Search Results

Search found 37088 results on 1484 pages for 'object element'.

Page 328/1484 | < Previous Page | 324 325 326 327 328 329 330 331 332 333 334 335  | Next Page >

  • Weak reference and Strong reference

    - by theband
    package uk.co.bigroom.utils { import flash.utils.Dictionary; /** * Class to create a weak reference to an object. A weak reference * is a reference that does not prevent the object from being * garbage collected. If the object has been garbage collected * then the get method will return null. */ public class WeakRef { private var dic:Dictionary; /** * The constructor - creates a weak reference. * * @param obj the object to create a weak reference to */ public function WeakRef( obj:* ) { dic = new Dictionary( true ); dic[obj] = 1; } /** * To get a strong reference to the object. * * @return a strong reference to the object or null if the * object has been garbage collected */ public function get():* { for ( var item:* in dic ) { return item; } return null; } } } In this Class, how they denote one as Weak Reference and one as Strong reference.

    Read the article

  • In flex how do I pass data retrieved from a remote object service to a modules interface?

    - by Dan G
    I found at this Adobe tutorial a nice "RemoteService" class that creates a RemoteObject and contains the functions for handling the result and fault events. If I wanted to use this approach, how could I pass the data from the result handler to interfaces that modules from the main application could use? I could put the RemoteService/RemoteObject in the modules, but (in my opinion- and I could be wrong) the best design seems to be using the remote calls in the main app and passing the data along to the modules.

    Read the article

  • Objective-C Basic class related question, retaining the value of a specific object using a class fil

    - by von steiner
    Members, scholars, code gurus. My background is far from any computer programming thus my question may seems basic and somewhat trivial to you. Nevertheless it seems that I can't put my head around it. I have googled and searched for the answer, just to get myself confused even more. With that, I would kindly ask for a simple explanation suitable for a non technical person such as myself and for other alike arriving to this thread. I have left a comment with the text "Here is the issue" below, referring to my question. // character.h #import <Foundation/Foundation.h> @interface character : NSObject { NSString *name; int hitPoints; int armorClass; } @property (nonatomic,retain) NSString *name; @property int hitPoints,armorClass; -(void)giveCharacterInfo; @end // character.m #import "character.h" @implementation character @synthesize name,hitPoints,armorClass; -(void)giveCharacterInfo{ NSLog(@"name:%@ HP:%i AC:%i",name,hitPoints,armorClass); } @end // ClassAtLastViewController.h #import <UIKit/UIKit.h> @interface ClassAtLastViewController : UIViewController { } -(void)callAgain; @end // ClassAtLastViewController.m #import "ClassAtLastViewController.h" #import "character.h" @implementation ClassAtLastViewController - (void)viewDidLoad { //[super viewDidLoad]; character *player = [[character alloc]init]; player.name = @"Minsc"; player.hitPoints = 140; player.armorClass = 10; [player giveCharacterInfo]; [player release]; // Up until here, All peachy! [self performSelector:@selector(callAgain) withObject:nil afterDelay:2.0]; } -(void)callAgain{ // Here is the issue, I assume that since I init the player again I loss everything // Q1. I loss all the data I set above, where is it than? // Q2. What is the proper way to implement this character *player = [[character alloc]init]; [player giveCharacterInfo]; } Many thanks in advance, Kindly remember that my background is more related to Salmons breeding than to computer code, try and lower your answer to my level if it's all the same to you.

    Read the article

  • OpenGL ES - how to keep some object at a fixed size?

    - by OMH
    I'm working on a little game in OpenGL ES. In the background, there is a world/map. The map is just a large texture. Zoom/pinch/pan is used to move around. And I'm using glOrthof (left, right, bottom, top, zNear, zFar) to implement the zoom/pinch. When I zoom in, the sprites on top of the map is also zoomed in. But I would like to have some sprites stay at a fixed size. I could probably calculate a scale factor, depending on the parameters to glOrthof, but there must be a more natural and straightforward way of doing that, instead of scaling the sprites down when I zoom in. If I add some text or some GUI elements on top of the map, they should definately have a fixed size. Is there a solution to do this, or do I have to leave fixed values in glOrthof and implement zoom/pinch in another way? EDIT: To be more clear: I want sprites that zoom in/out along with the map, but stay at the same size. I have some elements that are like the pins on the iPhone's map application. When you zoom, the pins stay the same size, but move around on the screen to stay on the same spot on the map. That is mainly what I want a solution for. Solutions for this already came below, thanks!

    Read the article

  • [C#] Finding the index of a queue that holds a member of a containing object for a given value

    - by Luke Mcneice
    I have a Queue that contains a collection of objects, one of these objects is a class called GlobalMarker that has a member called GlobalIndex. What I want to be able to do is find the index of the queue where the GlobalIndex contains a given value (this will always be unique). Simply using the .contains function shown bellow returns a bool. How can I obtain the queue index of this match? RealTimeBuffer.OfType<GlobalMarker>().Select(o => o.GlobalIndex).Contains(INT_VALUE);

    Read the article

  • How can I add a field with an array value to my Perl object?

    - by superstar
    What's the difference between these two constructors in perl? 1) sub new { my $class = shift; my $self = {}; $self->{firstName} = undef; $self->{lastName} = undef; $self->{PEERS} = []; bless ($self, $class); return $self; } 2) sub new { my $class = shift; my $self = { _firstName => shift, _lastName => shift, _ssn => shift, }; bless $self, $class; return $self; } I am using the second one so far, but I need to implement the PEERS array in the second one? How do I do it with the second constructor and how can we use get and set methods on those array variables?

    Read the article

  • Using the Loader display object to load X jpegs, then resize each of the images differently while th

    - by Supernovah
    Hey there, I was wondering if this is possible to do I am able to load the image in and have it displayed easily enough by using addChild(myLoader); where myLoader is in the classWide private scope. The problem is, whenever I call my function inside that class which adds the loader to the stage, it clears the old one and puts this new one in even if I add a bit where I change myLoader.name to something related to how many images it has completed. This is a serious hinderance as I can't do anything besides KNOW how many images I will need to load and write the code X times. The problem being is that the urls are read from an XML file. My main desire was to have a classWide private Array which contained my loaders and I would assign them using myArray.push(myLoader) each time the load had completed. There is a problem which is that it compiles but they never get displayed it would work as this is written public class Images extends Sprite { private var imagesLoaded = 0; private var myLoader:Loader; ... public function Images():Void { myLoader = new Loader; //loop calling a myLoader.load(imageURL) for a bunch of urls myLoader.contentLoaderInfo.addEventListener(Event.COMPLETE, imageLoaded); } public function imageLoaded { myArray[imagesLoaded] = myLoader; trace("does\'nt get to here!!"); addChild(myArray[imagesLoaded]); imagesLoaded++; } }

    Read the article

  • Loading table sections when using headers

    - by Luis Tovar
    I cant seem to wrap my head around this. I have googled, and overstacked for hours now looking for examples that i can relate to. What I have is two arrays. The name of my first NSMutableArray is "showDates". I have 3 objects in here. Object 0: "Today, May 20th" Object 1: "Tomorrow, May 21st" Object 2: "Saturday, May 22nd" Then I have my second NSMutableArray named "showTimes" I have about 15 objects in there with strings in each object. ( i hope that makes sense? ) Each object is structured like this: Object 0: showID @"98022" eventID @"833" showTime @"1:30pm" showDate @"Today, May 20th" auditorium @"9" venue @"2991" Object 1: showID @"98222" eventID @"813" showTime @"2:30pm" showDate @"Tomorrow, May 21st" auditorium @"9" venue @"2991" Etc, etc, .... I have the headers working great in my tableView, but I cant seem to figure out how to add the objects in my "showTimes" array under the correct header. Any help would be greatly appreciated.

    Read the article

  • How do you determine when an object is drawn on-screen in OpenGL?

    - by Harry
    I'm extremely new to OpenGL. I'm writing a program that displays flying text on screen. I need to know when certain text string appears (drawn) onto the screen and are visible to the user. The program needs to identify which text strings are displayed. At first, I started to think that I could use OpenGL's picking mechanism, but so far I've only seen examples where the selection area is focused on some sort of user interaction. I want to know what objects are displayed on the entire window area. This leads me to think I'm on the wrong track... Am I missing something? Any suggestions are welcome.

    Read the article

  • How to encapsulate a third party complex object structure?

    - by tangens
    Motivation Currently I'm using the java parser japa to create an abstract syntax tree (AST) of a java file. With this AST I'm doing some code generation (e.g.: if there's an annotation on a method, create some other source files, ...) Problem When my code generation becomes more complex, I've to dive deeper into the structure of the AST (e.g. I have to use visitors to extract some type information of method parameters). But I'm not sure if I want to stay with japa or if I will change the parser library later. Because my code generator uses freemarker (which isn't good at automatic refactoring) I want the interface that it uses to access the AST information to be stable, even if I decide to change the java parser. Question What's the best way to encapsulate complex datastructures of third party libraries? I could create my own datatypes and copy the parts of the AST that I need into these. I could create lots of specialized access methods that work with the AST and create exactly the infos I need (e.g. the fully qualified return type of a method as one string, or the first template parameter of a class). I could create wrapper classes for the japa datastructures I currently need and embed the japa types inside, so that I can delegate requests to the japa types and transform the resulting japa types to my wrapper classes again. Which solution should I take? Are there other (better) solutions to this problem?

    Read the article

  • Google App Engine JDO error could be caused by Serializable object ?

    - by Frank
    I got the following error mesage : java.lang.UnsupportedOperationException org.datanucleus.store.appengine.EntityUtils.getPropertyName(EntityUtils.java:62) org.datanucleus.store.appengine.DatastoreFieldManager.storeObjectField(DatastoreFieldManager.java:839) org.datanucleus.state.AbstractStateManager.providedObjectField(AbstractStateManager.java:1037) PayPal_Monitor.Contact_Info_Entry.jdoProvideField(Contact_Info_Entry.java) PayPal_Monitor.Contact_Info_Entry.jdoProvideFields(Contact_Info_Entry.java) org.datanucleus.state.JDOStateManagerImpl.provideFields(JDOStateManagerImpl.java:2715) Could it be caused by my Contact_Info_Entry.java ? It looks like this : @PersistenceCapable(identityType=IdentityType.APPLICATION) public class Contact_Info_Entry implements Serializable { @PrimaryKey @Persistent(valueStrategy=IdGeneratorStrategy.IDENTITY) Long Id; public static final long serialVersionUID=26362862L; @Persistent String Contact_Id=""; ... }

    Read the article

  • What's the best way of accessing a DRb object (e.g. Ruby Queue) from Scala (and Java)?

    - by Tom Morris
    I have built a variety of little scripts using Ruby's very simple Queue class, and share the Queue between Ruby and JRuby processes using DRb. It would be nice to be able to access these from Scala (and maybe Java) using JRuby. I've put together something Scala and the JSR-223 interface to access jruby-complete.jar. import javax.script._ class DRbQueue(host: String, port: Int) { private var engine = DRbQueue.factory.getEngineByName("jruby") private var invoker = engine.asInstanceOf[Invocable] engine.eval("require \"drb\" ") private var queue = engine.eval("DRbObject.new(nil, \"druby://" + host + ":" + port.toString + "\")") def isEmpty(): Boolean = invoker.invokeMethod(this.queue, "empty?").asInstanceOf[Boolean] def size(): Long = invoker.invokeMethod(this.queue, "length").asInstanceOf[Long] def threadsWaiting: Long = invoker.invokeMethod(this.queue, "num_waiting").asInstanceOf[Long] def offer(obj: Any) = invoker.invokeMethod(this.queue, "push", obj.asInstanceOf[java.lang.Object]) def poll(): Any = invoker.invokeMethod(this.queue, "pop") def clear(): Unit = { invoker.invokeMethod(this.queue, "clear") } } object DRbQueue { var factory = new ScriptEngineManager() } (It conforms roughly to java.util.Queue interface, but I haven't declared the interface because it doesn't implement the element and peek methods because the Ruby class doesn't offer them.) The problem with this is the type conversion. JRuby is fine with Scala's Strings - because they are Java strings. But if I give it a Scala Int or Long, or one of the other Scala types (List, Set, RichString, Array, Symbol) or some other custom type. This seems unnecessarily hacky: surely there has got to be a better way of doing RMI/DRb interop without having to use JSR-223 API. I could either make it so that the offer method serializes the object to, say, a JSON string and takes a structural type of only objects that have a toJson method. I could then write a Ruby wrapper class (or just monkeypatch Queue) to would parse the JSON. Is there any point in carrying on with trying to access DRb from Java/Scala? Might it just be easier to install a real message queue? (If so, any suggestions for a lightweight JVM-based MQ?)

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Using the MongoDB Ruby driver in Rails? (without an object mapper)

    - by Mark L
    I have recently been getting my feet wet in MongoDB using Mongoid w/ Rails 3, but I'm now interested in learning the low level MongoDB features using only the Ruby driver, and trying some map/reduce that would not be possible through Mongoid (afaik) I'm not entirely sure where in Rails I should be setting up the db connections etc, and any pointers would be much appreciated!

    Read the article

  • Load XML file into object. Best method?

    - by Cypher
    Hello, We are receiving an XML file from our client. I want to load the data from this file into a class, but am unsure about which way to go about it. I have an XSD to defining what is expected in the XML file, so therefore i can easily validate the XML file. Can i use the XSD file to load the data into a POCO, using some sort of serialization? The other way i was thinking was to load the xml into a XMLDocument and use XPath to populate each property in my class. Cheers for any advice

    Read the article

  • What is the best way to organize object oriented code?

    - by Adam
    I haven't coded in java for a long time, and after coding in C, I'm having issued organizing my code for OOP. More specifically I'm not sure when to create a new method, and when to create a new class, and when to just lump everything together. Are there some general rules or guidelines on how it should be done?

    Read the article

  • How can a Delphi TPersistent object calculate its own deserialization time?

    - by mjustin
    For performance tests I need a way to measure the time needed for a form to load its definition from the DFM. All existing forms inherit a custom form class. To capture the current time, this base class needs overriden methods as "extension points": start of the deserialization process after the deserialization (can be implemented by overriding the Loaded procedure) the moment just before the execution of the OnFormCreate event So the log for TMyForm.Create(nil) could look like: - 00.000 instance created - 00.010 before deserialization - 01.823 after deserialization - 02.340 before OnFormCreate Which TObject (or TComponent) methods are best suited? Maybe there are other extension points in the form creation process, please feel free to make suggestions.

    Read the article

  • Is there a way to enforce/preserve order of XML elements in an XML Schema?

    - by MarcoS
    Let's consider the following XML Schema: <?xml version="1.0" encoding="UTF-8"?> <schema targetNamespace="http://www.example.org/library" elementFormDefault="qualified" xmlns="http://www.w3.org/2001/XMLSchema" xmlns:lib="http://www.example.org/library"> <element name="library" type="lib:libraryType"></element> <complexType name="libraryType"> <sequence> <element name="books" type="lib:booksType"></element> </sequence> </complexType> <complexType name="booksType"> <sequence> <element name="book" type="lib:bookType" maxOccurs="unbounded" minOccurs="1"></element> </sequence> </complexType> <complexType name="bookType"> <attribute name="title" type="string"></attribute> </complexType> </schema> and a corresponding XML example: <?xml version="1.0" encoding="UTF-8"?> <lib:library xmlns:lib="http://www.example.org/library" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.example.org/library src/library.xsd "> <lib:books> <lib:book title="t1"/> <lib:book title="t2"/> <lib:book title="t3"/> </lib:books> </lib:library> Is there a way to guarantee that the order of <lib:book .../> elements is preserved? I want to be sure that any parser reading the XML will return books in the specified oder, that is first the book with title="t1", then the book with title="t2", and finally the book with title="t3". As far as I know XML parsers are not required to preserve order. I wonder whether one can enforce this through XML Schema? One quick solution for me would be adding an index attribute to the <lib:book .../> element, and delegate order preservation to the application reading the XML. Comments? Suggestions?

    Read the article

  • AS3: Removing EventListeners without knowing amount or names

    - by DevEight
    Hello! First shortly about how my site works: When a link is clicked it checks if something is already displayed in either the Left or Right side of the screen (the website looks like a book, so I have a left page I want to display information on and a right page). If there is already something showing it hides it and displays the new object, together with this it enables all the buttons within that object (I have separate functions to set up each object). An example of such an EventListener would be: pathTo.Button1.addEventListener(MouseEvent.CLICK, function():void {showText(side, object)}); What I'm trying to do is to remove all the previous set EventListeners without having to create separate functions for removing the links inside every object as well. Shorter version: How do I remove all EventListeners on all objects inside another object? The only variable I want to store is the object containing everything. There are however not always EventListeners within the objects.

    Read the article

< Previous Page | 324 325 326 327 328 329 330 331 332 333 334 335  | Next Page >