Search Results

Search found 10033 results on 402 pages for 'topic template'.

Page 320/402 | < Previous Page | 316 317 318 319 320 321 322 323 324 325 326 327  | Next Page >

  • OOP - Handling Automated Instances of a Class - PHP

    - by dscher
    This is a topic that, as a beginner to PHP and programming, sort of perplexes me. I'm building a stockmarket website and want users to add their own stocks. I can clearly see the benefit of having each stock be a class instance with all the methods of a class. What I am stumped on is the best way to give that instance a name when I instantiate it. If I have: class Stock() { ....doing stuff..... } what is the best way to give my instances of it a name. Obviously I can write: $newStock = new Stock(); $newStock.getPrice(); or whatever, but if a user adds a stock via the app, where can the name of that instance come from? I guess that there is little harm in always creating a new child with $newStock = new Stock() and then storing that to the DB which leads me to my next question! What would be the best way to retrieve 20 user stocks(for example) into instances of class Stock()? Do I need to instantiate 20 new instances of class Stock() every time the user logs in or is there something I'm missing? I hope someone answers this and more important hope a bunch of people answer this and it somehow helps someone else who is having a hard time wrapping their head around what probably leads to a really elegant solution. Thanks guys!

    Read the article

  • how to implement a really efficient bitvector sorting in python

    - by xiao
    Hello guys! Actually this is an interesting topic from programming pearls, sorting 10 digits telephone numbers in a limited memory with an efficient algorithm. You can find the whole story here What I am interested in is just how fast the implementation could be in python. I have done a naive implementation with the module bitvector. The code is as following: from BitVector import BitVector import timeit import random import time import sys def sort(input_li): return sorted(input_li) def vec_sort(input_li): bv = BitVector( size = len(input_li) ) for i in input_li: bv[i] = 1 res_li = [] for i in range(len(bv)): if bv[i]: res_li.append(i) return res_li if __name__ == "__main__": test_data = range(int(sys.argv[1])) print 'test_data size is:', sys.argv[1] random.shuffle(test_data) start = time.time() sort(test_data) elapsed = (time.time() - start) print "sort function takes " + str(elapsed) start = time.time() vec_sort(test_data) elapsed = (time.time() - start) print "sort function takes " + str(elapsed) start = time.time() vec_sort(test_data) elapsed = (time.time() - start) print "vec_sort function takes " + str(elapsed) I have tested from array size 100 to 10,000,000 in my macbook(2GHz Intel Core 2 Duo 2GB SDRAM), the result is as following: test_data size is: 1000 sort function takes 0.000274896621704 vec_sort function takes 0.00383687019348 test_data size is: 10000 sort function takes 0.00380706787109 vec_sort function takes 0.0371489524841 test_data size is: 100000 sort function takes 0.0520560741425 vec_sort function takes 0.374383926392 test_data size is: 1000000 sort function takes 0.867373943329 vec_sort function takes 3.80475401878 test_data size is: 10000000 sort function takes 12.9204008579 vec_sort function takes 38.8053860664 What disappoints me is that even when the test_data size is 100,000,000, the sort function is still faster than vec_sort. Is there any way to accelerate the vec_sort function?

    Read the article

  • Automated Legal Processing

    - by Chris S
    Will it ever be possible to make legal systems quantifiable enough to process with computer algorithms? What technologies would have to be in place before this is possible? Are there any existing technologies that are already trying to accomplish this? Out of curiosity, I downloaded the text for laws in my local municipality, and tried applying some simple NLP tricks to extract rules from sentences. I had mixed results. Some sentences were very explicit (e.g. "Cars may not be left in the park overnight"), but other sentences seemed hopelessly vague (e.g. "The council's purpose is to ensure the well-being of the community"). I apologize if this is too open-ended a topic, but I've often wondered what society would look like if legal systems were based on less ambiguous language. Lawyers, and the legal process in general, are so expensive because they have to manually process a complex set of rules codified in ambiguous legal texts. If this system could be represented in software, this huge expense could potentially be eliminated, making the legal system more accessible for everyone.

    Read the article

  • Audio output from Silverlight

    - by leecarter
    I'm looking to develop a Silverlight application which will take a stream of data (not an audio stream as such) from a web server. The data stream would then be manipulated to give audio of a certain format (G.711 a-Law for example) which would then be converted into PCM so that additional effects can be applied (such as boosting the volume). I'm OK up to this point. I've got my data, converted the G.711 into PCM but my problem is being able to output this PCM audio to the sound card. I basing a solution on some C# code intended for a .Net application but in Silverlight there is a problem with trying to take a copy of a delegate (function pointer) which will be the topic of a separate question once I've produced a simple code sample. So, the question is... How can I output the PCM audio that I have held in a data structure (currently an array) in my Silverlight to the user? (Please don't say write the byte values to a text box) If it were a MP3 or WMA file I would play it using a MediaElement but I don't want to have to make it into a file as this would put a crimp on applying dynamic effects to the audio. I've seen a few posts from people saying low level audio support is poor/non-existant in Silverlight so I'm open to any suggestions/ideas people may have.

    Read the article

  • Reporting Services - can't group by a column called "LanguageId"

    - by marc_s
    Folks, I have a really odd behavior here: I have a SQL Server 2008 Reporting Services report which gets grouped and sorted dynamically. One of the column in my data set which I display is called LanguageId and I was trying to get a grouping going by this LanguageId field. I checked, double-checked and triple-checked the data being returned - it does contain my expected values for LanguageId and everything seems fine and dandy. It just never worked - I didn't get the expected groups, I got things like a specific node actually changing its display value from one ID to another when expanding its subitems, and other really whacky stuff. I discovered that grouping and sorting by LanguageCaption works just fine. It also started working fine after I renamed LanguageId to MyLanguageId. So where on earth is this documented that LanguageId appears to be a system variable / reserved word / keyword of some sort in SQL Server Reporting Services that must be avoided at all costs?? I can't seem to find anything on that topic - even Mr. Google and Mrs. Bing came up empty so far....

    Read the article

  • So many technologies to choose from. Where does the beginner start?

    - by Sahat
    WPF Silverlight Windows phone 7 w/ Silverlight iPhone OS w/ Objective-C Cocoa w/ Objective-C ASP.NET Android Facebook FBML HTML5 I will be graduating with B.S. in Computer Science soon and have to decide what do I want to learn from this list. I believe it's better to focus on one thing, master it and build up a portfolio to enhance my resume. Bachelor's Degree with no experience, no portfolio won't do me any good. It won't get me a job by itself. I need to have something that will greatly boost my resume. What would it be? iPhone development? ASP.NET web development? Facebook development? Or completely something else that I haven't listed? I understand it's natural for silverlight developers to say "Learn Silverlight", and iPhone developers say "Learn iPhone SDK and Objective-C". So please try to give a constructive, non-biased, non-objective opinion on which technology should I focus on. Please don't close the topic for "subjective/argumentative" reasons. I am just looking for some guidance.

    Read the article

  • PHP Object References in Frameworks

    - by bigstylee
    Before I dive into the disscusion part a quick question; Is there a method to determine if a variable is a reference to another variable/object? For example $foo = 'Hello World'; $bar = &$foo; echo (is_reference($bar) ? 'Is reference' : 'Is orginal'; I have been using PHP5 for a few years now (personal use only) and I would say I am moderately reversed on the topic of Object Orientated implementation. However the concept of Model View Controller Framework is fairly new to me. I have looked a number of tutorials and looked at some of the open source frameworks (mainly CodeIgnitor) to get a better understanding how everything fits together. I am starting to appreciate the real benefits of using this type of structure. I am used to implementing object referencing in the following technique. class Foo{ public $var = 'Hello World!'; } class Bar{ public function __construct(){ global $Foo; echo $Foo->var; } } $Foo = new Foo; $Bar = new Bar; I was surprised to see that CodeIgnitor and Yii pass referencs of objects and can be accessed via the following method: $this->load->view('argument') The immediate advantage I can see is a lot less code and more user friendly. But I do wonder if it is more efficient as these frameworks are presumably optimised? Or simply to make the code more user friendly? This was an interesting article Do not use PHP references.

    Read the article

  • Should a Trim method generally in the Data Access Layer or with in the Domain Layer?

    - by jpierson
    I'm dealing with a database that contains data with inconsistencies such as white leading and trailing white space. In general I see a lot of developers practice defensive coding by trimming almost all strings that come from the database that may have been entered by a user at some point. In my oppinoin it is better to do such formating before data is persisted so that it is done only once and then the data can be in a consistent and reliable state. Unfortunatley this is not the case however which leads me to the next best solution, using a Trim method. If I trim all data as part of my data access layer then I don't have to concern myself with defensive trimming within the business objects of my domain layer. If I instead put the trimming responsibility in my business objects, such as with set accessors of my C# properties, I should get the same net results however the trim will be operating on all values assigned to my business objects properties not just the ones that come from the inconsistent database. I guess as a somewhat philisophical question that may determine the answer I could ask "Should the domain later be responsible for defensive/coercive formatting of data?" Would it make sense to have a set accessor for a PhoneNumber property on a business object accept a unformatted or formatted string and then attempt to format it as required or should this responsibility be pushed to the presentation and data access layers leaving the domain layer more strict in the type of data that it will accept? I think this may be the more fundamental question. Update: Below are a few links that I thought I should share about the topic of data cleansing. Information service patterns, Part 3: Data cleansing pattern LINQ to SQL - Format a string before saving? How to trim values using Linq to Sql?

    Read the article

  • ASP.NET ListView, custom DataSources, and editing items

    - by Andrew Shepherd
    The MSDN walkthroughs provide a number of examples where you can drag a DataSource from the toolbox, run through some simple configuration steps, then drag a ListView onto the screen, point it at the DataSource, and hey - you've got full table editing. Now I'm trying to write my own DataSource class (a class that implements System.Web.UI.IDataSource) and my own DataSourceView class. I now assign an instance of this custom DataSource class to the ListView.DataSource propery. The display of all the items is working well. However, updating, inserting and deleting just is not working. I'm overriding every function I can in my DataSourceView class, and they just aren't being called. This is such a huge topic, I'll focus this question on one simple example: When you press the "Edit" button (the button inside the ItemTemplate with a CommandName of "Edit", you expect the ItemTemplate to be replaced by an EditItemTemplate. This did not happen. The only way I could get it to happen was to handle the onitemediting event. protected void _listViewPublicHolidays_ItemEditing(object sender, ListViewEditEventArgs e) { _listViewPublicHolidays.EditIndex = e.NewEditIndex; _listViewPublicHolidays.DataBind(); } This is hardly a problem, but how come I had to do it at all? In the MSDN walkthroughs where I attach a ListView to a LinqDataSource, this code doesn't have to be written. Can someone who's been here before hazard a guess as to what would be different or missing in my custom datasource?

    Read the article

  • Where is the Open Source alternative to WPF?

    - by Evan Plaice
    If we've learned anything from HTML/CSS it's that, declarative languages (like XML) work best to describe User Interfaces because: It's easy to build code preprocessors that can template the code effectively. The code is in a well defined well structured (ideally) format so it's easy to parse. The technology to effectively parse or crawl an XML based source file already exists. The UIs scripted code becomes much simpler and easier to understand. It simple enough that designers are able to design the interface themselves. Programmers suck at creating UIs so it should be made easy enough for designers. I recently took a look at the meat of a WPF application (ie. the XAML) and it looks surprisingly familiar to the declarative language style used in HTML. It's blindingly apparent to me that the current state of desktop UI development is largely fractionalized, otherwise there wouldn't be so much duplicated effort in the domain of user interfaces (IE. GTK, XUL, Qt, Winforms, WPF, etc). There are 45 GUI platforms for Python alone It's painfully obvious to me that there should be a general purpose, open source, standardized, platform independent, markup language for designing desktop GUIs. Much like what the W3C made HTML/CSS into. WPF, or more specifically XAML seems like a pretty likely step in the right direction. Why hasn't anyone in the Open Source community (AFAIK) even scratched the surface of this issue. Now that the 'browser wars' are over should we look forward to a future of 'desktop gui wars?' Note: This topic is relatively subjective in the attempt to be 'future-thinking.' I think that desktop GUI development in its current state sucks ((really)hard) and, even though WPF is still in it's infancy, it presents a likely solution to the problem. Has no one in the OS community looked into developing something similar because they don't see the value, or because it's not worth the effort?

    Read the article

  • Android AES and init vector

    - by Donald_W
    I have an issue with AES encryptio and decryption: I can change my IV entirely and still I'm able to decode my data. public static final byte[] IV = { 65, 1, 2, 23, 4, 5, 6, 7, 32, 21, 10, 11, 12, 13, 84, 45 }; public static final byte[] IV2 = { 65, 1, 2, 23, 45, 54, 61, 81, 32, 21, 10, 121, 12, 13, 84, 45 }; public static final byte[] KEY = { 0, 42, 2, 54, 4, 45, 6, 7, 65, 9, 54, 11, 12, 13, 60, 15 }; public static final byte[] KEY2 = { 0, 42, 2, 54, 43, 45, 16, 17, 65, 9, 54, 11, 12, 13, 60, 15 }; //public static final int BITS = 256; public static void test() { try { // encryption Cipher c = Cipher.getInstance("AES"); SecretKeySpec keySpec = new SecretKeySpec(KEY, "AES"); c.init(Cipher.ENCRYPT_MODE, keySpec, new IvParameterSpec(IV)); String s = "Secret message"; byte[] data = s.getBytes(); byte[] encrypted = c.doFinal(data); String encryptedStr = ""; for (int i = 0; i < encrypted.length; i++) encryptedStr += (char) encrypted[i]; //decryoption Cipher d_c = Cipher.getInstance("AES"); SecretKeySpec d_keySpec = new SecretKeySpec(KEY, "AES"); d_c.init(Cipher.DECRYPT_MODE, d_keySpec, new IvParameterSpec(IV2)); byte[] decrypted = d_c.doFinal(encrypted); String decryptedStr = ""; for (int i = 0; i < decrypted.length; i++) decryptedStr += (char) decrypted[i]; Log.d("", decryptedStr); } catch (Exception ex) { Log.d("", ex.getMessage()); } } Any ideas what I'm doing wrong? How can I get 256 bit AES encryption (only change key to 32-byte long array?) Encryption is a new topic for me so please for newbie friendly answers.

    Read the article

  • Record the timestamps of slide changes during a live Powerpoint presentation?

    - by StackedCrooked
    I am planning to implement a lecture capture solution. One of the requirements is to record both the presenter and the slideshow. The presenter is recorded with a videocamera obviously, and the slideshow will probably be captured using a tool like Camtasia. Now during playback three components are visible: the presenter, the slides and a table of contents. Clicking a chapter title in the TOC causes the video to navigate to the corresponding section. This means that a mapping must be made between chapter titles and their timestamps in the video. Usually a change of topic is accompanied with a slide change in the Powerpoint presentation. So the timestamps could be deduced from the slidechanges. However, this requires me to detect slide changes during the live presentation. And I don't know how to do that. Anyone here knows how to do detect slide changes? Is there a Powerpoint API where I can connect event handlers or something like that? I'd greatly appreciate your help! Edit This issue is no longer relevant for my current work so this question will not be updated by me. However, you are still free to help others by posting your answers/insights here.

    Read the article

  • Advice on using .Net WorkFlow State Machine. What would you do?

    - by jlafay
    So I've been tasked at work to write windows services to replace some old legacy VB6 WinForms apps currently running as services, consistently repeating tasks day-to-day. To give some general background, they have there own state machines built in to handle decision basing and not utilizing threading. A lot of the senior developers here thought it would be worth a try to look into WorkFlow to replace the state machines rather than write my own business logic and try threading it programmaticly. So it's WF vs. the "Old College Try" I suppose. My concern is that there aren't many books on the topic, and since it was implemented in .Net I've heard very little about it being used. I brought this up at work and another developer mentioned that it's because Biz Talk never really caught on and it was designed for that. So is it broken? Do you think it will be supported long enough to not worry so much? I don't want an ill-functioning process injected into my services, my new babies at work, and then have WF's keel over. Leaving me with having to replace them with my own code in the event of an emergency; which does not seem like much of a grand scenario to me. Any suggestions, recommendations would be super.

    Read the article

  • Can I specify default value?

    - by atch
    Why is it that for user defined types when creating an array of objects every element of this array is initialized with default ctor but when I create built-in type this isn't the case? And second question: is it possible to specify default value to be used while initialize? Something like this (not valid): char* p = new char[size]('\0'); And another question in this topic while I'm with arrays. I suppose that when creating an array of user defined type and knowing the fact that every elem. of this array will be initialized with default value firstly why? If arrays for built in types do not initialize their elems. with their dflts why do they do it for UDT, and secondly: is there a way to switch it off/avoid/circumvent somehow? It seems like bit of a waste if I for example have created an array with size 10000 and then 10000 times dflt ctor will be invoked and I will (later on) overwrite this values anyway. I think that behaviour should be consistent, so either every type of array should be initialized or none. And I think that the behaviour for built-in arrays is more appropriate.

    Read the article

  • Pre-populate iPhone Safari SQLite DB

    - by Matt Rogish
    I'm working with a PhoneGap app that uses Safari local storage (SQlite DB) via Javascript: http://developer.apple.com/safari/library/documentation/iPhone/Conceptual/SafariJSDatabaseGuide/UsingtheJavascriptDatabase/UsingtheJavascriptDatabase.html On first load, the app creates the database, tables, and populates the data via a series of INSERT statements. If the user closes the app while this processing is happening, then my app database is left in an inconsistent state. What I prefer to do is deploy the SQLite DB as part of my iTunes App packaging so nothing must be populated at app cold start. However, I'm not sure if that is possible -- all of the google hits for this topic that I can find are referring to the core-data provided SQLite which is not what we're using... If it's not possible, could I wrap the entire thing in a transaction and keep re-trying it when the app is restarted? Failing that, I guess I can create a simple table with one boolean column "is_app_db_loaded?" and set it to true after I've processed all my inserts. But that's really gross... Ideas? Thanks!!

    Read the article

  • What should be taught in a "Fundamentals of programming" course at university?

    - by Dervin Thunk
    I have started a new question (see here), because I think the topic is of importance in a more general form. The question is now: If you were a professor at a Computer Science Dept. in some university, what would make it into your course? This is a programming course, second term, first year computer science/computer engineering. Remember you have a limited amount of time, and students are of different levels of competence, and some may be scientists, but some will also go on to be programmers in companies of different kinds. You have to cater to all. Bonus: What language? (Although see this question for my current thoughts about this...) Maybe you want to attach a course outline from some university? See here for an even more general question about this. Answer: I can't really summarize this post... I guess it was too subjective. However, it looks like we have to cover the history of computing up to a certain extent, computer architecture (memory, registers, whatever), C, and finally some basic algos and data structures in a problem solving fashion. This will be the bare bones of the course. Thanks all. I will accept the most voted up answer to close the thread, as it should be done.

    Read the article

  • Removing HttpModule for specific path in ASP.NET / IIS 7 application?

    - by soccerdad
    Most succinctly, my question is whether an ASP.NET 4.0 app running under IIS 7 integrated mode should be able to honor this portion of my Web.config file: <location path="auth/windows"> <system.webServer> <modules> <remove name="FormsAuthentication"/> </modules> </system.webServer> </location> I'm experimenting with mixed mode authentication (Windows and Forms - I know there are other questions on S.O. about the topic). Using IIS Manager, I've disabled Anonymous authentication to auth/windows/winauth.aspx, which is within the location path above. I have Failed Request Tracing set up to trace various HTTP status codes, including 302s. When I request the winauth.aspx page, a 302 HTTP status code is returned. If I look at the request trace, I can see that a 401 (unauthorized) was originally generated by the AnonymousAuthenticationModule. However, the FormsAuthenticationModule converts that to a 302, which is what the browser sees. So it seems as though my attempt to remove that module from the pipeline for pages in that path isn't working. But I'm not seeing any complaints anywhere (event viewer, yellow pages of death, etc.) that would indicate it's an invalid configuration. I want the 401 returned to the browser, which presumably would include an appropriate WWW-Authenticate header. A couple of other points: a) I do have <authentication mode="Forms"> in my Web.config, and that is what the 302 redirects to; b) I got the "name" of the module I'm trying to remove from the inetserv\config\applicationHost.config file. Anyone had any luck removing modules in this fashion? Thanks much, Donnie

    Read the article

  • Return 0 where django quersyet is none

    - by gramware
    I have a django queryset in my views whose values I pack before passing to my template. There is a problem when the queryset returns none since associated values are not unpacked. the quersyet is called comments. Here is my views.py def forums(request ): post_list = list(forum.objects.filter(child='0')&forum.objects.filter(deleted='0').order_by('postDate')) user = UserProfile.objects.get(pk=request.session['_auth_user_id']) newpostform = PostForm(request.POST) deletepostform = PostDeleteForm(request.POST) DelPostFormSet = modelformset_factory(forum, exclude=('child','postSubject','postBody','postPoster','postDate','childParentId')) readform = ReadForumForm(request.POST) comments =list( forum.objects.filter(deleted='0').filter(child='1').order_by('childParentId').values('childParentId').annotate(y=Count('childParentId'))) if request.user.is_staff== True : staff = 1 else: staff = 0 staffis = 1 if newpostform.is_valid(): topic = request.POST['postSubject'] poster = request.POST['postPoster'] newpostform.save() return HttpResponseRedirect('/forums') else: newpostform = PostForm(initial = {'postPoster':user.id}) if request.GET: form = SearchForm(request.GET) if form.is_valid(): query = form.cleaned_data['query'] post_list = list((forum.objects.filter(child='0')&forum.objects.filter(deleted='0')&forum.objects.filter(Q(postSubject__icontains=query)|Q(postBody__icontains=query)|Q(postDate__icontains=query)))or(forum.objects.filter(deleted='0')&forum.objects.filter(Q(postSubject__icontains=query)|Q(postBody__icontains=query)|Q(postDate__icontains=query)).values('childParentId'))) if request.method == 'POST': delpostformset = DelPostFormSet(request.POST) if delpostformset.is_valid(): delpostformset.save() return HttpResponseRedirect('/forums') else: delpostformset = DelPostFormSet(queryset=forum.objects.filter(child='0', deleted='0')) """if readform.is_valid(): user=get_object_or_404(UserProfile.objects.all()) readform.save() else: readform = ReadForumForm()""" post= zip( post_list,comments, delpostformset.forms) paginator = Paginator(post, 10) # Show 10 contacts per page # Make sure page request is an int. If not, deliver first page. try: page = int(request.GET.get('page', '1')) except ValueError: page = 1 # If page request (9999) is out of range, deliver last page of results. try: post = paginator.page(page) except (EmptyPage, InvalidPage): post = paginator.page(paginator.num_pages) return render_to_response('forum.html', {'post':post, 'newpostform': newpostform,'delpost':delpostformset, 'username':user.username, 'comments':comments, 'user':user, },context_instance = RequestContext( request ))

    Read the article

  • How do I optimize this postfix expression tree for speed?

    - by Peter Stewart
    Thanks to the help I received in this post: I have a nice, concise recursive function to traverse a tree in postfix order: deque <char*> d; void Node::postfix() { if (left != __nullptr) { left->postfix(); } if (right != __nullptr) { right->postfix(); } d.push_front(cargo); return; }; This is an expression tree. The branch nodes are operators randomly selected from an array, and the leaf nodes are values or the variable 'x', also randomly selected from an array. char *values[10]={"1.0","2.0","3.0","4.0","5.0","6.0","7.0","8.0","9.0","x"}; char *ops[4]={"+","-","*","/"}; As this will be called billions of times during a run of the genetic algorithm of which it is a part, I'd like to optimize it for speed. I have a number of questions on this topic which I will ask in separate postings. The first is: how can I get access to each 'cargo' as it is found. That is: instead of pushing 'cargo' onto a deque, and then processing the deque to get the value, I'd like to start processing it right away. I don't yet know about parallel processing in c++, but this would ideally be done concurrently on two different processors. In python, I'd make the function a generator and access succeeding 'cargo's using .next(). But I'm using c++ to speed up the python implementation. I'm thinking that this kind of tree has been around for a long time, and somebody has probably optimized it already. Any Ideas? Thanks

    Read the article

  • Which languages and techniques can I use to improve my coding practices?

    - by Danjah
    I've been offered the opportunity upskill through study, while at work which is great. My background I am mostly self-taught, but have worked with many excellent people over the years - both self-taught and fully educated, and on many decent projects. I have mild experience in Actionscript, I'm getting better every day with my Javascript, and my CSS is angled at best practice, but needs a bit of modernising. I'm a traditional interface developer, I'm not stupid and I like a challenge. My goal I need to start seeing ways of applying better logic, optimising code, refactoring, different styles of development (agile, others?), and.. well I need to try and start thinking like.. a more solid programmer. Its hard to describe, I have good solutions and I'm efficient - but I KNOW that there's a bunch I am missing. I am already employed with a solid career, but I feel the need to fill gaps. My question/s Are there a set of guiding principles you can recommend I focus on to improve the points above? Are there particular programming languages which I might focus on to get a broader overview? Do you think I should avoid particular styles of development, or even languages, while solidifying what might end up being part 'the basics' but hopefully 'advanced programming'? -- Sorry if this appears off topic or something but I figure you're probably some of the best people to ask.

    Read the article

  • incremental way of counting quantiles for large set of data

    - by Gacek
    I need to count the quantiles for a large set of data. Let's assume we can get the data only through some portions (i.e. one row of a large matrix). To count the Q3 quantile one need to get all the portions of the data and store it somewhere, then sort it and count the quantile: List<double> allData = new List<double>(); foreach(var row in matrix) // this is only example. In fact the portions of data are not rows of some matrix { allData.AddRange(row); } allData.Sort(); double p = 0.75*allData.Count; int idQ3 = (int)Math.Ceiling(p) - 1; double Q3 = allData[idQ3]; Now, I would like to find a way of counting this without storing the data in some separate variable. The best solution would be to count some parameters od mid-results for first row and then adjust it step by step for next rows. Note: These datasets are really big (ca 5000 elements in each row) The Q3 can be estimated, it doesn't have to be an exact value. I call the portions of data "rows", but they can have different leghts! Usually it varies not so much (+/- few hundred samples) but it varies! This question is similar to this one: http://stackoverflow.com/questions/1058813/on-line-iterator-algorithms-for-estimating-statistical-median-mode-skewness But I need to count quantiles. ALso there are few articles in this topic, i.e.: http://web.cs.wpi.edu/~hofri/medsel.pdf http://portal.acm.org/citation.cfm?id=347195&dl But before I would try to implement these, I wanted to ask you if there are maybe any other, qucker ways of counting the 0.25/0.75 quantiles?

    Read the article

  • How would you implement a hashtable in language x?

    - by mk
    The point of this question is to collect a list of examples of hashtable implementations using arrays in different languages. It would also be nice if someone could throw in a pretty detailed overview of how they work, and what is happening with each example. Edit: Why not just use the built in hash functions in your specific language? Because we should know how hash tables work and be able to implement them. This may not seem like a super important topic, but knowing how one of the most used data structures works seems pretty important to me. If this is to become the wikipedia of programming, then these are some of the types of questions that I will come here for. I'm not looking for a CS book to be written here. I could go pull Intro to Algorithms off the shelf and read up on the chapter on hash tables and get that type of info. More specifically what I am looking for are code examples. Not only for me in particular, but also for others who would maybe one day be searching for similar info and stumble across this page. To be more specific: If you had to implement them, and could not use built-in functions, how would you do it? You don't need to put the code here. Put it in pastebin and just link it.

    Read the article

  • Using PHP to get the source code of a URL I must be logged in to reach

    - by Maxwell
    I am trying to write a PHP script that will get the source code of a page in my Amazon account. However, to reach that page, I must be logged in. From what I understand, I should be able to accomplish this by posting the correct request headers, and then capturing the HTML response. Is that correct? If so, I'd really appreciate it if someone could explain to me how exactly I would do this. If it's not right, I'd love to hear the correct way of doing it! I've used Firebug to get the request and response headers I need. It's just a matter of what to do with them now. I read elsewhere on this site that you can't send a request with the PHP post method, and that perhaps using cURL is the way to go. I really know nothing about cURL, so the more info the better. Also, feel free to point me to some useful tutorials on this topic. Thanks! Max

    Read the article

  • Should a developer be a coauthor to a paper presented about the application they developed?

    - by ved
    In our organization, project teams come up with a need and funding and developers are given a basic scope and are allowed to develop the solution. There is a certain degree of implementation freedom given to the developers. They drive the solution to pilot and live deployment from its inception. If the solution is presented in a conference as a technical paper/white paper what is the protocol for the list of authors: because for the most part I see the project manager's and the dev team manager's names as authors but no mention of the actual developer. Is this correct? A lot of us developers feel pretty bummed to never see our names as the coauthors. Appreciate any pointers. Answers to the FOLLOW UP questions (1) in what field of study is the paper, and what are the standards of authorship for that field? The paper is for Flood Plain Management - there is nothing on the abstract guidelines, I have called the contact person listed for comment - waiting to hear. 2) was the paper literally about the software application as your question implies, or were the software issues incidental to the topic of the paper? The paper specifically deals with a GIS Application that is used in Coastal Engineering, yes the software is not incidental, but the meat of the paper and mentioned in the Title. 2

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

< Previous Page | 316 317 318 319 320 321 322 323 324 325 326 327  | Next Page >