Search Results

Search found 10033 results on 402 pages for 'topic template'.

Page 320/402 | < Previous Page | 316 317 318 319 320 321 322 323 324 325 326 327  | Next Page >

  • How much detail should be in a project plan or spec?

    - by DeanMc
    I have an issue that I feel many programmers can relate to... I have worked on many small scale projects. After my initial paper brain storm I tend to start coding. What I come up with is usually a rough working model of the actual application. I design in a disconnected fashion so I am talking about underlying code libraries, user interfaces are the last thing as the library usually dictates what is needed in the UI. As my projects get bigger I worry that so should my "spec" or design document. The above paragraph, from my investigations, is echoed all across the internet in one fashion or another. When a UI is concerned there is a bit more information but it is UI specific and does not relate to code libraries. What I am beginning to realise is that maybe code is code is code. It seems from my extensive research that there is no 1:1 mapping between a design document and the code. When I need to research a topic I dump information into OneNote and from there I prioritise features into versions and then into related chunks so that development runs in a fairly linear fashion, my tasks tend to look like so: Implement Binary File Reader Implement Binary File Writer Create Object to encapsulate Data for expression to the caller Now any programmer worth his salt is aware that between those three to do items could be a potential wall of code that could expand out to multiple files. I have tried to map the complete code process for each task but I simply don't think it can be done effectively. By the time one mangles pseudo code it is essentially code anyway so the time investment is negated. So my question is this: Am I right in assuming that the best documentation is the code itself. We are all in agreement that a high level overview is needed. How high should this be? Do you design to statement, class or concept level? What works for you?

    Read the article

  • ASP.NET ListView, custom DataSources, and editing items

    - by Andrew Shepherd
    The MSDN walkthroughs provide a number of examples where you can drag a DataSource from the toolbox, run through some simple configuration steps, then drag a ListView onto the screen, point it at the DataSource, and hey - you've got full table editing. Now I'm trying to write my own DataSource class (a class that implements System.Web.UI.IDataSource) and my own DataSourceView class. I now assign an instance of this custom DataSource class to the ListView.DataSource propery. The display of all the items is working well. However, updating, inserting and deleting just is not working. I'm overriding every function I can in my DataSourceView class, and they just aren't being called. This is such a huge topic, I'll focus this question on one simple example: When you press the "Edit" button (the button inside the ItemTemplate with a CommandName of "Edit", you expect the ItemTemplate to be replaced by an EditItemTemplate. This did not happen. The only way I could get it to happen was to handle the onitemediting event. protected void _listViewPublicHolidays_ItemEditing(object sender, ListViewEditEventArgs e) { _listViewPublicHolidays.EditIndex = e.NewEditIndex; _listViewPublicHolidays.DataBind(); } This is hardly a problem, but how come I had to do it at all? In the MSDN walkthroughs where I attach a ListView to a LinqDataSource, this code doesn't have to be written. Can someone who's been here before hazard a guess as to what would be different or missing in my custom datasource?

    Read the article

  • c# delegate and abstract class

    - by BeraCim
    Hi all: I currently have 2 concrete methods in 2 abstract classes. One class contains the current method, while the other contains the legacy method. E.g. // Class #1 public abstract class ClassCurrent<T> : BaseClass<T> where T : BaseNode, new() { public List<T> GetAllRootNodes(int i) { //some code } } // Class #2 public abstract class MyClassLegacy<T> : BaseClass<T> where T : BaseNode, new() { public List<T> GetAllLeafNodes(int j) { //some code } } I want the corresponding method to run in their relative scenarios in the app. I'm planning to write a delegate to handle this. The idea is that I can just call the delegate and write logic in it to handle which method to call depending on which class/project it is called from (at least thats what I think delegates are for and how they are used). However, I have some questions on that topic (after some googling): 1) Is it possible to have a delegate that knows the 2 (or more) methods that reside in different classes? 2) Is it possible to make a delegate that spawns off abstract classes (like from the above code)? (My guess is a no, since delegates create concrete implementation of the passed-in classes) 3) I tried to write a delegate for the above code. But I'm being technically challenged: public delegate List GetAllNodesDelegate(int k); GetAllNodesDelegate del = new GetAllNodesDelegate(ClassCurrent.GetAllRootNodes); I got the following error: An object reference is required for the non-static field, method, property ClassCurrent<BaseNode>.GetAllRootNodes(int) I might have misunderstood something... but if I have to manually declare a delegate at the calling class, AND to pass in the function manually as above, then I'm starting to question whether delegate is a good way to handle my problem. Thanks.

    Read the article

  • Where is the Open Source alternative to WPF?

    - by Evan Plaice
    If we've learned anything from HTML/CSS it's that, declarative languages (like XML) work best to describe User Interfaces because: It's easy to build code preprocessors that can template the code effectively. The code is in a well defined well structured (ideally) format so it's easy to parse. The technology to effectively parse or crawl an XML based source file already exists. The UIs scripted code becomes much simpler and easier to understand. It simple enough that designers are able to design the interface themselves. Programmers suck at creating UIs so it should be made easy enough for designers. I recently took a look at the meat of a WPF application (ie. the XAML) and it looks surprisingly familiar to the declarative language style used in HTML. It's blindingly apparent to me that the current state of desktop UI development is largely fractionalized, otherwise there wouldn't be so much duplicated effort in the domain of user interfaces (IE. GTK, XUL, Qt, Winforms, WPF, etc). There are 45 GUI platforms for Python alone It's painfully obvious to me that there should be a general purpose, open source, standardized, platform independent, markup language for designing desktop GUIs. Much like what the W3C made HTML/CSS into. WPF, or more specifically XAML seems like a pretty likely step in the right direction. Why hasn't anyone in the Open Source community (AFAIK) even scratched the surface of this issue. Now that the 'browser wars' are over should we look forward to a future of 'desktop gui wars?' Note: This topic is relatively subjective in the attempt to be 'future-thinking.' I think that desktop GUI development in its current state sucks ((really)hard) and, even though WPF is still in it's infancy, it presents a likely solution to the problem. Has no one in the OS community looked into developing something similar because they don't see the value, or because it's not worth the effort?

    Read the article

  • PHP Object References in Frameworks

    - by bigstylee
    Before I dive into the disscusion part a quick question; Is there a method to determine if a variable is a reference to another variable/object? For example $foo = 'Hello World'; $bar = &$foo; echo (is_reference($bar) ? 'Is reference' : 'Is orginal'; I have been using PHP5 for a few years now (personal use only) and I would say I am moderately reversed on the topic of Object Orientated implementation. However the concept of Model View Controller Framework is fairly new to me. I have looked a number of tutorials and looked at some of the open source frameworks (mainly CodeIgnitor) to get a better understanding how everything fits together. I am starting to appreciate the real benefits of using this type of structure. I am used to implementing object referencing in the following technique. class Foo{ public $var = 'Hello World!'; } class Bar{ public function __construct(){ global $Foo; echo $Foo->var; } } $Foo = new Foo; $Bar = new Bar; I was surprised to see that CodeIgnitor and Yii pass referencs of objects and can be accessed via the following method: $this->load->view('argument') The immediate advantage I can see is a lot less code and more user friendly. But I do wonder if it is more efficient as these frameworks are presumably optimised? Or simply to make the code more user friendly? This was an interesting article Do not use PHP references.

    Read the article

  • So many technologies to choose from. Where does the beginner start?

    - by Sahat
    WPF Silverlight Windows phone 7 w/ Silverlight iPhone OS w/ Objective-C Cocoa w/ Objective-C ASP.NET Android Facebook FBML HTML5 I will be graduating with B.S. in Computer Science soon and have to decide what do I want to learn from this list. I believe it's better to focus on one thing, master it and build up a portfolio to enhance my resume. Bachelor's Degree with no experience, no portfolio won't do me any good. It won't get me a job by itself. I need to have something that will greatly boost my resume. What would it be? iPhone development? ASP.NET web development? Facebook development? Or completely something else that I haven't listed? I understand it's natural for silverlight developers to say "Learn Silverlight", and iPhone developers say "Learn iPhone SDK and Objective-C". So please try to give a constructive, non-biased, non-objective opinion on which technology should I focus on. Please don't close the topic for "subjective/argumentative" reasons. I am just looking for some guidance.

    Read the article

  • Android AES and init vector

    - by Donald_W
    I have an issue with AES encryptio and decryption: I can change my IV entirely and still I'm able to decode my data. public static final byte[] IV = { 65, 1, 2, 23, 4, 5, 6, 7, 32, 21, 10, 11, 12, 13, 84, 45 }; public static final byte[] IV2 = { 65, 1, 2, 23, 45, 54, 61, 81, 32, 21, 10, 121, 12, 13, 84, 45 }; public static final byte[] KEY = { 0, 42, 2, 54, 4, 45, 6, 7, 65, 9, 54, 11, 12, 13, 60, 15 }; public static final byte[] KEY2 = { 0, 42, 2, 54, 43, 45, 16, 17, 65, 9, 54, 11, 12, 13, 60, 15 }; //public static final int BITS = 256; public static void test() { try { // encryption Cipher c = Cipher.getInstance("AES"); SecretKeySpec keySpec = new SecretKeySpec(KEY, "AES"); c.init(Cipher.ENCRYPT_MODE, keySpec, new IvParameterSpec(IV)); String s = "Secret message"; byte[] data = s.getBytes(); byte[] encrypted = c.doFinal(data); String encryptedStr = ""; for (int i = 0; i < encrypted.length; i++) encryptedStr += (char) encrypted[i]; //decryoption Cipher d_c = Cipher.getInstance("AES"); SecretKeySpec d_keySpec = new SecretKeySpec(KEY, "AES"); d_c.init(Cipher.DECRYPT_MODE, d_keySpec, new IvParameterSpec(IV2)); byte[] decrypted = d_c.doFinal(encrypted); String decryptedStr = ""; for (int i = 0; i < decrypted.length; i++) decryptedStr += (char) decrypted[i]; Log.d("", decryptedStr); } catch (Exception ex) { Log.d("", ex.getMessage()); } } Any ideas what I'm doing wrong? How can I get 256 bit AES encryption (only change key to 32-byte long array?) Encryption is a new topic for me so please for newbie friendly answers.

    Read the article

  • Should a Trim method generally in the Data Access Layer or with in the Domain Layer?

    - by jpierson
    I'm dealing with a database that contains data with inconsistencies such as white leading and trailing white space. In general I see a lot of developers practice defensive coding by trimming almost all strings that come from the database that may have been entered by a user at some point. In my oppinoin it is better to do such formating before data is persisted so that it is done only once and then the data can be in a consistent and reliable state. Unfortunatley this is not the case however which leads me to the next best solution, using a Trim method. If I trim all data as part of my data access layer then I don't have to concern myself with defensive trimming within the business objects of my domain layer. If I instead put the trimming responsibility in my business objects, such as with set accessors of my C# properties, I should get the same net results however the trim will be operating on all values assigned to my business objects properties not just the ones that come from the inconsistent database. I guess as a somewhat philisophical question that may determine the answer I could ask "Should the domain later be responsible for defensive/coercive formatting of data?" Would it make sense to have a set accessor for a PhoneNumber property on a business object accept a unformatted or formatted string and then attempt to format it as required or should this responsibility be pushed to the presentation and data access layers leaving the domain layer more strict in the type of data that it will accept? I think this may be the more fundamental question. Update: Below are a few links that I thought I should share about the topic of data cleansing. Information service patterns, Part 3: Data cleansing pattern LINQ to SQL - Format a string before saving? How to trim values using Linq to Sql?

    Read the article

  • Automated Legal Processing

    - by Chris S
    Will it ever be possible to make legal systems quantifiable enough to process with computer algorithms? What technologies would have to be in place before this is possible? Are there any existing technologies that are already trying to accomplish this? Out of curiosity, I downloaded the text for laws in my local municipality, and tried applying some simple NLP tricks to extract rules from sentences. I had mixed results. Some sentences were very explicit (e.g. "Cars may not be left in the park overnight"), but other sentences seemed hopelessly vague (e.g. "The council's purpose is to ensure the well-being of the community"). I apologize if this is too open-ended a topic, but I've often wondered what society would look like if legal systems were based on less ambiguous language. Lawyers, and the legal process in general, are so expensive because they have to manually process a complex set of rules codified in ambiguous legal texts. If this system could be represented in software, this huge expense could potentially be eliminated, making the legal system more accessible for everyone.

    Read the article

  • Advice on using .Net WorkFlow State Machine. What would you do?

    - by jlafay
    So I've been tasked at work to write windows services to replace some old legacy VB6 WinForms apps currently running as services, consistently repeating tasks day-to-day. To give some general background, they have there own state machines built in to handle decision basing and not utilizing threading. A lot of the senior developers here thought it would be worth a try to look into WorkFlow to replace the state machines rather than write my own business logic and try threading it programmaticly. So it's WF vs. the "Old College Try" I suppose. My concern is that there aren't many books on the topic, and since it was implemented in .Net I've heard very little about it being used. I brought this up at work and another developer mentioned that it's because Biz Talk never really caught on and it was designed for that. So is it broken? Do you think it will be supported long enough to not worry so much? I don't want an ill-functioning process injected into my services, my new babies at work, and then have WF's keel over. Leaving me with having to replace them with my own code in the event of an emergency; which does not seem like much of a grand scenario to me. Any suggestions, recommendations would be super.

    Read the article

  • Can I specify default value?

    - by atch
    Why is it that for user defined types when creating an array of objects every element of this array is initialized with default ctor but when I create built-in type this isn't the case? And second question: is it possible to specify default value to be used while initialize? Something like this (not valid): char* p = new char[size]('\0'); And another question in this topic while I'm with arrays. I suppose that when creating an array of user defined type and knowing the fact that every elem. of this array will be initialized with default value firstly why? If arrays for built in types do not initialize their elems. with their dflts why do they do it for UDT, and secondly: is there a way to switch it off/avoid/circumvent somehow? It seems like bit of a waste if I for example have created an array with size 10000 and then 10000 times dflt ctor will be invoked and I will (later on) overwrite this values anyway. I think that behaviour should be consistent, so either every type of array should be initialized or none. And I think that the behaviour for built-in arrays is more appropriate.

    Read the article

  • Audio output from Silverlight

    - by leecarter
    I'm looking to develop a Silverlight application which will take a stream of data (not an audio stream as such) from a web server. The data stream would then be manipulated to give audio of a certain format (G.711 a-Law for example) which would then be converted into PCM so that additional effects can be applied (such as boosting the volume). I'm OK up to this point. I've got my data, converted the G.711 into PCM but my problem is being able to output this PCM audio to the sound card. I basing a solution on some C# code intended for a .Net application but in Silverlight there is a problem with trying to take a copy of a delegate (function pointer) which will be the topic of a separate question once I've produced a simple code sample. So, the question is... How can I output the PCM audio that I have held in a data structure (currently an array) in my Silverlight to the user? (Please don't say write the byte values to a text box) If it were a MP3 or WMA file I would play it using a MediaElement but I don't want to have to make it into a file as this would put a crimp on applying dynamic effects to the audio. I've seen a few posts from people saying low level audio support is poor/non-existant in Silverlight so I'm open to any suggestions/ideas people may have.

    Read the article

  • Reporting Services - can't group by a column called "LanguageId"

    - by marc_s
    Folks, I have a really odd behavior here: I have a SQL Server 2008 Reporting Services report which gets grouped and sorted dynamically. One of the column in my data set which I display is called LanguageId and I was trying to get a grouping going by this LanguageId field. I checked, double-checked and triple-checked the data being returned - it does contain my expected values for LanguageId and everything seems fine and dandy. It just never worked - I didn't get the expected groups, I got things like a specific node actually changing its display value from one ID to another when expanding its subitems, and other really whacky stuff. I discovered that grouping and sorting by LanguageCaption works just fine. It also started working fine after I renamed LanguageId to MyLanguageId. So where on earth is this documented that LanguageId appears to be a system variable / reserved word / keyword of some sort in SQL Server Reporting Services that must be avoided at all costs?? I can't seem to find anything on that topic - even Mr. Google and Mrs. Bing came up empty so far....

    Read the article

  • Removing HttpModule for specific path in ASP.NET / IIS 7 application?

    - by soccerdad
    Most succinctly, my question is whether an ASP.NET 4.0 app running under IIS 7 integrated mode should be able to honor this portion of my Web.config file: <location path="auth/windows"> <system.webServer> <modules> <remove name="FormsAuthentication"/> </modules> </system.webServer> </location> I'm experimenting with mixed mode authentication (Windows and Forms - I know there are other questions on S.O. about the topic). Using IIS Manager, I've disabled Anonymous authentication to auth/windows/winauth.aspx, which is within the location path above. I have Failed Request Tracing set up to trace various HTTP status codes, including 302s. When I request the winauth.aspx page, a 302 HTTP status code is returned. If I look at the request trace, I can see that a 401 (unauthorized) was originally generated by the AnonymousAuthenticationModule. However, the FormsAuthenticationModule converts that to a 302, which is what the browser sees. So it seems as though my attempt to remove that module from the pipeline for pages in that path isn't working. But I'm not seeing any complaints anywhere (event viewer, yellow pages of death, etc.) that would indicate it's an invalid configuration. I want the 401 returned to the browser, which presumably would include an appropriate WWW-Authenticate header. A couple of other points: a) I do have <authentication mode="Forms"> in my Web.config, and that is what the 302 redirects to; b) I got the "name" of the module I'm trying to remove from the inetserv\config\applicationHost.config file. Anyone had any luck removing modules in this fashion? Thanks much, Donnie

    Read the article

  • Pre-populate iPhone Safari SQLite DB

    - by Matt Rogish
    I'm working with a PhoneGap app that uses Safari local storage (SQlite DB) via Javascript: http://developer.apple.com/safari/library/documentation/iPhone/Conceptual/SafariJSDatabaseGuide/UsingtheJavascriptDatabase/UsingtheJavascriptDatabase.html On first load, the app creates the database, tables, and populates the data via a series of INSERT statements. If the user closes the app while this processing is happening, then my app database is left in an inconsistent state. What I prefer to do is deploy the SQLite DB as part of my iTunes App packaging so nothing must be populated at app cold start. However, I'm not sure if that is possible -- all of the google hits for this topic that I can find are referring to the core-data provided SQLite which is not what we're using... If it's not possible, could I wrap the entire thing in a transaction and keep re-trying it when the app is restarted? Failing that, I guess I can create a simple table with one boolean column "is_app_db_loaded?" and set it to true after I've processed all my inserts. But that's really gross... Ideas? Thanks!!

    Read the article

  • How to write a flexible modular program with good interaction possibilities between modules?

    - by PeterK
    I went through answers on similar topics here on SO but could't find a satisfying answer. Since i know this is a rather large topic, i will try to be more specific. I want to write a program which processes files. The processing is nontrivial, so the best way is to split different phases into standalone modules which then would be used as necessary (since sometimes i will be only interested in the output of module A, sometimes i would need output of five other modules, etc). The thing is, that i need the modules to cooperate, because the output of one might be the input of another. And i need it to be FAST. Moreover i want to avoid doing certain processing more than once (if module A creates some data which then need to be processed by module B and C, i don't want to run module A twice to create the input for modules B,C ). The information the modules need to share would mostly be blocks of binary data and/or offsets into the processed files. The task of the main program would be quite simple - just parse arguments, run required modules (and perhaps give some output, or should this be the task of the modules?). I don't need the modules to be loaded at runtime. It's perfectly fine to have libs with a .h file and recompile the program every time there is a new module or some module is updated. The idea of modules is here mainly because of code readability, maintaining and to be able to have more people working on different modules without the need to have some predefined interface or whatever (on the other hand, some "guidelines" on how to write the modules would be probably required, i know that). We can assume that the file processing is a read-only operation, the original file is not changed. Could someone point me in a good direction on how to do this in C++ ? Any advice is wellcome (links, tutorials, pdf books...).

    Read the article

  • Which languages and techniques can I use to improve my coding practices?

    - by Danjah
    I've been offered the opportunity upskill through study, while at work which is great. My background I am mostly self-taught, but have worked with many excellent people over the years - both self-taught and fully educated, and on many decent projects. I have mild experience in Actionscript, I'm getting better every day with my Javascript, and my CSS is angled at best practice, but needs a bit of modernising. I'm a traditional interface developer, I'm not stupid and I like a challenge. My goal I need to start seeing ways of applying better logic, optimising code, refactoring, different styles of development (agile, others?), and.. well I need to try and start thinking like.. a more solid programmer. Its hard to describe, I have good solutions and I'm efficient - but I KNOW that there's a bunch I am missing. I am already employed with a solid career, but I feel the need to fill gaps. My question/s Are there a set of guiding principles you can recommend I focus on to improve the points above? Are there particular programming languages which I might focus on to get a broader overview? Do you think I should avoid particular styles of development, or even languages, while solidifying what might end up being part 'the basics' but hopefully 'advanced programming'? -- Sorry if this appears off topic or something but I figure you're probably some of the best people to ask.

    Read the article

  • Using PHP to get the source code of a URL I must be logged in to reach

    - by Maxwell
    I am trying to write a PHP script that will get the source code of a page in my Amazon account. However, to reach that page, I must be logged in. From what I understand, I should be able to accomplish this by posting the correct request headers, and then capturing the HTML response. Is that correct? If so, I'd really appreciate it if someone could explain to me how exactly I would do this. If it's not right, I'd love to hear the correct way of doing it! I've used Firebug to get the request and response headers I need. It's just a matter of what to do with them now. I read elsewhere on this site that you can't send a request with the PHP post method, and that perhaps using cURL is the way to go. I really know nothing about cURL, so the more info the better. Also, feel free to point me to some useful tutorials on this topic. Thanks! Max

    Read the article

  • Understanding how software testing works and what to test.

    - by RHaguiuda
    Intro: I've seen lots of topics here on SO about software testing and other terms I don't understand. Problem: As a beginner developer I, unfortunately, have no idea how software testing works, not even how to test a simple function. This is a shame, but thats the truth. I also hope this question can help others beginners developers too. Question: Can you help me to understand this subject a little bit more? Maybe some questions to start would help: When I develop a function, how should I test it? For example: when working with a sum function, should I test every input value possible or just some limits? How about testing functions with strings as parameters? In a big program, do I have to test every single piece of code of it? When you guys program do you test every code written? How automated test works and how can I try one? How tools for automated testing works and what they do? I`ve heard about unit testing. Can I have a brief explanation on this? What is a testing framework? If possible please post some code with examples to clarify the ideas. Any help on this topic is very welcome! Thanks.

    Read the article

  • incremental way of counting quantiles for large set of data

    - by Gacek
    I need to count the quantiles for a large set of data. Let's assume we can get the data only through some portions (i.e. one row of a large matrix). To count the Q3 quantile one need to get all the portions of the data and store it somewhere, then sort it and count the quantile: List<double> allData = new List<double>(); foreach(var row in matrix) // this is only example. In fact the portions of data are not rows of some matrix { allData.AddRange(row); } allData.Sort(); double p = 0.75*allData.Count; int idQ3 = (int)Math.Ceiling(p) - 1; double Q3 = allData[idQ3]; Now, I would like to find a way of counting this without storing the data in some separate variable. The best solution would be to count some parameters od mid-results for first row and then adjust it step by step for next rows. Note: These datasets are really big (ca 5000 elements in each row) The Q3 can be estimated, it doesn't have to be an exact value. I call the portions of data "rows", but they can have different leghts! Usually it varies not so much (+/- few hundred samples) but it varies! This question is similar to this one: http://stackoverflow.com/questions/1058813/on-line-iterator-algorithms-for-estimating-statistical-median-mode-skewness But I need to count quantiles. ALso there are few articles in this topic, i.e.: http://web.cs.wpi.edu/~hofri/medsel.pdf http://portal.acm.org/citation.cfm?id=347195&dl But before I would try to implement these, I wanted to ask you if there are maybe any other, qucker ways of counting the 0.25/0.75 quantiles?

    Read the article

  • Java-Eclipse-Spring 3.1 - the fastest way to get familiar with this set

    - by Leron
    I, know almost all of you at some point of your life as a programmer get to the point where you know (more or less) different technologies/languages/IDEs and a times come when you want to get things together and start using them once - more efficient and second - more closely to the real life situation where in fact just knowing Java, or some experience with Eclipse doesn't mean nothing, and what makes you a programmer worth something is the ability to work with the combination of 2 or more combinations. Having this in mind here is my question - what do you think is the optimal way of getting into Java+Eclipse+Spring3.1 world. I've read, and I've read a lot. I started writing real code but almost every step is discovering the wheel again and again, wondering how to do thing you know are some what trivial, but you've missed that one article where this topic was discussed and so on. I don't mind for paying for a good tutorial like for example, after a bit of research I decided that instead of losing a lot of time getting the different parts together I'd rather pay for the videos in http://knpuniversity.com/screencast/starting-in-symfony2-tutorial and save myself a lot of time (I hope) and get as fast as possible to writing a real code instead of wondering what do what and so on. But I find it much more difficult to find such sources of info especially when you want something more specific as me and that's the reason to ask this question. I know a lot of you go through the hard way, and I won't give up if I have to do the same, but to be honest I really hope to get post with good tutorials on the subject (paid or not) because in my situation time is literally money. Thanks Leron

    Read the article

  • Reading bmp file for encrypting and decrypting txt file into it

    - by Shantanu Gupta
    I am trying to read a bmp file in C++(Turbo). But i m not able to print binary stream. I want to encode txt file into it and decrypt it. How can i do this. I read that bmp file header is of 54 byte. But how and where should i append txt file in bmp file. ? I know only Turbo C++, so it would be helpfull for me if u provide solution or suggestion related to topic for the same. int main() { ifstream fr; //reads ofstream fw; // wrrites to file char c; int random; clrscr(); char file[2][100]={"s.bmp","s.txt"}; fr.open(file[0],ios::binary);//file name, mode of open, here input mode i.e. read only if(!fr) cout<<"File can not be opened."; fw.open(file[1],ios::app);//file will be appended if(!fw) cout<<"File can not be opened"; while(!fr) cout<<fr.get(); // error should be here. but not able to find out what error is it fr.close(); fw.close(); getch(); } This code is running fine when i pass txt file in binary mode

    Read the article

  • How to link jQuery UI datepicker functionality with a select list

    - by take2
    I'm trying to connect jQuery UI's datepicker with a select list. I have found one explanation on jQuery's Forum ( forum.jquery.com/topic/jquery-ui-datepicker-with-select-lists), but I can't get it working. There are input and select list both declared: <select id="selectMonth"><option value="01">Jan</option><option value="02">Feb</option> <option value="03">Mar</option><option value="04">Apr</option>...</select> <select id="selectDay"><option value="01">1</option><option value="02">2</option> <option value="03">3</option><option value="04">4</option>...</select> <select id="selectYear"><option value="2012">2012</option><option value="2013">2013</option> <option value="2014">2014</option>...</select> <p>Date: <input type="text" id="selectedDatepicker" /></p> This is the script: $(function() { $('#selectedDatepicker').datepicker({ beforeShow: readSelected, onSelect: updateSelected, minDate: new Date(2012, 1 - 1, 1), maxDate: new Date(2014, 12 - 1, 31), showOn: 'both', buttonImageOnly: true, buttonImage: 'img/calendar.gif'}); // Prepare to show a date picker linked to three select controls function readSelected() { $('#selectedDatepicker').val($('#selectMonth').val() + '/' + $('#selectDay').val() + '/' + $('#selectYear').val()); return {}; } // Update three select controls to match a date picker selection function updateSelected(date) { $('#selectMonth').val(date.substring(0, 2)); $('#selectDay').val(date.substring(3, 5)); $('#selectYear').val(date.substring(6, 10)); } }); And here is the fiddle: http://jsfiddle.net/xKXZm/ They are not connected properly, the only "connected behaviour" is that when you click on the input button, it picks up the value of the select list. On the other hand, the select list never picks up the value of the input nor will the input pick up the value of the select list until you click on it.

    Read the article

  • How do I optimize this postfix expression tree for speed?

    - by Peter Stewart
    Thanks to the help I received in this post: I have a nice, concise recursive function to traverse a tree in postfix order: deque <char*> d; void Node::postfix() { if (left != __nullptr) { left->postfix(); } if (right != __nullptr) { right->postfix(); } d.push_front(cargo); return; }; This is an expression tree. The branch nodes are operators randomly selected from an array, and the leaf nodes are values or the variable 'x', also randomly selected from an array. char *values[10]={"1.0","2.0","3.0","4.0","5.0","6.0","7.0","8.0","9.0","x"}; char *ops[4]={"+","-","*","/"}; As this will be called billions of times during a run of the genetic algorithm of which it is a part, I'd like to optimize it for speed. I have a number of questions on this topic which I will ask in separate postings. The first is: how can I get access to each 'cargo' as it is found. That is: instead of pushing 'cargo' onto a deque, and then processing the deque to get the value, I'd like to start processing it right away. I don't yet know about parallel processing in c++, but this would ideally be done concurrently on two different processors. In python, I'd make the function a generator and access succeeding 'cargo's using .next(). But I'm using c++ to speed up the python implementation. I'm thinking that this kind of tree has been around for a long time, and somebody has probably optimized it already. Any Ideas? Thanks

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

< Previous Page | 316 317 318 319 320 321 322 323 324 325 326 327  | Next Page >