Search Results

Search found 13683 results on 548 pages for 'python sphinx'.

Page 318/548 | < Previous Page | 314 315 316 317 318 319 320 321 322 323 324 325  | Next Page >

  • Get active window title in X

    - by dutt
    I'm trying to get the title of the active window. The application is a background task so if the user has Eclipse open the function returns "Eclipse - blabla", so it's not getting the window title of my own window. I'm developing this in Python 2.6 using PyQt4. My current solution, borrowed and slightly modified from an old answer here at SO, looks like this: def get_active_window_title(): title = '' root_check = '' root = Popen(['xprop', '-root'], stdout=PIPE) if root.stdout != root_check: root_check = root.stdout for i in root.stdout: if '_NET_ACTIVE_WINDOW(WINDOW):' in i: id_ = i.split()[4] id_w = Popen(['xprop', '-id', id_], stdout=PIPE) for j in id_w.stdout: if 'WM_ICON_NAME(STRING)' in j: if title != j.split()[2]: return j.split("= ")[1].strip(' \n\"') It works for most windows, but not all. For example it can't find my kopete chat windows, or the name of the application i'm currently developing. My next try looks like this: def get_active_window_title(self): screen = wnck.screen_get_default() if screen == None: return "Could not get screen" window = screen.get_active_window() if window == None: return "Could not get window" title = window.get_name() return title; But for some reason window is always None. Does somebody have a better way of getting the current window title, or how to modify one of my ways, that works for all windows? Edit: In case anybody is wondering this is the way I found that seems to work for all windows. def get_active_window_title(self): root_check = '' root = Popen(['xprop', '-root'], stdout=PIPE) if root.stdout != root_check: root_check = root.stdout for i in root.stdout: if '_NET_ACTIVE_WINDOW(WINDOW):' in i: id_ = i.split()[4] id_w = Popen(['xprop', '-id', id_], stdout=PIPE) id_w.wait() buff = [] for j in id_w.stdout: buff.append(j) for line in buff: match = re.match("WM_NAME\((?P<type>.+)\) = (?P<name>.+)", line) if match != None: type = match.group("type") if type == "STRING" or type == "COMPOUND_TEXT": return match.group("name") return "Active window not found"

    Read the article

  • tk: how to invoke it just to display something, and return to the main program?

    - by max
    Sorry for the noob question but I really don't understand this. I'm using python / tkinter and I want to display something (say, a canvas with a few shapes on it), and keep it displayed until the program quits. I understand that no widgets would be displayed until I call tkinter.tk.mainloop(). However, if I call tkinter.tk.mainloop(), I won't be able to do anything else until the user closes the main window. I don't need to monitor any user input events, just display some stuff. What's a good way to do this without giving up control to mainloop? EDIT: Is this sample code reasonable: class App(tk.Tk): def __init__(self, sim): self.sim = sim # link to the simulation instance self.loop() def loop(): self.redraw() # update all the GUI to reflect new simulation state sim.next_step() # advance simulation another step self.after(0, self.loop) def redraw(): # get whatever we need from self.sim, and put it on the screen EDIT2 (added after_idle): class App(tk.Tk): def __init__(self, sim): self.sim = sim # link to the simulation instance self.after_idle(self.preloop) def preloop(): self.after(0, self.loop) def loop(): self.redraw() # update all the GUI to reflect new simulation state sim.next_step() # advance simulation another step self.after_idle(self.preloop) def redraw(): # get whatever we need from self.sim, and put it on the screen

    Read the article

  • Problems with Getting Remote Contents using Google App Engine

    - by dade
    Here is the client side code. It is running insdide a Google Gadgets var params = {}; params[gadgets.io.RequestParameters.CONTENT_TYPE] = gadgets.io.ContentType.JSON; var url = "http://invplatformtest.appspot.com/getrecent/"; gadgets.io.makeRequest(url, response, params); The response function is: function response(obj) { var r = obj.data; alert(r['name']); } while on the server end, the python code sending the JSON is: class GetRecent(webapp.RequestHandler): def get(self): self.response.out.write({'name':'geocities'}) #i know this is where the problem is so how do i encode json in GAE? which is just supposed to send back a Json encoded string but when i run this, the javascript throws the following error: r is null alert(r['name']); If i were recieving just TEXT contents and my server send TEXT everything works fine. I only get this problem when am trying to send JSON. Where exactly is the problem? Am i encoding the JSON the wrong way on AppEngine? I tried using the JSON library but it looks as if this is not supported. Where is the problem exactly? :(

    Read the article

  • Approach for parsing file and creating dynamic data structure for use by another program

    - by user275633
    All, Background: I have a customer who has some build scripts for their datacenter based on python that I've inherited. I did not work on the original design so I'm sort of limited to some degree on what I can and can't change. That said, my customer has a properties file that they use in their datacenter. Some of the values are used to build their servers and unfortunately they have other applications that also use these values so I cannot change them to make it easier for me. What I want to do is make the scripts more dynamic to distribute more hosts so that I don't have to keep updating the scripts in the future and can just add more hosts to the property file. Unfortunately I can't change the current property file and have to work with it. The property file looks something like this: projectName.ClusterNameServer1.sslport=443 projectName.ClusterNameServer1.port=80 projectName.ClusterNameServer1.host=myHostA projectName.ClusterNameServer2.sslport=443 projectName.ClusterNameServer2.port=80 projectName.ClusterNameServer2.host=myHostB In their deployment scripts they basically have alot of if projectName.ClusterNameServerX where X is some number of entries defined and then do something, e.g.: if projectName.ClusterNameServer1.host != "" do X if projectName.ClusterNameServer2.host != "" do X if projectName.ClusterNameServer3.host != "" do X Then when they add another host (say Serve4) they've added another if statement. Question: What I would like to do is make the scripts more dynamic and parse the properties file and put what I need into some data structure to pass to the deployment scripts and then just iterate over the structure and do my deployment that way so I don't have to constantly add a bunch of if some host# do something. I'm just curious to feed some suggestions as to what others would do to parse the file and what sort of data structure would they use and how they would group things together by ClusterNameServer# or something else. Thanks

    Read the article

  • create a class attribute without going through __setattr__

    - by eric.frederich
    Hello, What I have below is a class I made to easily store a bunch of data as attributes. They wind up getting stored in a dictionary. I override __getattr__ and __setattr__ to store and retrieve the values back in different types of units. When I started overriding __setattr__ I was having trouble creating that initial dicionary in the 2nd line of __init__ like so... super(MyDataFile, self).__setattr__('_data', {}) My question... Is there an easier way to create a class level attribute with going through __setattr__? Also, should I be concerned about keeping a separate dictionary or should I just store everything in self.__dict__? #!/usr/bin/env python from unitconverter import convert import re special_attribute_re = re.compile(r'(.+)__(.+)') class MyDataFile(object): def __init__(self, *args, **kwargs): super(MyDataFile, self).__init__(*args, **kwargs) super(MyDataFile, self).__setattr__('_data', {}) # # For attribute type access # def __setattr__(self, name, value): self._data[name] = value def __getattr__(self, name): if name in self._data: return self._data[name] match = special_attribute_re.match(name) if match: varname, units = match.groups() if varname in self._data: return self.getvaras(varname, units) raise AttributeError # # other methods # def getvaras(self, name, units): from_val, from_units = self._data[name] if from_units == units: return from_val return convert(from_val, from_units, units), units def __str__(self): return str(self._data) d = MyDataFile() print d # set like a dictionary or an attribute d.XYZ = 12.34, 'in' d.ABC = 76.54, 'ft' # get it back like a dictionary or an attribute print d.XYZ print d.ABC # get conversions using getvaras or using a specially formed attribute print d.getvaras('ABC', 'cm') print d.XYZ__mm

    Read the article

  • Merging similar dictionaries in a list together

    - by WonderSteve
    New to python here. I've been pulling my hair for hours and still can't figure this out. I have a list of dictionaries: [ {'FX0XST001.MID5': '195', 'Name': 'Firmicutes', 'Taxonomy ID': '1239', 'Type': 'phylum'} {'FX0XST001.MID13': '4929', 'Name': 'Firmicutes', 'Taxonomy ID': '1239','Type': 'phylum'}, {'FX0XST001.MID6': '826', 'Name': 'Firmicutes', 'Taxonomy ID': '1239', 'Type': 'phylum'}, . . . . {'FX0XST001.MID6': '125', 'Name': 'Acidobacteria', 'Taxonomy ID': '57723', 'Type': 'phylum'} {'FX0XST001.MID25': '70', 'Name': 'Acidobacteria', 'Taxonomy ID': '57723', 'Type': 'phylum'} {'FX0XST001.MID40': '40', 'Name': 'Acidobacteria', 'Taxonomy ID': '57723', 'Type': 'phylum'} ] I want to merge the dictionaries in the list based on their Type, Name, and Taxonomy ID [ {'FX0XST001.MID5': '195', 'FX0XST001.MID13': '4929', 'FX0XST001.MID6': '826', 'Name': 'Firmicutes', 'Taxonomy ID': '1239', 'Type': 'phylum'} . . . . {'FX0XST001.MID6': '125', 'FX0XST001.MID25': '70', 'FX0XST001.MID40': '40', 'Name': 'Acidobacteria', 'Taxonomy ID': '57723', 'Type': 'phylum'}] I have the data structure setup like this because I need to write the data to CSV using csv.DictWriter later. Would anyone kindly point me to the right direction?

    Read the article

  • pyOpenSSL and the WantReadError

    - by directedition
    I have a socket server that I am trying to move over to SSL on python 2.5, but I've run into a snag with pyOpenSSL. I can't find any good tutorials on using it, so I'm operating largely on guesses. Here is how my server sets up the socket: ctx = SSL.Context(SSL.SSLv23_METHOD) ctx.use_privatekey_file ("mykey.pem") ctx.use_certificate_file("mycert.pem") sock = SSL.Connection(ctx, socket.socket(socket.AF_INET, socket.SOCK_STREAM)) sock.setsockopt(socket.SOL_SOCKET, socket.SO_REUSEADDR, 1) addr = ('', int(8081)) sock.bind(addr) sock.listen(5) Here is how it accepts clients: sock.setblocking(0) while True: if len(select([sock], [], [], 0.25)[0]): client_sock, client_addr = sock.accept() client = ClientGen(client_sock) And here is how it sends/receives from the connected sockets: while True: (r, w, e) = select.select([sock], [sock], [], 0.25) if len(r): bytes = sock.recv(1024) if len(w): n_bytes = sock.send(self.message) It's compacted, but you get the general idea. The problem is, once the send/receive loop starts, it dies right away, before anything has been sent or received (that I can see anyway): Traceback (most recent call last): File "ClientGen.py", line 50, in networkLoop n_bytes = sock.send(self.message WantReadError The manual's description of the 'WantReadError' is very vague, saying it can come from just about anywhere. What am I doing wrong?

    Read the article

  • I need Selenium to open it's web browser in a larger resolution ( preferably maximized)

    - by user1854271
    I am using Selenium WebDriver and coding in Python I have looked all over the place and the best I could find were things written in different languages. I also tried to use the export tool on Selenium IDE but when I look at the data says that the function is not supported for export. EDIT: The reason I need the browser to open up with a larger resolution is because the web application that I am testing is supporting tablet resolution as so elements are different depending on the resolution of the browser window. This is the script I exported from the IDE with a couple of modifications. from selenium import webdriver from selenium.webdriver.common.by import By from selenium.webdriver.support.ui import Select from selenium.common.exceptions import NoSuchElementException import unittest, time, re from Funk_Lib import RS class CreatingEditingDeletingVault(unittest.TestCase): def setUp(self): self.driver = webdriver.Firefox() self.driver.implicitly_wait(30) self.base_url = "http://cimdev-qa40/" self.verificationErrors = [] def test_creating_editing_deleting_vault(self): driver = self.driver driver.get(self.base_url + "/Login?contoller=Home") driver.find_element_by_id("UserName").click() driver.find_element_by_id("UserName").clear() driver.find_element_by_id("UserName").send_keys("[email protected]") driver.find_element_by_name("Password").click() driver.find_element_by_name("Password").clear() driver.find_element_by_name("Password").send_keys("Codigo#123") driver.find_element_by_id("fat-btn").click() driver.get(self.base_url + "/Content/Vaults/") driver.find_element_by_link_text("Content").click() driver.find_element_by_link_text("Vaults").click() driver.find_element_by_css_selector("button.btn.dropdown-toggle").click() driver.find_element_by_link_text("New vault").click() driver.find_element_by_name("Name").clear() driver.find_element_by_name("Name").send_keys("Test Vault") driver.find_element_by_xpath("//button[@onclick=\"vault_action('createvault', null, $('#CreateVault [name=\\'Name\\']').val())\"]").click() driver.find_element_by_css_selector("button.btn.dropdown-toggle").click() driver.find_element_by_link_text("Rename vault").click() driver.find_element_by_name("Id").click() Select(driver.find_element_by_name("Id")).select_by_visible_text("Test Vault") driver.find_element_by_css_selector("option[value=\"2\"]").click() driver.find_element_by_name("Name").clear() driver.find_element_by_name("Name").send_keys("Test Change") driver.find_element_by_xpath("//button[@onclick=\"vault_action('renamevault', $('#RenameVault [name=\\'Id\\']').val(), $('#RenameVault [name=\\'Name\\']').val())\"]").click() driver.find_element_by_css_selector("button.btn.dropdown-toggle").click() driver.find_element_by_link_text("Delete vault").click() driver.find_element_by_name("Id").click() Select(driver.find_element_by_name("Id")).select_by_visible_text("Test Change") driver.find_element_by_css_selector("option[value=\"2\"]").click() driver.find_element_by_xpath("//button[@onclick=\"vault_action('deletevault', $('#DeleteVault [name=\\'Id\\']').val(), '')\"]").click() def is_element_present(self, how, what): try: self.driver.find_element(by=how, value=what) except NoSuchElementException, e: return False return True def tearDown(self): self.driver.quit() self.assertEqual([], self.verificationErrors) if __name__ == "__main__": unittest.main()

    Read the article

  • Insertion sort invariant assertion fails

    - by user1661211
    In the following code at the end of the for loop I use the assert function in order to test that a[i+1] is greater than or equal to a[i] but I get the following error (after the code below). Also in c++ the assert with the following seems to work just fine but in python (the following code) it does not seem to work...anyone know why? import random class Sorting: #Precondition: An array a with values. #Postcondition: Array a[1...n] is sorted. def insertion_sort(self,a): #First loop invariant: Array a[1...i] is sorted. for j in range(1,len(a)): key = a[j] i = j-1 #Second loop invariant: a[i] is the greatest value from a[i...j-1] while i >= 0 and a[i] > key: a[i+1] = a[i] i = i-1 a[i+1] = key assert a[i+1] >= a[i] return a def random_array(self,size): b = [] for i in range(0,size): b.append(random.randint(0,1000)) return b sort = Sorting() print sort.insertion_sort(sort.random_array(10)) The Error: Traceback (most recent call last): File "C:\Users\Albaraa\Desktop\CS253\Programming 1\Insertion_Sort.py", line 27, in <module> print sort.insertion_sort(sort.random_array(10)) File "C:\Users\Albaraa\Desktop\CS253\Programming 1\Insertion_Sort.py", line 16, in insertion_sort assert a[i+1] >= a[i] AssertionError

    Read the article

  • Faster Insertion of Records into a Table with SQLAlchemy

    - by Kyle Brandt
    I am parsing a log and inserting it into either MySQL or SQLite using SQLAlchemy and Python. Right now I open a connection to the DB, and as I loop over each line, I insert it after it is parsed (This is just one big table right now, not very experienced with SQL). I then close the connection when the loop is done. The summarized code is: log_table = schema.Table('log_table', metadata, schema.Column('id', types.Integer, primary_key=True), schema.Column('time', types.DateTime), schema.Column('ip', types.String(length=15)) .... engine = create_engine(...) metadata.bind = engine connection = engine.connect() .... for line in file_to_parse: m = line_regex.match(line) if m: fields = m.groupdict() pythonified = pythoninfy_log(fields) #Turn them into ints, datatimes, etc if use_sql: ins = log_table.insert(values=pythonified) connection.execute(ins) parsed += 1 My two questions are: Is there a way to speed up the inserts within this basic framework? Maybe have a Queue of inserts and some insertion threads, some sort of bulk inserts, etc? When I used MySQL, for about ~1.2 million records the insert time was 15 minutes. With SQLite, the insert time was a little over an hour. Does that time difference between the db engines seem about right, or does it mean I am doing something very wrong?

    Read the article

  • Problems with i18n using django translation on App-Engine with Korean and Hindi

    - by Greg
    I've got a setup based on the post here, and it works perfectly. Adding more languages to the mix, it recognises them fine, except for Korean (ko) and Hindi (hi). Chinese/Japanese/Hebrew are all fine, so nothing to do with encodings/charsets I don't think. Taking a look into the django code inside the app-engine SDK, I notice that all the languages that I'm using except for ko and hi are ones that ship with django - in the default settings.py and inside the locale folder they are missing. If I copy one of the locale folders inside the /usr/local/google_appengine/lib/django[...]/conf/locale and rename it to be 'ko', then it starts working in my app, but I won't be able to replicate this modification when I deploy to app-engine, so need a bit of help understanding what I might be doing wrong. my settings.py is definitely being taken into account, as if I remove languages from there then they stop working (as they should). If I copied the django modules into my app, under 'lib' there say, could I use those instead of the ones app-engine tries to use, maybe? I'm brand new to python/django/app-engine, and developing on a Mac with Leopard, if that makes any difference. I have the latest app-engine SDK as of tuesday.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • django multiprocess problem

    - by iKiR
    I have django application, running under lighttpd via fastcgi. FCGI running script looks like: python manage.py runfcgi socket=<path>/main.socket method=prefork \ pidfile=<path>/server.pid \ minspare=5 maxspare=10 maxchildren=10 maxrequests=500 \ I use SQLite. So I have 10 proccess, which all work with the same DB. Next I have 2 views: def view1(request) ... obj = MyModel.objects.get_or_create(id=1) obj.param1 = <some value> obj.save () def view2(request) ... obj = MyModel.objects.get_or_create(id=1) obj.param2 = <some value> obj.save () And If this views are executed in two different threads sometimes I get MyModel instance in DB with id=1 and updated either param1 or param2 (BUT not both) - it depends on which process was the first. (of course in real life id changes, but sometimes 2 processes execute these two views with same id) The question is: What should I do to get instance with updated param1 and param2? I need something for merging changes in different processes. One decision is create interprocess lock object but in this case I will get sequence executing views and they will not be able to be executed simultaneously, so I ask help

    Read the article

  • Add a value to an element in a list of sets

    - by Kapelson
    Hello. I'm using python, and I have a list of sets, constructed like this: list = [set([])]*n ...where n is the number of sets I want in the list. I want to add a value to a specific set in the list. Say, the second set. I tried list[1].add(value) But this instead adds the value to each set in the list. This behaviour is pretty non-intuitive to me. Through further tests, I think I've found the problem: the list apparently contains 10 instances of the same set, or ten pointers to the same set, or something. Constructing the list through repeated calls of list.append(set([])) allowed me to use the syntax above to add elements to single sets. So my question is this: what exactly is going on in my first list-construction technique? It is clear I don't understand the syntax so well. Also, is there a better way to intialize an n-element list? I've been using this syntax for a while and this is my first problem with it.

    Read the article

  • Importing package as a submodule

    - by wecac
    Hi, I have a package 3rd party open source package "foo"; that is in beta phase and I want to tweak it to my requirements. So I don't want to get it installed in /usr/local/lib/python or anywhere in current sys.path as I can't make frequent changes in top level packages. foo/ __init__.py fmod1.py import foo.mod2 fmod2.py pass I want to install the the package "foo" as a sub package of my namespace say "team.my_pkg". So that the "fullname" of the package becomes "team.my_pkg.foo" without changing the code in inner modules that refer "team.my_pkg.foo" as "foo". team/ __init__.py my_pkg/ __init__.py foo/ fmod1.py import foo.mod2 fmod2.py pass One way to do this is to do this in team.my_pkg.init.py: import os.path import sys sys.path.append(os.path.dirname(__file__)) But I think it is very unsafe. I hope there is some way that only fmod1.py and fmod2.py can call "foo" by its short name everything else should use its complete name "team.my_pkg.foo" I mean this should fail outside team/my_pkg/foo: import team.my_pkg import foo But this should succeed outside team/my_pkg/foo: import team.my_pkg.foo

    Read the article

  • What's the best way to send user-inputted text via AJAX to Google App Engine?

    - by Cuga
    I'm developing in Google App Engine (python sdk) and I want to use jQuery to send an Ajax request to store an answer to a question. What is the best way to send this data to the server? Currently I have: function storeItem(question_id) { var answerInputControl = ".input_answer_"+question_id; var answer_text = $(answerInputControl).text(); $.ajax({ type: "POST", url: "store_answer.html", data: "question="+question_id, success: function(responseText){ alert("Retrieved: " + responseText); } }); } This takes a question Id and provides it to the server via the query string. But on the server-side, I'm unable to access the content of the answer control which I want to store. Without Ajax, I'm able to perform this operation with the following: class StoreAnswers(webapp.RequestHandler): def post(self): question_id = self.request.get("question_id") answer_text = self.request.get("input_answer" + question_id) But when doing this call through Ajax, my answer_text is empty. Do I need to send the contents of this control as part of the data with the Ajax request? Do I add the control itself to the query string? Its contents? Does it matter that the content might be a few hundred characters long? Is this the most-recommended practice? If sending it as a query string, what's the best way to escape the content so that a malicious user doesn't harm the system?

    Read the article

  • Seperating two graphs based on connectivity and coordinates

    - by martin
    I would like to separate existing data of vertices and edges into two or more graphs that are not connected. I would like to give the following as example: Imagine two hexagons on top of each other but are lying in different Z. Hexagon 1 has the following vertices A(0,0,1), B(1,0,2), C(2,1,2), D(1,2,1), E(0,2,1), F(-1,2,1). The connectivity is as following: A-B, B-C, C-D, D-E, E-F, F-A. This part of Graph 1 as all the vertices are connected in this layer. Hexagon2 has the following vertices A1(0,0,6), B1(1,0,7), C1(2,1,7), D1(1,2,8), E1(0,2,7), F1(-1,2,6). The connectivity is as following: A1-B1, B1-C1, C1-D1, D1-E1, E1-F1, F1-A1. This is part of Graph 2 My data is in the following form: list of Vertices and list of Edges that i can form graphs with. I would like to eliminate graph 2 and give only vertices and connectivity of graph 1 to polygon determination part of my algorithm. My real data contains around 1000 connected polygons as graph 1 and around 100 (much larger in area) polygons as graph 2. I would like to eliminate graph 2. I am programming this in python. Thanks in advance.

    Read the article

  • Extended slice that goes to beginning of sequence with negative stride

    - by recursive
    Bear with me while I explain my question. Skip down to the bold heading if you already understand extended slice list indexing. In python, you can index lists using slice notation. Here's an example: >>> A = list(range(10)) >>> A[0:5] [0, 1, 2, 3, 4] You can also include a stride, which acts like a "step": >>> A[0:5:2] [0, 2, 4] The stride is also allowed to be negative, meaning the elements are retrieved in reverse order: >>> A[5:0:-1] [5, 4, 3, 2, 1] But wait! I wanted to see [4, 3, 2, 1, 0]. Oh, I see, I need to decrement the start and end indices: >>> A[4:-1:-1] [] What happened? It's interpreting -1 as being at the end of the array, not the beginning. I know you can achieve this as follows: >>> A[4::-1] [4, 3, 2, 1, 0] But you can't use this in all cases. For example, in a method that's been passed indices. My question is: Is there any good pythonic way of using extended slices with negative strides and explicit start and end indices that include the first element of a sequence? This is what I've come up with so far, but it seems unsatisfying. >>> A[0:5][::-1] [4, 3, 2, 1, 0]

    Read the article

  • Repeated host lookups failing in urllib2

    - by reve_etrange
    I have code which issues many HTTP GET requests using Python's urllib2, in several threads, writing the responses into files (one per thread). During execution, it looks like many of the host lookups fail (causing a name or service unknown error, see appended error log for an example). Is this due to a flaky DNS service? Is it bad practice to rely on DNS caching, if the host name isn't changing? I.e. should a single lookup's result be passed into the urlopen? Exception in thread Thread-16: Traceback (most recent call last): File "/usr/lib/python2.6/threading.py", line 532, in __bootstrap_inner self.run() File "/home/da/local/bin/ThreadedDownloader.py", line 61, in run page = urllib2.urlopen(url) # get the page File "/usr/lib/python2.6/urllib2.py", line 126, in urlopen return _opener.open(url, data, timeout) File "/usr/lib/python2.6/urllib2.py", line 391, in open response = self._open(req, data) File "/usr/lib/python2.6/urllib2.py", line 409, in _open '_open', req) File "/usr/lib/python2.6/urllib2.py", line 369, in _call_chain result = func(*args) File "/usr/lib/python2.6/urllib2.py", line 1170, in http_open return self.do_open(httplib.HTTPConnection, req) File "/usr/lib/python2.6/urllib2.py", line 1145, in do_open raise URLError(err) URLError: <urlopen error [Errno -2] Name or service not known>

    Read the article

  • Django: Create custom template tag -> ImportError

    - by Alexander Scholz
    I'm sorry to ask this again, but I tried several solutions from stack overflow and some tutorials and I couldn't create a custom template tag yet. All I get is ImportError: No module named test_tag when I try to start the server via python manage.py runserver. I created a very basic template tag (found here: django templatetag?) like so: My folder structure: demo manage.py test __init__.py settings.py urls.py ... templatetags __init__.py test_tag.py test_tag.py: from django import template register = template.Library() @register.simple_tag def test_tag(input): if "foo" == input: return "foo" if "bar" == input: return "bar" if "baz" == input: return "baz" return "" index.html: {% load test_tag %} <html> <head> ... </head> <body> {% cms_toolbar %} {% foobarbaz "bar" %} {% foobarbaz "elephant" %} {% foobarbaz "foo" %} </body> </html> and my settings.py: INSTALLED_APPS = ( ... 'test_tag', ... ) Please let me know if you need further information from my settings.py and what I did wrong so I can't even start my server. (If I delete 'test_tag' from installed apps I can start the server but I get the error that test_tag is not known, of course). Thanks

    Read the article

  • Unable to write to a text file

    - by chrissygormley
    Hello, I am running some tests and need to write to a file. When I run the test's the open = (file, 'r+') does not write to the file. The test script is below: class GetDetailsIP(TestGet): def runTest(self): self.category = ['PTZ'] try: # This run's and return's a value result = self.client.service.Get(self.category) mylogfile = open("test.txt", "r+") print >>mylogfile, result result = ("".join(mylogfile.readlines()[2])) result = str(result.split(':')[1].lstrip("//").split("/")[0]) mylogfile.close() except suds.WebFault, e: assert False except Exception, e: pass finally: if 'result' in locals(): self.assertEquals(result, self.camera_ip) else: assert False When this test run's, no value has been entered into the text file and a value is returned in the variable result. I havw also tried mylogfile.write(result). If the file does not exist is claim's the file does not exist and doesn't create one. Could this be a permission problem where python is not allowed to create a file? I have made sure that all other read's to this file are closed so I the file should not be locked. Can anyone offer any suggestion why this is happening? Thanks

    Read the article

  • How to setup and teardown temporary django db for unit testing?

    - by blokeley
    I would like to have a python module containing some unit tests that I can pass to hg bisect --command. The unit tests are testing some functionality of a django app, but I don't think I can use hg bisect --command manage.py test mytestapp because mytestapp would have to be enabled in settings.py, and the edits to settings.py would be clobbered when hg bisect updates the working directory. Therefore, I would like to know if something like the following is the best way to go: import functools, os, sys, unittest sys.path.append(path_to_myproject) os.environ['DJANGO_SETTINGS_MODULE'] = 'myapp.settings' def with_test_db(func): """Decorator to setup and teardown test db.""" @functools.wraps def wrapper(*args, **kwargs): try: # Set up temporary django db func(*args, **kwargs) finally: # Tear down temporary django db class TestCase(unittest.TestCase): @with_test_db def test(self): # Do some tests using the temporary django db self.fail('Mark this revision as bad.') if '__main__' == __name__: unittest.main() I should be most grateful if you could advise either: If there is a simpler way, perhaps subclassing django.test.TestCase but not editing settings.py or, if not; What the lines above that say "Set up temporary django db" and "Tear down temporary django db" should be?

    Read the article

  • Paginating requests to an API

    - by user332912
    I'm consuming (via urllib/urllib2) an API that returns XML results. The API always returns the total_hit_count for my query, but only allows me to retrieve results in batches of, say, 100 or 1000. The API stipulates I need to specify a start_pos and end_pos for offsetting this, in order to walk through the results. Say the urllib request looks like "http://someservice?query='test'&start_pos=X&end_pos=Y". If I send an initial 'taster' query with lowest data transfer such as http://someservice?query='test'&start_pos=1&end_pos=1 in order to get back a result of, for conjecture, total_hits = 1234, I'd like to work out an approach to most cleanly request those 1234 results in batches of, again say, 100 or 1000 or... This is what I came up with so far, and it seems to work, but I'd like to know if you would have done things differently or if I could improve upon this: hits_per_page=1000 # or 1000 or 200 or whatever, adjustable total_hits = 1234 # retreived with BSoup from 'taster query' base_url = "http://someservice?query='test'" startdoc_positions = [n for n in range(1, total_hits, hits_per_page)] enddoc_positions = [startdoc_position + hits_per_page - 1 for startdoc_position in startdoc_positions] for start, end in zip(startdoc_positions, enddoc_positions): if end total_hits: end = total_hits print "url to request is:\n ", print "%s&start_pos=%s&end_pos=%s" % (base_url, start, end) p.s. I'm a long time consumer of StackOverflow, especially the Python questions, but this is my first question posted. You guys are just brilliant.

    Read the article

  • How to make "int" parse blank strings?

    - by Alex B
    I have a parsing system for fixed-length text records based on a layout table: parse_table = [\ ('name', type, length), .... ('numeric_field', int, 10), # int example ('textc_field', str, 100), # string example ... ] The idea is that given a table for a message type, I just go through the string, and reconstruct a dictionary out of it, according to entries in the table. Now, I can handle strings and proper integers, but int() will not parse all-spaces fields (for a good reason, of course). I wanted to handle it by defining a subclass of int that handles blank strings. This way I could go and change the type of appropriate table entries without introducing additional kludges in the parsing code (like filters), and it would "just work". But I can't figure out how to override the constructor of a build-in type in a sub-type, as defining constructor in the subclass does not seem to help. I feel I'm missing something fundamental here about how Python built-in types work. How should I approach this? I'm also open to alternatives that don't add too much complexity.

    Read the article

  • Reason for socket.error

    - by August Flanagan
    Hi, I am a complete newbie when it comes to python, and programming in general. I've been working on a little webapp for the past few weeks trying to improve my coding chops. A few days ago my laptop was stolen so I went out and got a new MacBook Pro. Thank God I had everything under subversion control. The problem is now that I am on my new machine a script that I was running has stopped working and I have no idea why. This is really the only part of what I have been writing that I borrowed heavily for existing scripts. It is from the widely available whois.py script and I have only slightly modified it as follows (see below). It was running fine on my old system (running ubuntu), but now the socket.error is being raised. I'm completely lost on this, and would really appreciate any help. Thanks! def is_available(domainname, whoisserver="whois.verisign-grs.com", cache=0): if whoisserver is None: whoisserver = "whois.networksolutions.com" s = None while s == None: try: s = socket.socket(socket.AF_INET, socket.SOCK_STREAM) s.setblocking(0) try: s.connect((whoisserver, 43)) except socket.error, (ecode, reason): if ecode in (115, 150): pass else: raise socket.error, (ecode, reason) ret = select.select([s], [s], [], 30) if len(ret[1])== 0 and len(ret[0]) == 0: s.close() raise TimedOut, "on connect " s.setblocking(1) except socket.error, (ecode, reason): print ecode, reason time.sleep(1) s = None s.send("%s \n\n" % domainname) page = "" while 1: data = s.recv(8196) if not data: break page = page + data s.close()

    Read the article

< Previous Page | 314 315 316 317 318 319 320 321 322 323 324 325  | Next Page >