Search Results

Search found 10033 results on 402 pages for 'topic template'.

Page 321/402 | < Previous Page | 317 318 319 320 321 322 323 324 325 326 327 328  | Next Page >

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • How do I optimize this postfix expression tree for speed?

    - by Peter Stewart
    Thanks to the help I received in this post: I have a nice, concise recursive function to traverse a tree in postfix order: deque <char*> d; void Node::postfix() { if (left != __nullptr) { left->postfix(); } if (right != __nullptr) { right->postfix(); } d.push_front(cargo); return; }; This is an expression tree. The branch nodes are operators randomly selected from an array, and the leaf nodes are values or the variable 'x', also randomly selected from an array. char *values[10]={"1.0","2.0","3.0","4.0","5.0","6.0","7.0","8.0","9.0","x"}; char *ops[4]={"+","-","*","/"}; As this will be called billions of times during a run of the genetic algorithm of which it is a part, I'd like to optimize it for speed. I have a number of questions on this topic which I will ask in separate postings. The first is: how can I get access to each 'cargo' as it is found. That is: instead of pushing 'cargo' onto a deque, and then processing the deque to get the value, I'd like to start processing it right away. I don't yet know about parallel processing in c++, but this would ideally be done concurrently on two different processors. In python, I'd make the function a generator and access succeeding 'cargo's using .next(). But I'm using c++ to speed up the python implementation. I'm thinking that this kind of tree has been around for a long time, and somebody has probably optimized it already. Any Ideas? Thanks

    Read the article

  • How to detect a gamepad button press on OSX 10.5 and higher?

    - by Steph Thirion
    How do I detect a button press on a USB gamepad on OSX 10.5 and higher? I can't wrap my head around the ridiculously complex HID Manager (even though apparently it was simplified with 10.5), and the code samples at Apple have thousands of lines of code that would take days to understand and isolate what I need, so I'd appreciate if someone posts a simple, and fully coded solution for this isolated problem. EDIT: so far all answers are links to source code or semi obscure libraries for all kinds of HID devices, which will require more research time than what I'd like to invest on this. I am starting a bounty to get an actual snippet of code that solves this simple problem (using an external library or not). EDIT POS BOUNTY: thanks to all for you help; but unfortunately the answer that has been automatically selected by the system is not working for me, can't figure out why; and the author has not yet replied to my comments. Any insight would be appreciated, but until a fix is found, anyone looking for resources on this topic should take this answer with a pinch of salt.

    Read the article

  • Reading bmp file for encrypting and decrypting txt file into it

    - by Shantanu Gupta
    I am trying to read a bmp file in C++(Turbo). But i m not able to print binary stream. I want to encode txt file into it and decrypt it. How can i do this. I read that bmp file header is of 54 byte. But how and where should i append txt file in bmp file. ? I know only Turbo C++, so it would be helpfull for me if u provide solution or suggestion related to topic for the same. int main() { ifstream fr; //reads ofstream fw; // wrrites to file char c; int random; clrscr(); char file[2][100]={"s.bmp","s.txt"}; fr.open(file[0],ios::binary);//file name, mode of open, here input mode i.e. read only if(!fr) cout<<"File can not be opened."; fw.open(file[1],ios::app);//file will be appended if(!fw) cout<<"File can not be opened"; while(!fr) cout<<fr.get(); // error should be here. but not able to find out what error is it fr.close(); fw.close(); getch(); } This code is running fine when i pass txt file in binary mode

    Read the article

  • Return 0 where django quersyet is none

    - by gramware
    I have a django queryset in my views whose values I pack before passing to my template. There is a problem when the queryset returns none since associated values are not unpacked. the quersyet is called comments. Here is my views.py def forums(request ): post_list = list(forum.objects.filter(child='0')&forum.objects.filter(deleted='0').order_by('postDate')) user = UserProfile.objects.get(pk=request.session['_auth_user_id']) newpostform = PostForm(request.POST) deletepostform = PostDeleteForm(request.POST) DelPostFormSet = modelformset_factory(forum, exclude=('child','postSubject','postBody','postPoster','postDate','childParentId')) readform = ReadForumForm(request.POST) comments =list( forum.objects.filter(deleted='0').filter(child='1').order_by('childParentId').values('childParentId').annotate(y=Count('childParentId'))) if request.user.is_staff== True : staff = 1 else: staff = 0 staffis = 1 if newpostform.is_valid(): topic = request.POST['postSubject'] poster = request.POST['postPoster'] newpostform.save() return HttpResponseRedirect('/forums') else: newpostform = PostForm(initial = {'postPoster':user.id}) if request.GET: form = SearchForm(request.GET) if form.is_valid(): query = form.cleaned_data['query'] post_list = list((forum.objects.filter(child='0')&forum.objects.filter(deleted='0')&forum.objects.filter(Q(postSubject__icontains=query)|Q(postBody__icontains=query)|Q(postDate__icontains=query)))or(forum.objects.filter(deleted='0')&forum.objects.filter(Q(postSubject__icontains=query)|Q(postBody__icontains=query)|Q(postDate__icontains=query)).values('childParentId'))) if request.method == 'POST': delpostformset = DelPostFormSet(request.POST) if delpostformset.is_valid(): delpostformset.save() return HttpResponseRedirect('/forums') else: delpostformset = DelPostFormSet(queryset=forum.objects.filter(child='0', deleted='0')) """if readform.is_valid(): user=get_object_or_404(UserProfile.objects.all()) readform.save() else: readform = ReadForumForm()""" post= zip( post_list,comments, delpostformset.forms) paginator = Paginator(post, 10) # Show 10 contacts per page # Make sure page request is an int. If not, deliver first page. try: page = int(request.GET.get('page', '1')) except ValueError: page = 1 # If page request (9999) is out of range, deliver last page of results. try: post = paginator.page(page) except (EmptyPage, InvalidPage): post = paginator.page(paginator.num_pages) return render_to_response('forum.html', {'post':post, 'newpostform': newpostform,'delpost':delpostformset, 'username':user.username, 'comments':comments, 'user':user, },context_instance = RequestContext( request ))

    Read the article

  • OSGI, Servlets and JPA hello world / tutorial / example

    - by Kamil
    I want to build a web application which basically is a restful web-service serving json messages. I would like it to be as simple as possible. I was thinking about using servlets (with annotations). JPA as a database layer is a must - Toplink or Hibernate. Preferably working on Tomcat. I want to have app divided into modules serving different functionality (auth service, customer service, etc..). And I would like to be able to update those modules without reinstalling whole application on the server - like eclipse plugins, user is notified (when he enters webapp's home url) that update is available, clicks it, and app is downloading and installing updated module. I think this functionality can be made with OSGI, but I can't find any example code, or tutorial with simple hello world updatable servlet providing some data from database through jpa. I'm looking for an advice: - Is OSGI the right tool for this or it can be done with something simpler? - Where can I find some examples covering topic (or topics) which I need for this project. - Which OSGI implementation would be best-simplest for this task. *My knowledge of OSGI is basic. I know how bundles are described, I understand concept of OSGI container and what it does. I have never created any OSGI app yet.

    Read the article

  • Record the timestamps of slide changes during a live Powerpoint presentation?

    - by StackedCrooked
    I am planning to implement a lecture capture solution. One of the requirements is to record both the presenter and the slideshow. The presenter is recorded with a videocamera obviously, and the slideshow will probably be captured using a tool like Camtasia. Now during playback three components are visible: the presenter, the slides and a table of contents. Clicking a chapter title in the TOC causes the video to navigate to the corresponding section. This means that a mapping must be made between chapter titles and their timestamps in the video. Usually a change of topic is accompanied with a slide change in the Powerpoint presentation. So the timestamps could be deduced from the slidechanges. However, this requires me to detect slide changes during the live presentation. And I don't know how to do that. Anyone here knows how to do detect slide changes? Is there a Powerpoint API where I can connect event handlers or something like that? I'd greatly appreciate your help! Edit This issue is no longer relevant for my current work so this question will not be updated by me. However, you are still free to help others by posting your answers/insights here.

    Read the article

  • How do I detect proximity of the mouse pointer to a line in Flex?

    - by Hanno Fietz
    I'm working on a charting UI in Flex. One of the features I want to implement is "snapping" of the mousepointer to the data points in the diagram. I. e., if the user hovers the mouse pointer over a line diagram and gets close to the data point, I want the pointer to move to the exact coordinates and show a marker, like this: Currently, the lines are drawn on a Shape, using the Graphics API. The Shape is a child DisplayObject of a custom UIComponent subclass with the exact same dimensions. This means, I already get mouseOver events on the parent of the diagram's canvas. Now I need a way to detect if the pointer is close to one of the data points. I. e. I need an answer to the question "Which data points lie within a radius of x pixels from my current position and which of them is closest?" upon each move of the mouse. I can think of the following possibilities: draw the lines not as simple lines in the graphics API, but as more advanced objects that can have their own mouseOver events. However, I want the snapping to trigger before the mouse is actually over the line. check the original data for possible candidates upon each mouse movement. Using binary search, I might be able to reduce the number of items I have to compare sufficently. prepare some kind of new data structure from the raw data that makes the above search more efficient. I don't know how that would look like. I'm guessing this is a pretty standard problem for a number of applications, but probably the actual code usually is inside of some framework. Is there anything I can read about this topic?

    Read the article

  • How would you implement a hashtable in language x?

    - by mk
    The point of this question is to collect a list of examples of hashtable implementations using arrays in different languages. It would also be nice if someone could throw in a pretty detailed overview of how they work, and what is happening with each example. Edit: Why not just use the built in hash functions in your specific language? Because we should know how hash tables work and be able to implement them. This may not seem like a super important topic, but knowing how one of the most used data structures works seems pretty important to me. If this is to become the wikipedia of programming, then these are some of the types of questions that I will come here for. I'm not looking for a CS book to be written here. I could go pull Intro to Algorithms off the shelf and read up on the chapter on hash tables and get that type of info. More specifically what I am looking for are code examples. Not only for me in particular, but also for others who would maybe one day be searching for similar info and stumble across this page. To be more specific: If you had to implement them, and could not use built-in functions, how would you do it? You don't need to put the code here. Put it in pastebin and just link it.

    Read the article

  • Is XSLT worth investing time in and are there any actual alternatives?

    - by Keeno
    I realize this has been a few other questions on this topic, and people are saying use your language of choice to manipulate the XML etc etc however, not quite fit my question exactly. Firstly, the scope of the project: We want to develop platform independent e-learning, currently, its a bunch of HTML pages but as they grow and develop they become hard to maintain. The idea: Generate up an XML file + Schema, then produce some XSLT files that process the XML into the eLearning modiles. XML to HTML via XSLT. Why: We would like the flexibilty to be able to easy reformat the content (I realize CSS is a viable alternative here) If we decide to alter the pages layout or functionality in anyway, im guessing altering the "shared" XSLT files would be easier than updating the HTML files. So far, we have about 30 modules, with up to 10-30 pages each Depending on some "parameters" we could output drastically different page layouts/structures, above and beyond what CSS can do Now, all this has to be platform independent, and to be able to run "offline" i.e. without a server powering the HTML Negatives I've read so far for XSLT: Overhead? Not exactly sure why...is it the compute power need to convert to HTML? Difficult to learn Better alternatives Now, what I would like to know exactly is: are there actually any viable alternatives for this "offline"? Am I going about it in the correct manner, do you guys have any advice or alternatives. Thanks!

    Read the article

  • Counting combinations in c or in python

    - by Dennis
    Hello I looked a bit on this topic here but I found nothing that could help me. I need a program in Python or in C that will give me all possible combinations of a and b that will meet the requirement n=2*a+b, for n from 0 to 10. a, b and n are integers. For example if n=0 both a and b must be 0. For n=1 a must be zero and b must be 1, for n=2 a can be 1 and b=0, or a=0 and b=2, etc. I'm not that good with programming. I made this: #include <stdio.h> int main(void){ int a,b,n; for(n = 0; n <= 10; n++){ for(a = 0; a <= 10; a++){ for(b = 0; b <= 10; b++) if(n == 2*a + b) printf("(%d, %d), ", (a,b)); } printf("\n"); } } But it keeps getting strange results like this: (0, -1079628000), (1, -1079628000), (2, -1079628000), (0, -1079628000), (3, -1079628000), (1, -1079628000), (4, -1079628000), (2, -1079628000), (0, -1079628000), (5, -1079628000), (3, -1079628000), (1, -1079628000), (6, -1079628000), (4, -1079628000), (2, -1079628000), (0, -1079628000), (7, -1079628000), (5, -1079628000), (3, -1079628000), (1, -1079628000), (8, -1079628000), (6, -1079628000), (4, -1079628000), (2, -1079628000), (0, -1079628000), (9, -1079628000), (7, -1079628000), (5, -1079628000), (3, -1079628000), (1, -1079628000), (10, -1079628000), (8, -1079628000), (6, -1079628000), (4, -1079628000), (2, -1079628000), (0, -1079628000), ideone Any idea what is wrong? Also if I could do this for Python it would be even cooler. :D

    Read the article

  • Multi-Part HTTP Request through xcode

    - by devsri
    Hello Everyone, i want to upload image,video and audio files to a server. I have read this thread on the similar topic but wasn't able to understand completely the flow of the code. It would be great if you can suggest me some sample code or tutorial to start with. I am using the following code to connect without any media to the server [UIApplication sharedApplication].networkActivityIndicatorVisible = YES; NSString *url =[[NSString alloc]initWithFormat:@"%@",[NetworkConstants getURL]]; NSURL *theURL =[NSURL URLWithString:url]; [url release]; NSMutableURLRequest *theRequest =[NSMutableURLRequest requestWithURL:theURL cachePolicy:NSURLRequestReloadIgnoringCacheData timeoutInterval:0.0f]; [theRequest setHTTPMethod:@"POST"]; NSString *theBodyString = [NSString stringWithFormat:@"json1=%@&userID=%@",jsonObject,[GlobalConstants getUID]]; NSData *theBodyData = [theBodyString dataUsingEncoding:NSUTF8StringEncoding]; [theRequest setHTTPBody:theBodyData]; NSURLConnection *conn = [[NSURLConnection alloc] initWithRequest:theRequest delegate:self]; if (conn) { NSLog(@"Successful in sending sync"); } else { NSLog(@"Failed Connection in sending sync"); } [conn release]; It would be really convenient for me if anything could be done editing this part of code. Any form of help would be highly appreciated. Thanks in advance!!

    Read the article

  • Radio buttons being reset in FF on cache-refresh

    - by Andrew Song
    (This is technically an addendum to an earlier StackOverflow question I had posted, but my original post asked a different question which doesn't really cover this topic -- I don't want to edit my older question as I feel this is different enough to merit its own page) While browsing my website in Firefox 3.5 (and only FF3.5), I come across a page with two radio buttons that have the following HTML code: <input id="check1" type="radio" value="True" name="check" checked="checked"/> <input id="check2" type="radio" value="False" name="check"/> This page renders as expected, with 'check1' checked and 'check2' unchecked. When I then go to refresh the page by pressing Control + R, the two radio buttons render, but they are both unchecked even though the raw HTML code is the same (as above). If I do a cache-miss refresh (via Control + F5 or Control + Shift + R), the page returns back to the way you'd expect it. This is not a problem in any other browser I've tried except FF3.5. What is causing these radio buttons to be reset on a normal refresh? How can I avoid this?

    Read the article

  • ASP.NET MVC Viewmodel trouble...

    - by ile
    I've already started similar topic, but still didn't find final solution... So here I am with new one :) ... I'm developing NerdDinner from scratch and now I came to point where I define DinnerViewModel. Following these instructions (starting from Listing 5) I came to this: namespace Nerd.Controllers { // View Model Classes public class DinnerViewModel { public DinnerViewModel(List<Dinner> dinners) { this.Dinners = dinners; } public List<Dinner> Dinners { get; private set; } } public class DinnerController : Controller { private DinnerRepository dinnerRepository = new DinnerRepository(); .... public ActionResult NewDinners() { // Create list of products var dinners = new List<Dinner>(); dinners.Add(new Dinner(/*Something to add*/)); // Return view return View(new DinnerViewModel(dinners)); } } } Also, the Dinner table in this new version of NerdDinner is a bit shortened (it contains of DinnerID, Title, EventDate and Description fields). No matter what I try to add here dinners.Add(new Dinner(/*Something to add*/)); I always get following error Error 1 'Nerd.Model.Dinner' does not contain a constructor that takes '1' arguments C:\Documents and Settings\ilija\My Documents\Visual Studio 2008\Projects\Nerd\Nerd\Controllers\DinnerController.cs 150 25 Nerd Because I'm total beginner in C# and generally OOP, I have no idea what to do here... I suppose I need to declare a constructor, but how and where exactly? Thanks, Ile

    Read the article

  • [OT a bit] Flex+JEE what is it good for?

    - by Zenzen
    Ok so sorry for being, I guess, a bit off topic but still I think this is the best place to ask. My new semester just started (don't worry I won't ask you to do my homework) and this time we have a rather cool subject about www programming in general where we have to do a web service, web abb - whatever as long as it's "web". Here's the problem though, my team and I want to do it with Flex and JEE but we don't have much experience about what are they actually used for. I mean we know you can do virtually anything with it, but we don't really want to lose time on doing something useless. My first idea was to do a "brainstorming" 3D room/service - a place where people could log in have a video conference, a whiteboard, a place to upload pictures everyone could see, some toolbars for google, youtube etc. plus some other features which would make real-time brainstorming easy when you can't get everyone in one place. But is Flex+JEE really suitable? I mean I'm 99% sure it's doable but is it really worth doing it in Flex+JEE or was the whole purpose of JEE completely different? @EDIT: well this was only one of our ideas obviously. I do know the basics of JSP, Servlets, JPA etc. of course but yeah the main goal of this project is to get some actual experience. The problem is we don't really know is it worth doing something like let's say a social network (something like extended facebook) for gamers (doesn't really matter if it already exists) in JEE or would it only look ridiculous (because PHP or whatever would be a far better choice)? Bottom line is that we are wondering are only large scale applications (for banks etc.) written in JEE or is it good for anything (even the smaller projects)?

    Read the article

  • Why doesn't java.lang.Number implement Comparable?

    - by Julien Chastang
    Does anyone know why java.lang.Number does not implement Comparable? This means that you cannot sort Numbers with Collections.sort which seems to me a little strange. Post discussion update: Thanks for all the helpful responses. I ended up doing some more research about this topic. The simplest explanation for why java.lang.Number does not implement Comparable is rooted in mutability concerns. For a bit of review, java.lang.Number is the abstract super-type of AtomicInteger, AtomicLong, BigDecimal, BigInteger, Byte, Double, Float, Integer, Long and Short. On that list, AtomicInteger and AtomicLong to do not implement Comparable. Digging around, I discovered that it is not a good practice to implement Comparable on mutable types because the objects can change during or after comparison rendering the result of the comparison useless. Both AtomicLong and AtomicInteger are mutable. The API designers had the forethought to not have Number implement Comparable because it would have constrained implementation of future subtypes. Indeed, AtomicLong and AtomicInteger were added in Java 1.5 long after java.lang.Number was initially implemented. Apart from mutability, there are probably other considerations here too. A compareTo implementation in Number would have to promote all numeric values to BigDecimal because it is capable of accommodating all the Number sub-types. The implication of that promotion in terms of mathematics and performance is a bit unclear to me, but my intuition finds that solution kludgy.

    Read the article

  • Should a developer be a coauthor to a paper presented about the application they developed?

    - by ved
    In our organization, project teams come up with a need and funding and developers are given a basic scope and are allowed to develop the solution. There is a certain degree of implementation freedom given to the developers. They drive the solution to pilot and live deployment from its inception. If the solution is presented in a conference as a technical paper/white paper what is the protocol for the list of authors: because for the most part I see the project manager's and the dev team manager's names as authors but no mention of the actual developer. Is this correct? A lot of us developers feel pretty bummed to never see our names as the coauthors. Appreciate any pointers. Answers to the FOLLOW UP questions (1) in what field of study is the paper, and what are the standards of authorship for that field? The paper is for Flood Plain Management - there is nothing on the abstract guidelines, I have called the contact person listed for comment - waiting to hear. 2) was the paper literally about the software application as your question implies, or were the software issues incidental to the topic of the paper? The paper specifically deals with a GIS Application that is used in Coastal Engineering, yes the software is not incidental, but the meat of the paper and mentioned in the Title. 2

    Read the article

  • App crashes frequently at time when UIActionSheet would be presented

    - by Jim Hankins
    I am getting the following error intermittently when a call is made to display an action sheet. Assertion failure in -[UIActionSheet showInView:] Terminating app due to uncaught exception 'NSInternalInconsistencyException', reason: 'Invalid parameter not satisfying: view != nil' Now in this case I've not changed screens. The UIActionSheet is presented when a local notification is fired and I have an observer call a local method on this view as such: I have the property marked as strong. When the action sheet is dismissed I also set it to nil. I am using a story board for the UI. It's fairly repeatable to crash it, perhaps less than 5 tries. (Thankfully I have that going for me). Any suggestions what to try next? I'm really pulling my hair out on this one. Most of the issues I've seen on this topic are pointing to the crash occurring once the selection is made. In my case it's at presentation and intermittently. Also for what it's worth, this particular view is several stacks deep in an embedded navigation controller. Hometableviewdetail selectviewController in question. This same issue occurs so far in testing on iOS 5.1 and iOS 6. I'm presuming it's something to do with how the show InView is being targeted. self.actionSheet = [[UIActionSheet alloc] initWithTitle:@"Select Choice" delegate:self cancelButtonTitle:@"Not Yet" destructiveButtonTitle:@"Do this Now" otherButtonTitles:nil]; [self.actionSheet showInView:self.parentViewController.tabBarController.view];

    Read the article

  • What is the procedure for debugging a production-only error?

    - by Lord Torgamus
    Let me say upfront that I'm so ignorant on this topic that I don't even know whether this question has objective answers or not. If it ends up being "not," I'll delete or vote to close the post. Here's the scenario: I just wrote a little web service. It works on my machine. It works on my team lead's machine. It works, as far as I can tell, on every machine except for the production server. The exception that the production server spits out upon failure originates from a third-party JAR file, and is skimpy on information. I search the web for hours, but don't come up with anything useful. So what's the procedure for tracking down an issue that occurs only on production machines? Is there a standard methodology, or perhaps category/family of tools, for this? The error that inspired this question has already been fixed, but that was due more to good fortune than a solid approach to debugging. I'm asking this question for future reference. Some related questions: Test accounts and products in a production system Running test on Production Code/Server

    Read the article

  • SQL Structure of DB table with different types of columns

    - by Dmitry Dvornikov
    I have a problem with the optimization of the structure of the database. I'll try to explain it exactly. I create a project, where we can add different values??, but this values must have different types of the columns in the database (eg, int, double , varchar). What is the best way to store the different types of values ??in the database. In the project I'm using Propel 1.6. The point is availability to add value with 'int', 'varchar' and other columns types, to search the table was efficient. In total, I have two ideas. The first is to create a table of "value", which will have columns: "id ", "value_int", "value_double", "value_varchar", etc - with the corresponding column types. Depending on the type of values??, records will be saved with the value in the appropriate column (the rest will be NULL). The second solution is to create separate tables such as "value_int", "value_varchar" etc. There would be columns: "id", "value", which correspond to the relevant types of "value" (ie, such as int, varchar, etc). I must admit that I do not believe any of the above solutions, originally I was thinking about one table "value", where the column would be a "text" type - but this solution would probably be even worse. I would like to know your opinion on this topic, maybe something else would be better. Thanks in advance. EDIT: For example : We have three tables: USER: [table of users] * id * name FIELD: [table of profile fields - where the column 'type' is the type of field, eg int or varchar) * id * type * name VALUE : * id * User_id - ( FK user.id ) * Field_id - ( FK field.id ) * value So we have in each row an user in USER table, and the profile is stored in the VALUE table. Bit each profile field may have a different type (column 'type' in the FIELD table), and based on that I would want this value to add to the appropriate column of the appropriate type.

    Read the article

  • No GPS Update retrieved? Problem in Code?

    - by poeschlorn
    Hello mates, I've got a serious problem with my GPS on my Nexus One: I wrote a kind of hello world with GPS, but the Toast that should be displayed isn't :( I don't know what I'm doing wrong...maybe you could help me getting this work. Here's my code: package gps.test; import android.app.Activity; import android.content.Context; import android.location.Location; import android.location.LocationListener; import android.location.LocationManager; import android.os.Bundle; import android.widget.Toast; public class GPS extends Activity { private LocationManager lm; private LocationListener locationListener; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); // ---use the LocationManager class to obtain GPS locations--- lm = (LocationManager) getSystemService(Context.LOCATION_SERVICE); locationListener = new MyLocationListener(); lm.requestLocationUpdates(LocationManager.GPS_PROVIDER, 100, 1, locationListener); } private class MyLocationListener implements LocationListener { @Override public void onLocationChanged(Location loc) { if (loc != null) { Toast.makeText( getBaseContext(), "Location changed : Lat: " + loc.getLatitude() + " Lng: " + loc.getLongitude(), Toast.LENGTH_SHORT).show(); } } @Override public void onProviderDisabled(String provider) { // TODO Auto-generated method stub } @Override public void onProviderEnabled(String provider) { // TODO Auto-generated method stub } @Override public void onStatusChanged(String provider, int status, Bundle extras) { // TODO Auto-generated method stub } } } Theoretically there should be a new toast every 100 milliseconds, shouldn't it? Or at least, when I change my position by one meter!? I've no idea why it doesn't. I must admit I'm new to the topic, maybe I've missed something? It would be great if you could give me a hint :) nice greetings, poeschlorn

    Read the article

  • WCF data services (OData), query with inheritance limitation?

    - by Mathieu Hétu
    Project: WCF Data service using internally EF4 CTP5 Code-First approach. I configured entities with inheritance (TPH). See previous question on this topic: Previous question about multiple entities- same table The mapping works well, and unit test over EF4 confirms that queries runs smoothly. My entities looks like this: ContactBase (abstract) Customer (inherits from ContactBase), this entity has also several Navigation properties toward other entities Resource (inherits from ContactBase) I have configured a discriminator, so both Customer and Resource map to the same table. Again, everythings works fine on the Ef4 point of view (unit tests all greens!) However, when exposing this DBContext over WCF Data services, I get: - CustomerBases sets exposed (Customers and Resources sets seems hidden, is it by design?) - When I query over Odata on Customers, I get this error: Navigation Properties are not supported on derived entity types. Entity Set 'ContactBases' has a instance of type 'CodeFirstNamespace.Customer', which is an derived entity type and has navigation properties. Please remove all the navigation properties from type 'CodeFirstNamespace.Customer'. Stacktrace: at System.Data.Services.Serializers.SyndicationSerializer.WriteObjectProperties(IExpandedResult expanded, Object customObject, ResourceType resourceType, Uri absoluteUri, String relativeUri, SyndicationItem item, DictionaryContent content, EpmSourcePathSegment currentSourceRoot) at System.Data.Services.Serializers.SyndicationSerializer.WriteEntryElement(IExpandedResult expanded, Object element, ResourceType expectedType, Uri absoluteUri, String relativeUri, SyndicationItem target) at System.Data.Services.Serializers.SyndicationSerializer.<DeferredFeedItems>d__b.MoveNext() at System.ServiceModel.Syndication.Atom10FeedFormatter.WriteItems(XmlWriter writer, IEnumerable`1 items, Uri feedBaseUri) at System.ServiceModel.Syndication.Atom10FeedFormatter.WriteFeedTo(XmlWriter writer, SyndicationFeed feed, Boolean isSourceFeed) at System.ServiceModel.Syndication.Atom10FeedFormatter.WriteFeed(XmlWriter writer) at System.ServiceModel.Syndication.Atom10FeedFormatter.WriteTo(XmlWriter writer) at System.Data.Services.Serializers.SyndicationSerializer.WriteTopLevelElements(IExpandedResult expanded, IEnumerator elements, Boolean hasMoved) at System.Data.Services.Serializers.Serializer.WriteRequest(IEnumerator queryResults, Boolean hasMoved) at System.Data.Services.ResponseBodyWriter.Write(Stream stream) Seems like a limitation of WCF Data services... is it? Not much documentation can be found on the web about WCF Data services (OData) and inheritance specifications. How can I overpass this exception? I need these navigation properties on derived entities, and inheritance seems the only way to provide mapping of 2 entites on the same table with Ef4 CTP5... Any thoughts?

    Read the article

  • Static Vs Non-Static Method Performance C#

    - by dotnetguts
    Hello All, I have few global methods declared in public class in my asp.net web application. I have habbit of declaring all global methods in public class in following format public static string MethodName(parameters) { } I want to know how it would impact on performance point of view? 1) Which one is Better? Static Method or Non-Static Method? 2) Reason why it is better? Following link shows Non-Static methods are good because, static methods are using locks to be Thread-safe. The always do internally a Monitor.Enter() and Monitor.exit() to ensure Thread-safety. http://bytes.com/topic/c-sharp/answers/231701-static-vs-non-static-function-performance And Following link shows Static Methods are good static methods are normally faster to invoke on the call stack than instance methods. There are several reasons for this in the C# programming language. Instance methods actually use the 'this' instance pointer as the first parameter, so an instance method will always have that overhead. Instance methods are also implemented with the callvirt instruction in the intermediate language, which imposes a slight overhead. Please note that changing your methods to static methods is unlikely to help much on ambitious performance goals, but it can help a tiny bit and possibly lead to further reductions. http://dotnetperls.com/static-method I am little confuse which one to use? Thanks

    Read the article

  • JQuery: how to store records id for data from ajax query in dynamicly created html elements

    - by grapkulec
    Probably question title is rather cryptic but I will try to explain myself here so please bare with me :) Let's assume this configuration: server-side is PHP application responding for requests with data (list of items, single item details, etc.) in json format client-side is JQuery application sending ajax request to that PHP app and creating html content corresponding with received data So, for example: client requests "list of all animals with names staring with 'A'", gets the json response from server, and for every "animal" creates some html gizmo like div with animal description or something like that. It doesn't really matter what html element it will be but it has to point exactly to specific record by "containing" id of that record. And here is my dilemma: is it good solution to use "id" property for that? So it would be like: <div id="10" class="animal"> <p> This is animal of very mysterious kind... </p> </div> <div id="11" class="animal"> <p> And this one is very common to our country... </p> </div> where id="10" is of course indication that this is representation of record with id = 10. Or maybe I should store this record id in some custom made tag like <record_id>10</record_id> and leave an "id" strictly for what it was meant to be (css selector)? I need that record id for further stuff like updating database with some user input or deleting some of "animals" or creating new ones or anything that will be needed. All manipulations will be done with JQuery and ajax requests and responses will be visualized also with dynamic creation of html interface. I'm sure that somebody had to deal with that kind of stuff before so I would be grateful for some tips on that topic.

    Read the article

  • How does one gets started with Winforms style applications on Win32?

    - by Billy ONeal
    EDIT: I'm extremely tired and frustrated at the moment -- please ignore that bit in this question -- I'll edit it in the morning to be better. Okay -- a bit of background: I'm a C++ programmer mostly, but the only GUI stuff I've ever done was on top of .NET's WinForms platform. I'm completely new to Windows GUI programming, and despite Petzold's excellent book, I'm extremely confused. Namely, it seems that most every reference on getting started with Win32 is all about drawing lines and curves and things -- a topic about which (at least at present time) I couldn't care less. I need a checked list box, a splitter, and a textbox -- something that would take less than 10 minutes to do in Winforms land. It has been recommended to me to use the WTL library, which provides an implementation of all three of these controls -- but I keep getting hung up on simple things, such as getting the damn controls to use the right font, and getting High DPI working correctly. I've spent two freaking days on this, and I can't help but think there has to be a better reference for these kinds of things than I've been able to find. Petzold's book is good, but it hasn't been updated since Windows 95 days, and there's been a LOT changed w.r.t. how applications should be correctly developed since it was published. I guess what I'm looking for is a modern Petzold book. Where can I find such a resource, if any?

    Read the article

< Previous Page | 317 318 319 320 321 322 323 324 325 326 327 328  | Next Page >