Search Results

Search found 13683 results on 548 pages for 'python sphinx'.

Page 317/548 | < Previous Page | 313 314 315 316 317 318 319 320 321 322 323 324  | Next Page >

  • Django install on a shared host, .htaccess help

    - by redconservatory
    I am trying to install Django on a shared host using the following instructions: docs.google.com/View?docid=dhhpr5xs_463522g My problem is with the following line on my root .htaccess: RewriteRule ^(.*)$ /cgi-bin/wcgi.py/$1 [QSA,L] When I include this line I get a 500 error with almost all of my domains on this account. My cgi-bin directory is home/my-username/public_html/cgi-bin/ The wcgi.py file contains: #!/usr/local/bin/python import os, sys sys.path.insert(0, "/home/username/django/") sys.path.insert(0, "/home/username/django/projects") sys.path.insert(0, "/home/username/django/projects/newprojects") import django.core.handlers.wsgi os.chdir("/home/username/django/projects/newproject") # optional os.environ['DJANGO_SETTINGS_MODULE'] = "newproject.settings" def runcgi(): environ = dict(os.environ.items()) environ['wsgi.input'] = sys.stdin environ['wsgi.errors'] = sys.stderr environ['wsgi.version'] = (1,0) environ['wsgi.multithread'] = False environ['wsgi.multiprocess'] = True environ['wsgi.run_once'] = True application = django.core.handlers.wsgi.WSGIHandler() if environ.get('HTTPS','off') in ('on','1'): environ['wsgi.url_scheme'] = 'https' else: environ['wsgi.url_scheme'] = 'http' headers_set = [] headers_sent = [] def write(data): if not headers_set: raise AssertionError("write() before start_response()") elif not headers_sent: # Before the first output, send the stored headers status, response_headers = headers_sent[:] = headers_set sys.stdout.write('Status: %s\r\n' % status) for header in response_headers: sys.stdout.write('%s: %s\r\n' % header) sys.stdout.write('\r\n') sys.stdout.write(data) sys.stdout.flush() def start_response(status,response_headers,exc_info=None): if exc_info: try: if headers_sent: # Re-raise original exception if headers sent raise exc_info[0], exc_info[1], exc_info[2] finally: exc_info = None # avoid dangling circular ref elif headers_set: raise AssertionError("Headers already set!") headers_set[:] = [status,response_headers] return write result = application(environ, start_response) try: for data in result: if data: # don't send headers until body appears write(data) if not headers_sent: write('') # send headers now if body was empty finally: if hasattr(result,'close'): result.close() runcgi() Only I changed the "username" to my username...

    Read the article

  • How to prevent BeautifulSoup from stripping lines

    - by Oli
    I'm trying to translate an online html page into text. I have a problem with this structure: <div align="justify"><b>Available in <a href="http://www.example.com.be/book.php?number=1"> French</a> and <a href="http://www.example.com.be/book.php?number=5"> English</a>. </div> Here is its representation as a python string: '<div align="justify"><b>Available in \r\n<a href="http://www.example.com.be/book.php?number=1">\r\nFrench</a>; \r\n<a href="http://www.example.com.be/book.php?number=5">\r\nEnglish</a>.\r\n</div>' When using: html_content = get_html_div_from_above() para = BeautifulSoup(html_content) txt = para.text BeautifulSoup translate it (in the 'txt' variable) as: u'Available inFrenchandEnglish.' It probably strips each line in the original html string. Do you have a clean solution about this problem ? Thanks.

    Read the article

  • What should i do for accomodating large scale data storage and retrieval?

    - by kailashbuki
    There's two columns in the table inside mysql database. First column contains the fingerprint while the second one contains the list of documents which have that fingerprint. It's much like an inverted index built by search engines. An instance of a record inside the table is shown below; 34 "doc1, doc2, doc45" The number of fingerprints is very large(can range up to trillions). There are basically following operations in the database: inserting/updating the record & retrieving the record accoring to the match in fingerprint. The table definition python snippet is: self.cursor.execute("CREATE TABLE IF NOT EXISTS `fingerprint` (fp BIGINT, documents TEXT)") And the snippet for insert/update operation is: if self.cursor.execute("UPDATE `fingerprint` SET documents=CONCAT(documents,%s) WHERE fp=%s",(","+newDocId, thisFP))== 0L: self.cursor.execute("INSERT INTO `fingerprint` VALUES (%s, %s)", (thisFP,newDocId)) The only bottleneck i have observed so far is the query time in mysql. My whole application is web based. So time is a critical factor. I have also thought of using cassandra but have less knowledge of it. Please suggest me a better way to tackle this problem.

    Read the article

  • Installing django on dreamhost (help a newb out)

    - by augustfirst
    I'm trying to get django running on my dreahost account. I've been trying to sort of use two tutorials at once: the one on the dreamhost wiki and the one in the django book. I installed django using the script on the wiki page, but I ran into trouble immediately while trying to work through the django book. It says: To start the server, change into your project directory (cd mysite), if you haven’t already, and run this command: python manage.py runserver This launches the server locally, on port 8000, accessible only to connections from your own computer. Now that it’s running, visit 127.0.0.1:8000 with your Web browser. You’ll see a “Welcome to Django” page shaded in a pleasant pastel blue. It worked! Those instructions seem to assume that you're developing locally, not on a shared server. Where the heck am I supposed to look for the "Welcome to Django" page after starting the server? In my webroot? No dice. Anyway, I tried to blunder ahead through the django book to its hello world tutorial (chapter 3). But once I've edited the view file and the URLconf, I don't get a nice clean "hello world" text. Instead (as you can see) I get an "import error". Any help would be greatly appreciated.

    Read the article

  • Operating on rows and then on columns of a matrix produces code duplication

    - by Chetan
    I have the following (Python) code to check if there are any rows or columns that contain the same value: # Test rows -> # Check each row for a win for i in range(self.height): # For each row ... firstValue = None # Initialize first value placeholder for j in range(self.width): # For each value in the row if (j == 0): # If it's the first value ... firstValue = b[i][j] # Remember it else: # Otherwise ... if b[i][j] != firstValue: # If this is not the same as the first value ... firstValue = None # Reset first value break # Stop checking this row, there's no win here if (firstValue != None): # If first value has been set # First value placeholder now holds the winning player's code return firstValue # Return it # Test columns -> # Check each column for a win for i in range(self.width): # For each column ... firstValue = None # Initialize first value placeholder for j in range(self.height): # For each value in the column if (j == 0): # If it's the first value ... firstValue = b[j][i] # Remember it else: # Otherwise ... if b[j][i] != firstValue: # If this is not the same as the first value ... firstValue = None # Reset first value break # Stop checking this column, there's no win here if (firstValue != None): # If first value has been set # First value placeholder now holds the winning player's code return firstValue # Return it Clearly, there is a lot of code duplication here. How do I refactor this code? Thanks!

    Read the article

  • Is www.example.com/post/21/edit a RESTful URI? I think I know the answer, but have another question.

    - by tmadsen
    I'm almost afraid to post this question, there has to be an obvious answer I've overlooked, but here I go: Context: I am creating a blog for educational purposes (want to learn python and web.py). I've decided that my blog have posts, so I've created a Post class. I've also decided that posts can be created, read, updated, or deleted (so CRUD). So in my Post class, I've created methods that respond to POST, GET, PUT, and DELETE HTTP methods). So far so good. The current problem I'm having is a conceptual one, I know that sending a PUT HTTP message (with an edited Post) to, e.g., /post/52 should update post with id 52 with the body contents of the HTTP message. What I do not know is how to conceptually correctly serve the (HTML) edit page. Will doing it like this: /post/52/edit violate the idea of URI, as 'edit' is not a resource, but an action? On the other side though, could it be considered a resource since all that URI will respond to is a GET method, that will only return an HTML page? So my ultimate question is this: How do I serve an HTML page intended for user editing in a RESTful manner?

    Read the article

  • Fetching just the Key/id from a ReferenceProperty in App Engine

    - by ozone
    Hi SO, I could use a little help in AppEngine land... Using the [Python] API I create relationships like this example from the docs: class Author(db.Model): name = db.StringProperty() class Story(db.Model): author = db.ReferenceProperty(Author) story = db.get(story_key) author_name = story.author.name As I understand it, that example will make two datastore queries. One to fetch the Story and then one to deference the Author inorder to access the name. But I want to be able to fetch the id, so do something like: story = db.get(story_key) author_id = story.author.key().id() I want to just get the id from the reference. I do not want to have to deference (therefore query the datastore) the ReferenceProperty value. From reading the documentation it says that the value of a ReferenceProperty is a Key Which leads me to think that I could just call .id() on the reference's value. But it also says: The ReferenceProperty model provides features for Key property values such as automatic dereferencing. I can't find anything that explains when this referencing takes place? Is it safe to call .id() on the ReferenceProperty's value? Can it be assumed that calling .id() will not cause a datastore lookup?

    Read the article

  • Ways of breaking down SQL transactional/call data into reports -- 'square data'?

    - by RizwanK
    I've got a large database of call-traffic information (although the question could be answered with any generic data set.) For instance, a row contains : call endpoint server (endpoint_name) call endpoint status (sip_disconnect_reason) call destination (destination) call completed (duration) [duration 0 is completed] call account group (account_group) It's pretty easy to run SQL reports against the data, i.e. select count(*), endpoint_name from calls where duration0 group by endpoint_name select count(*),destination from calls where blah group by destination I've been calling this filtering or breakdown reports (I get the number of calls per carrier, etc.). Add another breakdown, and you've got two breakdowns, a la select count(*), endpoint_name, sip_disconnect_reason from calls where duration=0 group by endpoint_name, sip_disconnect_reason Of course, if you keep adding breakdowns, you end up making super-large reports and slicing your data so thin that you can't extract any trends from it. So my question is this : Is there a name for this sort of method of report writing? (I've heard words like squares, slicing and breakdown reports applied to them) --- I'm looking for a Python/Reporting toolkit that I can use to make these easier to generate for my end users. aside : Are there other ways of representing transactional data that might be useful rather than the above method? Thanks,

    Read the article

  • Django sub-applications & module structure

    - by Rob Golding
    I am developing a Django application, which is a large system that requires multiple sub-applications to keep things neat. Therefore, I have a top level directory that is a Django app (as it has an empty models.py file), and multiple subdirectories, which are also applications in themselves. The reason I have laid my application out in this way is because the sub-applications are separated, but they would never be used on their own, outside the parent application. It therefore makes no sense to distribute them separately. When installing my application, the settings file has to include something like this: INSTALLED_APPS = ( ... 'myapp', 'myapp.subapp1', 'myapp.subapp2', ... ) ...which is obviously suboptimal. This also has the slightly nasty result of requiring that all the sub-applications are referred to by their "inner" name (i.e. subapp1, subapp2 etc.). For example, if I want to reset the database tables for subapp1, I have to type: python manage.py reset subapp1 This is annoying, especially because I have a sub-app called core - which is likely to conflict with another application's name when my application is installed in a user's project. Am I doing this completely wrongly, or is there away to force these "inner" apps to be referred to by their full name?

    Read the article

  • why does cx_oracle execute() not like my string now?

    - by Frank Stallone
    I've downloaded cx_oracle some time ago and wrote a script to convert data to XML. I've had to reisntall my OS and grabbed the latest version of cx_Oracle (5.0.3) and all of the sudden my code is broken. The first thing was that cx_Oracle.connect wanted unicode rather string for the username and password, that was very easy to fix. But now it keeps failing on the cursor.execute and tells me my string is not a string even when type() tells me it is a string. Here is a test script I initally used ages ago and worked fine on my old version but does not work on cx_Oracle now. import cx_Oracle ip = 'url.to.oracle' port = 1521 SID = 'mysid' dsn_tns = cx_Oracle.makedsn(ip, port, SID) connection = cx_Oracle.connect(u'name', u'pass', dsn_tns) cursor = connection.cursor() cursor.arraysize = 50 sql = "select isbn, title_code from core_isbn where rownum<=20" print type(sql) cursor.execute(sql) for isbn, title_code in cursor.fetchall(): print "Values from DB:", isbn, title_code cursor.close() connection.close() When I run that I get: Traceback (most recent call last): File "C:\NetBeansProjects\Python\src\db_temp.py", line 48, in cursor.execute(sql) TypeError: expecting None or a string Does anyone know what I may be doing wrong?

    Read the article

  • Django: DatabaseError column does not exist

    - by Rosarch
    I'm having a problem with Django 1.2.4. Here is a model: class Foo(models.Model): # ... ftw = models.CharField(blank=True) bar = models.ForeignKey(Bar) Right after flushing the database, I use the shell: Python 2.6.6 (r266:84292, Sep 15 2010, 15:52:39) [GCC 4.4.5] on linux2 Type "help", "copyright", "credits" or "license" for more information. (InteractiveConsole) >>> from apps.foo.models import Foo >>> Foo.objects.all() Traceback (most recent call last): File "<console>", line 1, in <module> File "/usr/local/lib/python2.6/dist-packages/django/db/models/query.py", line 67, in __repr__ data = list(self[:REPR_OUTPUT_SIZE + 1]) File "/usr/local/lib/python2.6/dist-packages/django/db/models/query.py", line 82, in __len__ self._result_cache.extend(list(self._iter)) File "/usr/local/lib/python2.6/dist-packages/django/db/models/query.py", line 271, in iterator for row in compiler.results_iter(): File "/usr/local/lib/python2.6/dist-packages/django/db/models/sql/compiler.py", line 677, in results_iter for rows in self.execute_sql(MULTI): File "/usr/local/lib/python2.6/dist-packages/django/db/models/sql/compiler.py", line 732, in execute_sql cursor.execute(sql, params) File "/usr/local/lib/python2.6/dist-packages/django/db/backends/util.py", line 15, in execute return self.cursor.execute(sql, params) File "/usr/local/lib/python2.6/dist-packages/django/db/backends/postgresql_psycopg2/base.py", line 44, in execute return self.cursor.execute(query, args) DatabaseError: column foo_foo.bar_id does not exist LINE 1: ...t_omg", "foo_foo"."ftw", "foo_foo... What am I doing wrong here?

    Read the article

  • Pymedia video encoding failed

    - by user1474837
    I am using Python 2.5 with Windows XP. I am trying to make a list of pygame images into a video file using this function. I found the function on the internet and edited it. It worked at first, than it stopped working. This is what it printed out: Making video... Formating 114 Frames... starting loop making encoder Frame 1 process 1 Frame 1 process 2 Frame 1 process 2.5 This is the error: Traceback (most recent call last): File "ScreenCapture.py", line 202, in <module> makeVideoUpdated(record_files, video_file) File "ScreenCapture.py", line 151, in makeVideoUpdated d = enc.encode(da) pymedia.video.vcodec.VCodecError: Failed to encode frame( error code is 0 ) This is my code: def makeVideoUpdated(files, outFile, outCodec='mpeg1video', info1=0.1): fw = open(outFile, 'wb') if (fw == None) : print "Cannot open file " + outFile return if outCodec == 'mpeg1video' : bitrate= 2700000 else: bitrate= 9800000 start = time.time() enc = None frame = 1 print "Formating "+str(len(files))+" Frames..." print "starting loop" for img in files: if enc == None: print "making encoder" params= {'type': 0, 'gop_size': 12, 'frame_rate_base': 125, 'max_b_frames': 90, 'height': img.get_height(), 'width': img.get_width(), 'frame_rate': 90, 'deinterlace': 0, 'bitrate': bitrate, 'id': vcodec.getCodecID(outCodec) } enc = vcodec.Encoder(params) # Create VFrame print "Frame "+str(frame)+" process 1" bmpFrame= vcodec.VFrame(vcodec.formats.PIX_FMT_RGB24, img.get_size(), # Covert image to 24bit RGB (pygame.image.tostring(img, "RGB"), None, None) ) print "Frame "+str(frame)+" process 2" # Convert to YUV, then codec da = bmpFrame.convert(vcodec.formats.PIX_FMT_YUV420P) print "Frame "+str(frame)+" process 2.5" d = enc.encode(da) #THIS IS WHERE IT STOPS print "Frame "+str(frame)+" process 3" fw.write(d.data) print "Frame "+str(frame)+" process 4" frame += 1 print "savng file" fw.close() Could somebody tell me why I have this error and possibly how to fix it? The files argument is a list of pygame images, outFile is a path, outCodec is default, and info1 is not used anymore. UPDATE 1 This is the code I used to make that list of pygame images. from PIL import ImageGrab import time, pygame pygame.init() f = [] #This is the list that contains the images fps = 1 for n in range(1, 100): info = ImageGrab.grab() size = info.size mode = info.mode data = info.tostring() info = pygame.image.fromstring(data, size, mode) f.append(info) time.sleep(fps)

    Read the article

  • Forwarding keypresses in GTK

    - by dguaraglia
    I'm writing a bit of code for a Gedit plugin. I'm using Python and the interface (obviously) is GTK. So, the issue I'm having is quite simple: I have a search box (a gtk.Entry) and right below I have a results box (a gtk.TreeView). Right after you type something in the search box you are presented a bunch of results, and I would like the user to be able to press the Up/Down keys to select one, Enter to choose it, and be done. Thing is, I can't seem to find a way to forward the Up/Down keypress to the TreeView. Currently I have this piece of code: def __onSearchKeyPress(self, widget, event): """ Forward up and down keys to the tree. """ if event.keyval in [gtk.keysyms.Up, gtk.keysyms.Down]: print "pressed up or down" e = gtk.gdk.Event(gtk.gdk.KEY_PRESS) e.keyval = event.keyval e.window = self.browser.window e.send_event = True self.browser.emit("key-press-event", e) return True I can clearly see I'm receiving the right kind of event, but the event I'm sending gets ignored by the TreeView. Any ideas? Thanks in advance people.

    Read the article

  • Creating collaborative whiteboard drawing application

    - by Steven Sproat
    I have my own drawing program in place, with a variety of "drawing tools" such as Pen, Eraser, Rectangle, Circle, Select, Text etc. It's made with Python and wxPython. Each tool mentioned above is a class, which all have polymorphic methods, such as left_down(), mouse_motion(), hit_test() etc. The program manages a list of all drawn shapes -- when a user has drawn a shape, it's added to the list. This is used to manage undo/redo operations too. So, I have a decent codebase that I can hook collaborative drawing into. Each shape could be changed to know its owner -- the user who drew it, and to only allow delete/move/rescale operations to be performed on shapes owned by one person. I'm just wondering the best way to develop this. One person in the "session" will have to act as the server, I have no money to offer free central servers. Somehow users will need a way to connect to servers, meaning some kind of "discover servers" browser...or something. How do I broadcast changes made to the application? Drawing in realtime and broadcasting a message on each mouse motion event would be costly in terms of performance and things get worse the more users there are at a given time. Any ideas are welcome, I'm not too sure where to begin with developing this (or even how to test it)

    Read the article

  • Process xml-like log file queue

    - by Zsolt Botykai
    Hi all, first of all: I'm not a programmer, never was, although had learn a lot during my professional carreer as a support consultant. Now my task is to process - and create some statistics about a constantly written and rapidly growing XML like log file. It's not valid XML, because it does not have a proper <root> element, e.g. the log looks like this: <log itemdate="somedate"> <field id="0" /> ... </log> <log itemdate="somedate+1"> <field id="0" /> ... </log> <log itemdate="somedate+n"> <field id="0" /> ... </log> E.g. I have to count all the items with field id=0. But most of the solutions I had found (e.g. using XPath) reports an error about the garbage after the first closing </log>. Most probably I can use python (2.6, although I can compile 3.x as well), or some really old perl version (5.6.x), and recently compiled xmlstarlet which really looks promising - I was able to create the statistics for a certain period after copying the file, and pre- & appending the opening and closing root element. But this is a huge file and copying takes time as well. Isn't there a better solution? Thanks in advance!

    Read the article

  • Is there a programmatic way to transform a sequence of image files into a PDF?

    - by Salim Fadhley
    I have a sequence of JPG images. Each of the scans is already cropped to the exact size of one page. They are sequential pages of a valuable and out of print book. The publishing application requires that these pages be submitted as a single PDF file. I could take each of these images and just past them into a word-processor (e.g. OpenOffice) - unfortunately the problem here is that it's a very big book and I've got quite a few of these books to get through. It would obviously be time-consuming. This is volunteer work! My second idea was to use LaTeX - I could make a very simple document that consists of nothing more than a series of in-line image includes. I'm sure that this approach could be made to work, it's just a little on the complex side for something which seems like a very simple job. It occurred to me that there must be a simpler way - so any suggestions? I'm on Ubuntu 9.10, my primary programming language is Python, but if the solution is super-simple I'd happily adopt any technology that works.

    Read the article

  • sqlalchemy dynamic mapping

    - by adancu
    Hi, I have the following problem: I have the class: class Word(object): def __init__(self): self.id = None self.columns = {} def __str__(self): return "(%s, %s)" % (str(self.id), str(self.columns)) self.columns is a dict which will hold (columnName:columnValue) values. The name of the columns are known at runtime and they are loaded in a wordColumns list, for example wordColumns = ['english', 'korean', 'romanian'] wordTable = Table('word', metadata, Column('id', Integer, primary_key = True) ) for columnName in wordColumns: wordTable.append_column(Column(columnName, String(255), nullable = False)) I even created a explicit mapper properties to "force" the table columns to be mapped on word.columns[columnName], instead of word.columnName, I don't get any error on mapping, but it seems that doesn't work. mapperProperties = {} for column in wordColumns: mapperProperties['columns[\'%']' % column] = wordTable.columns[column] mapper(Word, wordTable, mapperProperties) When I load a word object, SQLAlchemy creates an object which has the word.columns['english'], word.columns['korean'] etc. properties instead of loading them into word.columns dict. So for each column, it creates a new property. Moreover word.columns dictionary doesn't even exists. The same way, when I try to persist a word, SQLAlchemy expects to find the column values in properties named like word.columns['english'] (string type) instead of the dictionary word.columns. I have to say that my experience with Python and SQLAlchemy is quite limited, maybe it isn't possible to do what I'm trying to do. Any help appreciated, Thanks in advance.

    Read the article

  • pyOpenSSL and the WantReadError

    - by directedition
    I have a socket server that I am trying to move over to SSL on python 2.5, but I've run into a snag with pyOpenSSL. I can't find any good tutorials on using it, so I'm operating largely on guesses. Here is how my server sets up the socket: ctx = SSL.Context(SSL.SSLv23_METHOD) ctx.use_privatekey_file ("mykey.pem") ctx.use_certificate_file("mycert.pem") sock = SSL.Connection(ctx, socket.socket(socket.AF_INET, socket.SOCK_STREAM)) sock.setsockopt(socket.SOL_SOCKET, socket.SO_REUSEADDR, 1) addr = ('', int(8081)) sock.bind(addr) sock.listen(5) Here is how it accepts clients: sock.setblocking(0) while True: if len(select([sock], [], [], 0.25)[0]): client_sock, client_addr = sock.accept() client = ClientGen(client_sock) And here is how it sends/receives from the connected sockets: while True: (r, w, e) = select.select([sock], [sock], [], 0.25) if len(r): bytes = sock.recv(1024) if len(w): n_bytes = sock.send(self.message) It's compacted, but you get the general idea. The problem is, once the send/receive loop starts, it dies right away, before anything has been sent or received (that I can see anyway): Traceback (most recent call last): File "ClientGen.py", line 50, in networkLoop n_bytes = sock.send(self.message WantReadError The manual's description of the 'WantReadError' is very vague, saying it can come from just about anywhere. What am I doing wrong?

    Read the article

  • Design an Application That Stores and Processes Files

    - by phasetwenty
    I'm tasked with writing an application that acts as a central storage point for files (usually document formats) as provided by other applications. It also needs to take commands like "file 395 needs a copy in X format", at which point some work is offloaded to a 3rd party application. I'm having trouble coming up with a strategy for this. I'd like to keep the design as simple as possible, so I'd like to avoid big extra frameworks or techniques like threads for as long as it makes sense. The clients are expected to be web applications (for example, one is a django application that receives files from our customers; the others are not yet implemented). The platform it will be running on is likely going to be Python on Linux, unless I have a strong argument to use something else. In the beginning I thought I could fit the information I wanted to communicate in the filenames, and let my application parse the filename to figure out what it needed to do, but this is proving too inflexible with the amount of information I'm realizing I need to make available. Another idea is to pair FTP with a database used as a communication medium (client uploads a file and updates the database with a command as a row in a table) but I don't like this idea because adding commands (a known change) looks like it will require adding code as well as changing database schemas. It will also muddy up the interface my clients will have to use. I looked into Pyro to let applications communicate more directly but I don't like the idea of running an extra nameserver for this one purpose. I also don't see a good way to do file transfer within this framework. What I'm looking for is techniques and/or technologies applicable to my problem. At the simplest level, I need the ability to accept files and messages with them.

    Read the article

  • Ubuntu + virtualenv = a mess? virtualenv hates dist-packages, wants site-packages

    - by lostincode
    Can someone please explain to me what is going on with python in ubuntu 9.04? I'm trying to spin up virtualenv, and the --no-site-packages flag seems to do nothing with ubuntu. I installed virtualenv 1.3.3 with easy_install (which I've upgraded to setuptools 0.6c9) and everything seems to be installed to /usr/local/lib/python2.6/dist-packages I assume that when installing a package using apt-get, it's placed in /usr/lib/python2.6/dist-packages/ ? The issue is, there is a /usr/local/lib/python2.6/site-packages as well that just sits there being empty. It would seem (by looking at the path in a virtualenv) that this is the folder virtualenv uses as backup. Thus even thought I omit --no-site-packages, I cant access my local systems packages from any of my virtualenv's. So my questions are: How do I get virtualenv to point to one of the dist-packages? Which dist-packages should I point it to? /usr/lib/python2.6/dist-packages or /usr/local/lib/python2.6/dist-packages/ What is the point of /usr/lib/python2.6/site-packages? There's nothing in there! Is it first come first serve on the path? If I have a newer version of package XYZ installed in /usr/local/lib/python2.6/dist-packages/ and and older one (from ubuntu repos/apt-get) in /usr/lib/python2.6/dist-packages, which one gets imported when I import xyz? I'm assuming this is based on the path list, yes? Why the hell is this so confusing? Is there something I'm missing here? Where is it defined that easy_install should install to /usr/local/lib/python2.6/dist-packages? Will this affect pip as well? Thanks to anyone who can clear this up!

    Read the article

  • Accessing data entered into multiple Django forms and generating them onto a new URL

    - by pedjk
    I have a projects page where users can start up new projects. Each project has two forms. The two forms are: class ProjectForm(forms.Form): Title = forms.CharField(max_length=100, widget=_hfill) class SsdForm(forms.Form): Status = forms.ModelChoiceField(queryset=P.ProjectStatus.objects.all()) With their respective models as follows: class Project(DeleteFlagModel): Title = models.CharField(max_length=100) class Ssd(models.Model): Status = models.ForeignKey(ProjectStatus) Now when a user fills out these two forms, the data is saved into the database. What I want to do is access this data and generate it onto a new URL. So I want to get the "Title" and the "Status" from these two forms and then show them on a new page for that one project. I don't want the "Title" and "Status" from all the projects to show up, just for one project at a time. If this makes sense, how would I do this? I'm very new to Django and Python (though I've read the Django tutorials) so I need as much help as possible. Thanks in advance Edit: The ProjectStatus code is (under models): class ProjectStatus(models.Model): Name = models.CharField(max_length=30) def __unicode__(self): return self.Name

    Read the article

  • Is There a Better Way to Feed Different Parameters into Functions with If-Statements?

    - by FlowofSoul
    I've been teaching myself Python for a little while now, and I've never programmed before. I just wrote a basic backup program that writes out the progress of each individual file while it is copying. I wrote a function that determines buffer size so that smaller files are copied with a smaller buffer, and bigger files are copied with a bigger buffer. The way I have the code set up now doesn't seem very efficient, as there is an if loop that then leads to another if loops, creating four options, and they all just call the same function with different parameters. import os import sys def smartcopy(filestocopy, dest_path, show_progress = False): """Determines what buffer size to use with copy() Setting show_progress to True calls back display_progress()""" #filestocopy is a list of dictionaries for the files needed to be copied #dictionaries are used as the fullpath, st_mtime, and size are needed if len(filestocopy.keys()) == 0: return None #Determines average file size for which buffer to use average_size = 0 for key in filestocopy.keys(): average_size += int(filestocopy[key]['size']) average_size = average_size/len(filestocopy.keys()) #Smaller buffer for smaller files if average_size < 1024*10000: #Buffer sizes determined by informal tests on my laptop if show_progress: for key in filestocopy.keys(): #dest_path+key is the destination path, as the key is the relative path #and the dest_path is the top level folder copy(filestocopy[key]['fullpath'], dest_path+key, callback = lambda pos, total: display_progress(pos, total, key)) else: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, callback = None) #Bigger buffer for bigger files else: if show_progress: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, 1024*2600, callback = lambda pos, total: display_progress(pos, total, key)) else: for key in filestocopy.keys(): copy(filestocopy[key]['fullpath'], dest_path+key, 1024*2600) def display_progress(pos, total, filename): percent = round(float(pos)/float(total)*100,2) if percent <= 100: sys.stdout.write(filename + ' - ' + str(percent)+'% \r') else: percent = 100 sys.stdout.write(filename + ' - Completed \n') Is there a better way to accomplish what I'm doing? Sorry if the code is commented poorly or hard to follow. I didn't want to ask someone to read through all 120 lines of my poorly written code, so I just isolated the two functions. Thanks for any help.

    Read the article

  • Add a value to an element in a list of sets

    - by Kapelson
    Hello. I'm using python, and I have a list of sets, constructed like this: list = [set([])]*n ...where n is the number of sets I want in the list. I want to add a value to a specific set in the list. Say, the second set. I tried list[1].add(value) But this instead adds the value to each set in the list. This behaviour is pretty non-intuitive to me. Through further tests, I think I've found the problem: the list apparently contains 10 instances of the same set, or ten pointers to the same set, or something. Constructing the list through repeated calls of list.append(set([])) allowed me to use the syntax above to add elements to single sets. So my question is this: what exactly is going on in my first list-construction technique? It is clear I don't understand the syntax so well. Also, is there a better way to intialize an n-element list? I've been using this syntax for a while and this is my first problem with it.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Nose2 multiprocess error on Windows7

    - by tt293
    I was looking into nose2 as a way to get around the restrictions of having both xunit output and multiprocessing in nose1.3. However, when always-on is set to False in the [multiprocess] section, I can only get a single process running, while when running with always-on set to True, I get the following error: ---------------------------------------------------------------------- Ran 0 tests in 0.043s OK Traceback (most recent call last): File "C:\dev\testing\Tests\PythonTests\venv\Scripts\nose2-script.py", line 8, in <module> load_entry_point('nose2==0.4.7', 'console_scripts', 'nose2')() File "C:\dev\testing\Tests\PythonTests\venv\lib\site-packages\nose2-0.4.7-py2. 7.egg\nose2\main.py", line 284, in discover return main(*args, **kwargs) File "C:\dev\testing\Tests\PythonTests\venv\lib\site-packages\nose2-0.4.7-py2. 7.egg\nose2\main.py", line 98, in __init__ super(PluggableTestProgram, self).__init__(**kw) File "C:\dev\testing\Tests\PythonTests\venv\lib\site-packages\unittest2-0.5.1- py2.7.egg\unittest2\main.py", line 98, in __init__ self.runTests() File "C:\dev\testing\Tests\PythonTests\venv\lib\site-packages\nose2-0.4.7-py2. 7.egg\nose2\main.py", line 260, in runTests self.result = runner.run(self.test) File "C:\dev\testing\Tests\PythonTests\venv\lib\site-packages\nose2-0.4.7-py2. 7.egg\nose2\runner.py", line 53, in run executor(test, result) File "C:\dev\testing\Tests\PythonTests\venv\lib\site-packages\nose2-0.4.7-py2. 7.egg\nose2\plugins\mp.py", line 60, in _runmp ready, _, _ = select.select(rdrs, [], [], self.testRunTimeout) select.error: (10038, 'An operation was attempted on something that is not a soc ket') This is running python 2.7.5 (32bit) on Windows 7 in a virtualenv with six-1.1.0, unittest2-0.5.1 and nose2-0.4.7 (I get the same behavior outside of the venv, so I don't think that is the issue here).

    Read the article

< Previous Page | 313 314 315 316 317 318 319 320 321 322 323 324  | Next Page >