely, regardless of closing it using the aforementioned libraries. Just for context, I'm trying to send numbers through my USB port, serially to an Arduino Duemilanove at 9600 baud. Running Serial Monitor in Arduino is perfectly fine, however, running through a C++ application it freezes up my computer, occasionally, my mouse/keyboard freeze up: requiring a hard reset. How can this problem be fixed? It seems like Mac OS X is not USB friendly!

    Read the article

  • Installing fonts

    - by Lazar
    I have "white nights" trying to install Hebrew/Arabic fonts on my level 7 (API 2.1) aka Nexus emulator. I can't understand why Google guys will want to waist my skills do something helpful for the community using Hebrew/Arabic fonts. After rw mount/remount I can do it for level 3 devices, but for Nexus - nada! Why? What can be done? Real devices guys already broke this peace of hardware, but I am sitting and looking wide eyes open like a sheep. Please make me happy and give the chance to install the fonts. That's what must be done for some of us: We need system image saved on exit for tomorrow to continue the work Open emulator to work in peace cp command included with the SDK. Thanks for any help

    Read the article

  • Python urllib.urlopen IOError

    - by Michael
    So I have the following lines of code in a function sock = urllib.urlopen(url) html = sock.read() sock.close() and they work fine when I call the function by hand. However, when I call the function in a loop (using the same urls as earlier) I get the following error: > Traceback (most recent call last): File "./headlines.py", line 256, in <module> main(argv[1:]) File "./headlines.py", line 37, in main write_articles(headline, output_folder + "articles_" + term +"/") File "./headlines.py", line 232, in write_articles print get_blogs(headline, 5) File "/Users/michaelnussbaum08/Documents/College/Sophmore_Year/Quarter_2/Innovation/Headlines/_code/get_content.py", line 41, in get_blogs sock = urllib.urlopen(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 87, in urlopen return opener.open(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 203, in open return getattr(self, name)(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 314, in open_http if not host: raise IOError, ('http error', 'no host given') IOError: [Errno http error] no host given Any ideas?

    Read the article

< Previous Page | 312 313 314 315 316 317 318 319 320 321 322 323  | Next Page >