Search Results

Search found 2313 results on 93 pages for 'continuous delivery'.

Page 33/93 | < Previous Page | 29 30 31 32 33 34 35 36 37 38 39 40  | Next Page >

  • Oracle Unified Method (OUM) Release 5.6

    - by user714714
    ORACLE® UNIFIED METHOD RELEASE 5.6 Oracle’s Full Lifecycle Methodfor Deploying Oracle-Based Business Solutions About | Release | Access | Previous Announcements About Oracle is evolving the Oracle® Unified Method (OUM) to achieve the vision of supporting the entire Enterprise IT Lifecycle, including support for the successful implementation of every Oracle product. OUM replaces Legacy Methods, such as AIM Advantage, AIM for Business Flows, EMM Advantage, PeopleSoft's Compass, and Siebel's Results Roadmap. OUM provides an implementation approach that is rapid, broadly adaptive, and business-focused. OUM includes a comprehensive project and program management framework and materials to support Oracle's growing focus on enterprise-level IT strategy, architecture, and governance. Release OUM release 5.6 provides support for Application Implementation, Cloud Application Implementation, and Software Upgrade projects as well as the complete range of technology projects including Business Intelligence (BI) and Enterprise Performance Management (EPM), Enterprise Security, WebCenter, Service-Oriented Architecture (SOA), Application Integration Architecture (AIA), Business Process Management (BPM), Enterprise Integration, and Custom Software. Detailed techniques and tool guidance are provided, including a supplemental guide related to Oracle Tutor and UPK. This release features: Business Process Management (BPM) Project Engineering Supplemental Guide Cloud Roadmap View and Supplemental Guide Enterprise Security View and Supplemental Guide Service-Oriented Architecture (SOA) Governance Implementation Supplemental Guide "Tailoring OUM for Your Project" White Paper OUM Microsoft Project Workplan Template and User's Guide Mappings: OUM to J.D. Edwards OneMethodology, OUM Roles to Task Techniques: Determining Number of Iterations, Managing an OUM Project using Scrum Templates: Scrum Workplan (WM.010), Siebel CRM Enhanced / Updated: Manage Focus Area reorganized by Activities for all Views Oracle Architecture Development Process (OADP) View updated for OADP v3.0 Oracle Support Services Supplemental Guide expanded to include guidance related to IT Change Management Oracle User Productivity Kit Professional (UPK Pro) and Tutor Supplemental Guide expanded guidance for UPK Pro Service-Oriented Architecture (SOA) Application Integration Architecture (AIA) Supplemental Guide updated for SOA Tactical Project Delivery View Service-Oriented Architecture (SOA) Tactical Project Delivery View expanded to include additional tasks Siebel CRM Supplemental Guide expanded task guidance and added select Siebel-specific OUM templates WebCenter View and Supplemental Guide updated for WebCenter Portal and Content Management For a comprehensive list of features and enhancements, refer to the "What's New" page of the Method Pack. Upcoming releases will provide expanded support for Oracle's Enterprise Application suites including product-suite specific materials and guidance for tailoring OUM to support various engagement types. Access Oracle Customers Oracle customers may obtain copies of the method for their internal use – including guidelines, templates, and tailored work breakdown structure – by contracting with Oracle for a consulting engagement of two weeks or longer and meeting some additional minimum criteria. Customers, who have a signed consulting contract with Oracle and meet the engagement qualification criteria, are permitted to download the current release of OUM for their perpetual use. They may also obtain subsequent releases published during a renewable, three-year access period. Training courses are also available to these customers. Contact your local Oracle Sales Representative about enrolling in the OUM Customer Program. Oracle PartnerNetwork (OPN) Diamond, Platinum, and Gold Partners OPN Diamond, Platinum, and Gold Partners are able to access the OUM method pack, training courses, and collateral from the OPN Portal at no additional cost: Go to the OPN Portal at partner.oracle.com. Select the "Partners (Login Required)" tab. Login. Select the "Engage with Oracle" tab. From the Engage with Oracle page, locate the "Applications" heading. From the Applications heading, locate and select the "Oracle Unified Method" link. From the Oracle Unified Method Knowledge Zone, select the "Implement" tab. From the Implement tab, select the "Tools and Resources" link. Locate and select the "Oracle Unified Method (OUM)" link. Previous Announcements Oracle Unified Method (OUM) Release 5.6 Oracle Unified Method (OUM) Release 5.5 Oracle Unified Method (OUM) Release 5.4 Oracle EMM Advantage Retired Retirement of Oracle EMM Advantage Planned for December 01, 2011

    Read the article

  • JDeveloper 11g R1 (11.1.1.4.0) - New Features on ADF Desktop Integration Explained

    - by juan.ruiz
    One of the areas that introduced many new features on the latest release (11.1.1.4.0)  of JDeveloper 11g R1 is ADF Desktop integration - in this article I’ll provide an overview of these new features. New ADF Desktop Integration Ribbon in Excel - After installing the ADF desktop integration add-in and depending on the mode in which you open the desktop integration workbook, the ADF Desktop integration ribbon for design time and runtime are displayed as a separate tab within Excel. In previous version the ADF Desktop integration environment used to be placed inside the add-ins tab. Above you can see both, design time ribbon as well as runtime ribbon. On the design time ribbon you can manage the workbook and worksheet properties, worksheet component properties, diagnostics, execution and publication of the workbook. The runtime version of the ribbon is totally customizable and represents what it used to be the runtime menu on the spreadsheet, in this ribbon you can include all the operations and actions that could be executed by the end user while working with the spreadsheet data. Diagnostics - A very important aspect for developers is how to debug or verify the interactions of the client with the server, for that ADF desktop integration has provided since day one a series of diagnostics tools. In this release the diagnostics tools are more visible and are really easy to configure. You can access the client console while testing the workbook, or you can simple dump all the messages to a log file – having the ability of setting the output level for both. Security - There are a number of enhancements on security but the one with more impact for developers is tha security now is optional when using ADF Desktop Integration. Until this version every time that you wanted to work with ADFdi it was a must that the application was previously secured. In this release security is optional which means that if you have previously defined security on your application, then you must secure the ADFdi servlet as explained in one of my previous (ADD LINK) posts. In the other hand, if but the time that you start working with ADFdi you have not defined security, you can test and publish your workbooks without adding security. Support for Continuous Integration - In this release we have added tooling for continuous integration building. in the ADF desktop integration space, the concept translates to adding functionality that developers can use to publish ADFdi workbooks as part of their entire application build. For that purpose, we have a publish tool that can be easily invoke from an ANT task such that all the design time workbooks are re-published into the latest version of the application building process. Key Column - At runtime, on any worksheet containing editable tables you will notice a new additional column called the key column. The purpose of this column is to make the end user aware that all rows on the table need to be selected at the time of sorting. The users cannot alter the value of this column. From the developers points of view there are no steps required in order to have the key column included into the worksheets. Installation and Creation of New Workbooks - Both use cases can be executed now directly from JDeveloper. As part of the Tools menu options the developer can install the ADF desktop integration designer. Also, creating new workbooks that previously was done through that convert tool shipped with JDeveloper is now automatic done from the New Gallery. Creating a new ADFdi workbook adds metadata information information to the Excel workbook so you can work in design time. Other Enhancements Support for Excel 2010 and the ADF components ready-only enabled don’t allow to change its value – the cell in Excel is automatically protected, this could cause confusion among customers of previous releases.

    Read the article

  • Oracle OpenWorld Update: Demo Pods and Hands-on Labs

    - by Doug Reid
    0 false 18 pt 18 pt 0 0 false false false /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:12.0pt; font-family:"Times New Roman"; mso-ascii-font-family:Cambria; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Cambria; mso-hansi-theme-font:minor-latin;} Less than one week away until the start of Oracle OpenWorld 2012 and the Data Integration Solutions team is ready to go!  We have an exciting line up for you this year which we have summarized for you in the Oracle OpenWorld Focus on Data Integration Solutions document. In past posts we have discussed session themes and our customer panel, but today I would like to summarize our Hands-on Labs and Demo Pods that we have available for attendees. For Oracle GoldenGate Hands-On Labs we have two labs that we are running this year. Deep Dive into Oracle GoldenGate Thursday October 4th at 11:15AM in the Marriott Marquis Salon 1/2 Oracle GoldenGate provides real-time log-based change data capture and delivery between heterogeneous systems. It enables cost-effective, low-impact, real-time data integration and continuous availability solutions. This session covers Oracle GoldenGate 11g’s internal product architecture and includes a hands-on lab that covers configuration examples for target database instantiation and real-time change data capture and delivery. The participants will configure Oracle GoldenGate to instantiate a secondary database that can be used for disaster recovery or a reporting instance. Come learn how easy it is to use and how this can be a very valuable and easy technology solution for your organization. Introduction to Oracle GoldenGate Veridata Wednesday October 3rd 10:15AM in the Marriott Marquis Sales 1/2 Oracle GoldenGate Veridata compares one set of data with another and identifies data that is out of synchronization. In this hands-on lab, you will be introduced to the key features of this product. Using the Oracle GoldenGate Veridata Web client, you will have the opportunity to configure comparison objects and rules, initiate a comparison, review the status and output of a comparison, and review out-of-sync data. As a bonus this year, we have recorded the labs and made them available on youtube.com/oraclegoldengate. These will be available the day of the labs. Our demo pods are an opportunity for attendees to see our products but more so to meet the product management and development teams. I would like to point out that we have two Oracle GoldenGate 11gR2 demo pods, one in the database camp and the other in the middleware camp. The one in the middleware camp will be focused on all platforms while the one in the database camp will have a focus on the Oracle platform. The other two I would like to point out are the Monitoring Oracle GoldenGate and the Oracle Enterprise Manager demo pods; both of these pods will focus on methods to monitor GoldenGate but the OEM demo pod will have a specific focus on the Oracle GoldenGate Management Pack plug-in for OEM. Below is a list of our demo pods and their locations. Monitoring Oracle GoldenGate for End-to-End Visibility Moscone South, Right - S-241 Oracle Data Integrator and Oracle GoldenGate for Oracle Applications Moscone South, Right - S-240 Oracle GoldenGate 11gR2 New Features Moscone South, Right - S-239 Oracle GoldenGate 11gR2: Real-Time, Transactional Database Replication     Moscone South, Left - S-027 Oracle GoldenGate Veridata and Adapters Moscone South, Right - S-242 Oracle Enterprise Manager Moscone South, Left - S-040 Keep tuned to our blog during the show for news and highlights from the Data Integration Solutions team. See you there.

    Read the article

  • Visual Studio 2010 Best Practices

    - by Etienne Tremblay
    I’d like to thank Packt for providing me with a review version of Visual Studio 2010 Best Practices eBook. In fairness I also know the author Peter having seen him speak at DevTeach on many occasions.  I started by looking at the table of content to see what this book was about, knowing that “best practices” is a real misnomer I wanted to see what they were.  I really like the fact that he starts the book by really saying they are not really best practices but actually recommend practices.  As a Team Foundation Server user I found that chapter 2 was more for the open source crowd and I really skimmed it.  The portion on Branching was well documented, although I’m not a fan of the testing branch myself, but the rest was right on. The section on merge remote changes (bring the outside to you) paradigm is really important and was touched on. Chapter 3 has good solid practices on low level constructs like generics and exceptions. Chapter 4 dives into architectural practices like decoupling, distributed architecture and data based architecture.  DTOs and ORMs are touched on briefly as is NoSQL. Chapter 5 is about deployment and is really a great primer on all the “packaging” technologies like Visual Studio Setup and Deployment (depreciated in 2012), Click Once and WIX the major player outside of commercial solutions.  This is a nice section on how to move from VSSD to WIX this is going to be important in the coming years due to the fact that VS 2012 doesn’t support VSSD. In chapter 6 we dive into automated testing practices, including test coverage, mocking, TDD, SpecDD and Continuous Testing.  Peter covers all those concepts really nicely albeit succinctly. Being a book on recommended practices I find this is really good. I really enjoyed chapter 7 that gave me a lot of great tips to enhance my Visual Studio “experience”.  Tips on organizing projects where good.  Also even though I knew about configurations I like that he put that in there so you can move all your settings to another machine, a lot of people don’t know about that. Quick find and Resharper are also briefly covered.  He touches on macros (depreciated in 2012).  Finally he touches on Continuous Integration a very important concept in today’s ALM landscape. Chapter 8 is all about Parallelization, threads, Async, division of labor, reactive extensions.  All those concepts are touched on and again generalized approaches to those modern problems are giving.       Chapter 9 goes into distributed apps, the most used and accepted practice in the industry for .NET projects the chapter tackles concepts like Scalability, Messaging and Cloud (the flavor of the month of distributed apps, although I think this will stick ;-)).  He also looks a protocols TCP/UDP and how to debug distributed apps.  He touches on logging and health monitoring. Chapter 10 tackles recommended practices for web services starting with implementing WCF services, which goes into all sort of goodness like how to host in IIS or self-host.  How to manual test WCF services, also a section on authentication and authorization.  ASP.NET Web services are also touched on in that chapter All in all a good read, nice tips and accepted practices.  I like the conciseness of the subjects and Peter touches on a lot of things in this book and uses a lot of the current technologies flavors to explain the concepts.   Cheers, ET

    Read the article

  • 2013 Predictions for Retail

    - by David Dorf
    Its that time of year to roll out the predictions for next year.  I can't say I've really nailed it in the past, but feel free to look back at my 2012, 2011, and 2010 predictions.  I'm not expecting anything earth-shattering this year; just continued maturation of several technologies that are finally taking hold. 1. Next day delivery -- Amazon finally decided it wasn't worth fighting state taxes and instead decided to place distribution centers everywhere so they can potentially offer next-day deliveries.  Not to be outdone, Walmart is looking to leverage its huge physical presence to offer the same.  Clubs like ShopRunner are pushing delivery barriers as well, so the norm is shifting to free shipping in a few days or relatively cheap shipping overnight.  Retailers need be thinking about how to ship from physical stores. 2. Bring your own device -- Earlier this year Intuit bought AisleBuyer, a mobile self-checkout start-up, at least somewhat validating the BYOD approach.  Grocery stores, especially in Europe, have been supporting in-aisle self-scanning for a while and I'm betting it will find a home in certain verticals in the US too.  There's also the BYOD concept for employees.  Some retailers are considering issuing mobile devices at hiring along side the shirt and name-tag.  Employees become responsible for the hardware until they leave. 3. TV shopping -- Will Apple finally release a TV product in 2013?  Who knows?  But the industry isn't standing still. Companies like QVC and HSN are already successfully combining the TV and online experiences for shopping.  Comcast is partnering with Tivo to allow viewers to interact with ads with Paypal handing payment.  This will be a slow maturation, but expect TVs to get smarter and eventually become a new selling channel (pun intended) for retailers. 4. Privacy backlash -- It only takes one big incident to stir the public, and I'm betting we have one in 2013.  Facebook, Google, or Apple will test the boundaries of what the public is willing to accept.  It could involve a retailer using geo-location technology, or possibly video analytics.  And as is always the case, the offender will apologize, temporarily remove the technology, and wait 2-3 years for it to be generally accepted.  Privacy is a moving target. 5. More NFC -- I've come to the conclusion that adoption of any banking technology is going to be slow.  It was slow for credit cards, ATMs, and online billpay so why should it be any different for NFC?  Maybe, just maybe the iPhone 5S will have an NFC chip, but we're not going to see mainstream uptake for years.  Next year we'll continue to see incremental improvements from Isis, Google, and Paypal and a plethora of new startups, but don't toss your magstripe cards just yet. 6. In-store location -- The technologies for tracking people inside stores is really improving.  Retailers can track people using video cameras, infrared, and by the WiFi radios in mobile phones.  We're getting closer to the point where accuracy could be a shelf-facing, which will help retailers understand how people shop, where they spend time, and what displays attract them.  Expect CPG companies to get involved and partner with retailers, since the data benefits both parties.  Consumers will benefit by being directed right to the products they seek.  (In 2013 ARTS is forming a workteam to develop new standards in this area.) 7. M&A -- Looking back at 2012 there were some really big deals involving IBM, Oracle, JDA, and NCR and I expect that trend will likely continue as vendors add assets to bolster their portfolios.  Many retailers are due for an IT transformation to support anywhere, anytime shoppers, and one-stop-vendors can minimize complexity and costs. Predictions from other sources: Independent Retailer Stores Magazine IDC Insights Mobile Commerce Daily

    Read the article

  • EPM 11.1.2.2.000 - released

    - by THE
    Normal 0 21 false false false DE X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman","serif";} Oracle’s EPM System Development Team is pleased to announce General Availability of Oracle Hyperion Enterprise Performance Management System release 11.1.2.2.  This release is available on the Oracle Software Delivery Cloud (  https://edelivery.oracle.com).  This is a localized release available in multiple languages. See "System Requirements and Supported Platforms for Oracle Enterprise Performance Management System 11.1.2.2" ( http://www.oracle.com/technetwork/middleware/ias/downloads/fusion-certification-100350.html)  for details.  In this release, EPM System products extend the new features and products offered with release 11.1.2.1. Please visit the product "New Features Guides" ( http://docs.oracle.com/cd/E17236_01/index.htm), available in the Enterprise Performance Management System Documentation Library for more information. Note: Oracle Hyperion Calculation Manager has replaced Oracle Hyperion Business Rules as the mechanism for designing and managing business rules, therefore, Business Rules is no longer released with EPM System Release 11.1.2.2. If you are applying 11.1.2.2 as a maintenance release, or upgrading to Release 11.1.2.2, and have been using Business Rules in an earlier release, you must migrate to Calculation Manager rules in Release 11.1.2.2. See Oracle Enterprise Performance Management System Installation and Configuration Guide. The EPM System Media pack on Oracle Software Delivery Cloud has been simplified.  Software downloads have been merged together. See the Media Pack Readme for a list of downloads needed for your domain/product. IBM WebSphere 7.0.0.19+ (AS, ND) is now supported as an application server.  Documentation about deploying to WebSphere is in the chapter titled “Deploying EPM System Products to WebSphere Application Server” in the Oracle Enterprise Performance Management System Installation and Configuration Guide. FireFox 10.x+ and Internet Explorer 9 are now supported Web browsers. Microsoft Office 2010 64 bit is now supported. Microsoft Windows Installer (MSI) Client Installers are now provided for Oracle Essbase Client, Oracle Essbase Administration Services Console, Oracle Essbase Studio Console, and Oracle Hyperion Financial Management Client. Online Help content for EPM System products is served from a central Oracle download location, which reduces the download and installation time for EPM System. You can also install and configure online Help to run locally. For more information, see the Oracle Enterprise Performance Management System Installation and Configuration Guide.  For more information on , please see the “Oracle Enterprise Performance Management System, Release 11.1.2.2.000 Readme ( http://docs.oracle.com/cd/E17236_01/epm.1112/epm_1112200_readme.pdf).

    Read the article

  • General Availability of Oracle E-Business Suite Plug-in 12.1.0.1.0

    - by user810030
    We are pleased to announce the General Availability of Oracle E-Business Suite Plug-in 12.1.0.1.0, an integral part of Application Management Suite for Oracle E-Business Suite. The combination of Enterprise Manager 12c Cloud Control and the Application Management Suite combines functionality that was available in the standalone Application Management Pack for Oracle E-Business Suite and Application Change Management Pack for Oracle E-Business Suite with Oracle’s Real User Experience Insight product and the Configuration & Compliance capabilities to provide the most complete solution for managing Oracle E-Business Suite applications. The features that were available in the standalone management packs are now packaged into the Oracle E-Business Suite Plug-in, which is now fully certified with Oracle Enterprise Manager 12c Cloud Control. This latest plug-in extends Cloud Control with E-Business Suite specific system management capabilities and features enhanced change management support. This new release offers the following key enhancements: General: Oracle Enterprise Manager 12c Base Platform uptake: All components of the management suite are certified with Oracle Enterprise Manager 12c Cloud Control. Security: Privilege Delegation: The Oracle E-Business Suite Plug-in now extends Enterprise Manager’s privilege delegation through Sudo and PowerBroker to Oracle E-Business Suite Plug-in host targets.  Privileges and Roles for Managing Oracle E-Business Suite: This release includes new ready-to-use target and resource privileges to monitor, manage, and perform Change Management functionality.  Cloning: Named Credentials Uptake in Cloning: The Clone module transactions now let users leverage the Named Credential feature introduced in Enterprise Manager 12c, thereby passing all the benefits of Named Credentials features in Enterprise Manager to the Oracle E-Business Suite Plug-in users.  Smart Clone improvements: The new and improved Smart Clone UI supports the adding of "pre and post" custom steps to a copy of the ready-to-use cloning deployment procedure. Now a user can pass parameters to the custom steps through the interview screen of the UI as well as pass ready-to-use parameters to the custom steps.  Change Management Enhancements Application Management Suite for Oracle E-Business Suite provides a centralized view to monitor and orchestrate changes (both functional and technical) across multiple Oracle E-Business Suite systems. In this latest release, it provides even more control and flexibility in managing Oracle E-Business Suite changes. Customization Manager: Support for longer file names: Customization Manager now handles file names up to thirty characters in length.  Patch Manager: Queuing of Patch Manager Runs: This feature allows patch runs to queue up if Patch Manager detects a specific target is in a blackout state.  Multi-node system patching: The patch run interview has been enhanced to allow Enterprise Manager Administrator to choose which nodes adpatch will run on.  New AD Administration Options: The patch run interview has been extended to include AD Administration Options "Relink Application Programs", "Generate Product Jars Files", "Generate Report Files", and "Generate Form Files".  Release Technical Details Product documentation for the plug-in is available on My Oracle Support as note 1434392.1.  The Oracle E-Business Suite Plug-in can be accessed in one of the following ways:  Fresh install  Enterprise Manager Store  Oracle Software Delivery Cloud Upgrades  Oracle Technology Network Please refer to the Application Management Pack for Oracle E-Business Suite Guide for further details.  Related Software Component Oracle Real User Experience Insight 12.1.0.0.1  Product documentation is available on Oracle Technology Network in the "Oracle Enterprise Manager 12c Release 1 (12.1) Documentation" set under the "Associated Document" tab. (http://docs.oracle.com/cd/E26370_01/index.htm)  Product may be downloaded individually from Oracle Technology Network software download page for Oracle Enterprise Manager under "Additional Enterprise Manager Downloads." (http://www.oracle.com/technetwork/oem/grid-control/downloads/index.html)  Product may also be downloaded individually from the Oracle Software Delivery Cloud. Select "Oracle Enterprise Manager" product pack, "Oracle Real User Experience Insight 12c Release 1 Media Pack for x8  Collateral Can be accessed on the Application Management Page on Oracle Technology Network

    Read the article

  • SQL SERVER – #TechEdIn – Presenting Tomorrow on Speed Up! – Parallel Processes and Unparalleled Performance at TechEd India 2012

    - by pinaldave
    Performance tuning is always a very hot topic when it is about SQL Server. SQL Server Performance Tuning is a very challenging subject that requires expertise in Database Administration and Database Development. I always have enjoyed talking about SQL Server Performance tuning subject. However, in India, it’s actually the very first time someone is presenting on this interesting subject, so this time I had the biggest challenge to present this session. Frequently enough, we get these two kind of questions: How to turn off parallelism as it is reducing performance? How to turn on parallelism as I want more performance? The reality is that not everyone knows what exactly is needed by their system. In this session, I have attempted to answer this very question. I’ve decided to provide a balanced view but stay away from theory, which leads us to say “It depends”. The session will have a clear message about this towards its end. Deck Details Slides: 45+ Demos: 7+ Bonus Quiz: 5 Images: 10+ Session delivery time: 52 Mins + 8 Mins of Q & A I have presented this session a couple of times to my friends and so far have received good feedback. Oftentimes, when people hear that I am going to present 45 slides, they all say it is too much to cover. However, when I am done with the session the usual reaction is that I truly gave justice to those slides. Action Item Here are a few of the action items for all of those who are going to attend this session: If you want to attend the session, just come early. There’s a good chance that you may not get a seat because right before me, there is a session from SQL Guru Vinod Kumar. He performs a powerful delivery of million concepts in just a little time. Quiz. I will be asking few questions during the session as well as before the session starts. If you get the correct answer, I will give unique learning material for you. You may not want to miss this learning opportunity at any cosst. Session Details Title: Speed Up! – Parallel Processes and Unparalleled Performance (Add to Calendar) Abstract: “More CPU, More Performance” – A  very common understanding is that usage of multiple CPUs can improve the performance of the query. To get a maximum performance out of any query, one has to master various aspects of the parallel processes. In this deep-dive session, we will explore this complex subject with a very simple interactive demo. Attendees will walk away with proper understanding of CX_PACKET wait types, MAXDOP, parallelism threshold and various other concepts. Date and Time: March 23, 2012, 12:15 to 13:15 Location: Hotel Lalit Ashok - Kumara Krupa High Grounds, Bengaluru – 560001, Karnataka, India. Add to Calendar Reference: Pinal Dave (http://blog.sqlauthority.com) Filed under: PostADay, SQL, SQL Authority, SQL Interview Questions and Answers, SQL Query, SQL Server, SQL Tips and Tricks, SQLServer, T SQL, Technology

    Read the article

  • "Why We Chose Fusion CRM" by Vikas Bhambri, Managing Partner, The Athene Group

    - by Natalia Rachelson
    Normal 0 false false false EN-US X-NONE X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin-top:0in; mso-para-margin-right:0in; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0in; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} A guest post by Vikas Bhambri, Managing Partner, The Athene Group This year The Athene Group (www.theathenegroup.com) celebrated our tenth anniversary. The company has accomplished a lot in ten years overcoming a number of hurdles and challenges to have grown organically to a 150+ person global company with offices in the US, UK, and India and customers in the US, Canada, and Europe. Now more than ever with the current global landscape from an economic and competitive standpoint it was vital that we make some changes to remain successful for the next ten years. There were two key initiatives that we discussed internally that would enable us to successfully accomplish this – collaboration and the concept of “insight to action”. With our existing Oracle CRM On Demand platform we had components of this but not the full depth and breadth that we were looking for. When we started to discuss Fusion CRM we immediately saw several next generation tools that would embrace these two objectives. For a consulting and development organization the collaboration required between business development and consulting delivery is as important as the collaboration required during the projects between the project delivery and account management teams. The Activity Streams functionality in Fusion CRM immediately addressed the communication of key discussion topics and exchanges around our clients. Of course when we saw the Oracle Social Network (which is part of our Fusion CRM roadmap) we were blown away. The combination OSN and our CRM is going to make us more effective as we discuss and work cohesively on client engagements – ensuring mutual success for both Athene and our clients. When we looked at “insight to action” we saw that we had a great platform when folks were at their desks, unfortunately a lot of our business development and consulting folks are on the road. The Fusion Mobile Sales and Fusion Outlook Desktop provide information to our teams when they are on the go. So that they can provide real-time information and react to real-time information provided by their peers. We are in the early stages of our transformative experience with Fusion CRM but we believe the platform along with our people and processes are going to help us achieve our goals in the future.

    Read the article

  • Visual Studio 2012 and .NET 4.5 now Live!

    - by Tarun Arora
    Today was the formal launch event for Visual Studio 2012 and .NET 4.5, a state-of-the-art development solution for building modern applications that span connected devices and continuous services, from the client to the cloud. The event was streamed live from http://visualstudiolaunch.com, S.Somasegar corporate vice president of the Developer Division opened the key note, Jason Zander dived deeper into how to leverage Visual Studio 2012 and .NET 4.5 to build modern application. Brian Harry all the awesome features in Visual Studio 2012 to improve the application lifecycle management.   I. Summary of the announcements made today 1. Visual Studio Updates coming this fall –  VS Update will better support agile teams, enable continuous quality, elevate SharePoint development with application lifecycle management (ALM) tools, and expand Visual Studio 2012 Windows development capabilities. It will be available as a community technology preview (CTP) later this month and in final release later this calendar year. A comprehensive list of what will be on offer can be found here. 2. Visual Studio Express 2012 for Windows Desktop – Visual Studio Express 2012 for Windows Desktop brings the newest desktop development capabilities in Visual Studio 2012 to Express users, too. You would be excited to know that the express SKU will support Integration with TFS among some of the other cool features I would like to mention Unit Testing, Unit Testing, Code Analysis, dependency management with NuGet a full list and download links can be found here. 3. F# tools for Visual Studio Express 2012 for web –  This F# Tools release adds in F# 3.0 components, such as the F# 3.0 compiler, F# Interactive, IDE support, and new F# features such as type providers and query expressions to your Visual Studio 2012 express for web. More details and download links can be found here. 4. Visual Studio TFS 2012 Power Tools – The TFS 2012 Power tools brings the goodness of Best Practice Analyzer, Process Template Editor, Storyboard Shapes, Team Explorer enhancements, TFPT command line, TFS Server Backups, etc via to your TFS 2012 installation. It can be downloaded right away from here. II. Road shows There will be many more community road shows this month packaged with hours of demos and discussions. The Visual Studio UK Team has just announced that there will be four UK launch events, face to face session including a product group speaker and partner sessions: Edinburgh, 1st October Manchester, 3rd October London, 4th October Reading, 5th October III. Get Started Download Visual Studio 2012 and the additional supporting software's from here. The Visual Studio development team has put together over 60 videos to help you learn about the new Visual Studio 2012 capabilities in more detail, and all of these will be available for watching here. IV. What’s Next A lot more exciting stuff lined up… Windows 8 Anticipated release: Oct. 26 (UPDATED 9/12) Windows Server 2012 Released (UPDATED 9/4) System Center 2012 Released (UPDATED 9/11) SQL Server 2012 Released (UPDATED 4/2) Internet Explorer 10 Anticipated release: Between Q3 2012 and early 2013 (UPDATED 5/3   Office 2013 Anticipated release: Q4 2012 or Q1 2013(UPDATED 9/12) Exchange 2013 Anticipated release: Q4 2012 (UPDATED 7/26) Visual Studio 2012 Released (UPDATED 9/12) Kinect for Windows Released (UPDATED 9/4) Windows Phone "Tango" and 8 "Tango": Released; Anticipated "Windows Phone 8" release: Q4 2012 (UPDATED 9/5) Dynamics ERP Online Anticipated release: September or October 2012 (UPDATED 7/20) Office 365 Anticipated update schedule: "Almost weekly"(UPDATED 9/12) Windows Azure Rumored CTP release: Spring 2012 (UPDATED 9/7) SharePoint 2013 Anticipated release: Q4 2012 (UPDATED 8/21) Enjoy

    Read the article

  • Customer Interaction Group (NL) becomes the first Oracle EMEA partner that Achieves OPN Specialization for Oracle RightNow CX Cloud Service

    - by Richard Lefebvre
    Oracle Recognizes Customer Interaction Group for Expertise in Oracle RightNow CX Cloud Service Customer Interaction Group, specialists in customer contact and a Gold level member of Oracle® PartnerNetwork (OPN), today announced it has achieved OPN Specialized status for Oracle RightNow CX Cloud Service. To achieve OPN Specialized status, Oracle partners are required to meet a stringent set of requirements that are based on the needs and priorities of the customer and partner community. By achieving a Specialized distinction, Customer Interaction Group has been recognized by Oracle for its expertise in delivering services specifically around Oracle RightNow CX Cloud Service through competency development, business results and proven success.   “As valued Oracle partner it is very important to us to achieve this specialization. With this recognition we guarantee our customers professionalism in each project, from advisory tasks to complex implementations. This allows Customer Interaction Group not only a deepening realization towards optimizing customer interaction, but also to service delivery through various media channels. As a result, our customers are able to service their customers on a higher level” says Hanjo Huizing, CEO of Customer Interaction Group. “Oracle congratulates The Customer Interaction Group with becoming specialized Oracle RightNow partner. Oracle’s Specialization Program is a trusted status and brand, which allows our most experienced and committed partners to differentiate themselves in the marketplace and gain a competitive edge by spotlighting their strengths and special skills” said Richard Lefebvre, head of the Oracle EMEA CRM&CX Partner Community. In today’s competitive markets, successful businesses can successfully stand out by offering their customers good customer service combined with excellent accessibility. Our mission is to help businesses configure and optimize the full range of customer contact. We have the knowledge, experience and tools to develop practical and innovative solutions for customer interaction processes. Our customers as fonq.nl (web department store) and CitizenM (hotels) are working successfully with Oracle RightNow CX Cloud Service. They both serve their customers not only in The Netherlands but also in a lot of countries in Europe. Our focus is on the delivery of excellent customer service at a lower cost. Our objective is to increase return on customer contact and to give customers a positive experience. About Customer Interaction Group Customer Interaction Group specializes in delivering and optimizing customer interaction solutions for voice, web, and social interactions. Armed with the knowledge, experience and solutions, they provide solutions and consulting services to companies seeking to deliver superior customer experiences. The core method and approach of Customer Interaction Group is to translate business problems and processes into practical interaction solutions. Based in Amsterdam, the Netherlands, The Customer Interaction Group serves customers all over Europe. Follow us on Twitter @CustIntGroup, Facebook.com/custintgroup, linkedin.com/company/customer-interaction-group or visit our website www.custintgroup.com About Oracle PartnerNetwork Oracle PartnerNetwork (OPN) Specialized is the latest version of Oracle's partner program that provides partners with tools to better develop, sell and implement Oracle solutions. OPN Specialized offers resources to train and support specialized knowledge of Oracle products and solutions and has evolved to recognize Oracle's growing product portfolio, partner base and business opportunity. Key to the latest enhancements to OPN is the ability for partners to differentiate through Specializations. Specializations are achieved through competency development, business results, expertise and proven success. To find out more visit http://www.oracle.com/partners.

    Read the article

  • Windows Azure Recipe: Consumer Portal

    - by Clint Edmonson
    Nearly every company on the internet has a web presence. Many are merely using theirs for informational purposes. More sophisticated portals allow customers to register their contact information and provide some level of interaction or customer support. But as our understanding of how consumers use the web increases, the more progressive companies are taking advantage of social web and rich media delivery to connect at a deeper level with the consumers of their goods and services. Drivers Cost reduction Scalability Global distribution Time to market Solution Here’s a sketch of how a Windows Azure Consumer Portal might be built out: Ingredients Web Role – this will host the core of the solution. Each web role is a virtual machine hosting an application written in ASP.NET (or optionally php, or node.js). The number of web roles can be scaled up or down as needed to handle peak and non-peak traffic loads. Database – every modern web application needs to store data. SQL Azure databases look and act exactly like their on-premise siblings but are fault tolerant and have data redundancy built in. Access Control (optional) – if identity needs to be tracked within the solution, the access control service combined with the Windows Identity Foundation framework provides out-of-the-box support for several social media platforms including Windows LiveID, Google, Yahoo!, Facebook. It also has a provider model to allow integration with other platforms as well. Caching (optional) – for sites with high traffic with lots of read-only data and lists, the distributed in-memory caching service can be used to cache and serve up static data at higher scale and speed than direct database requests. It can also be used to manage user session state. Blob Storage (optional) – for sites that serve up unstructured data such as documents, video, audio, device drivers, and more. The data is highly available and stored redundantly across data centers. Each entry in blob storage is provided with it’s own unique URL for direct access by the browser. Content Delivery Network (CDN) (optional) – for sites that service users around the globe, the CDN is an extension to blob storage that, when enabled, will automatically cache frequently accessed blobs and static site content at edge data centers around the world. The data can be delivered statically or streamed in the case of rich media content. Training Labs These links point to online Windows Azure training labs where you can learn more about the individual ingredients described above. (Note: The entire Windows Azure Training Kit can also be downloaded for offline use.) Windows Azure (16 labs) Windows Azure is an internet-scale cloud computing and services platform hosted in Microsoft data centers, which provides an operating system and a set of developer services which can be used individually or together. It gives developers the choice to build web applications; applications running on connected devices, PCs, or servers; or hybrid solutions offering the best of both worlds. New or enhanced applications can be built using existing skills with the Visual Studio development environment and the .NET Framework. With its standards-based and interoperable approach, the services platform supports multiple internet protocols, including HTTP, REST, SOAP, and plain XML SQL Azure (7 labs) Microsoft SQL Azure delivers on the Microsoft Data Platform vision of extending the SQL Server capabilities to the cloud as web-based services, enabling you to store structured, semi-structured, and unstructured data. Windows Azure Services (9 labs) As applications collaborate across organizational boundaries, ensuring secure transactions across disparate security domains is crucial but difficult to implement. Windows Azure Services provides hosted authentication and access control using powerful, secure, standards-based infrastructure. See my Windows Azure Resource Guide for more guidance on how to get started, including links web portals, training kits, samples, and blogs related to Windows Azure.

    Read the article

  • Updated SOA Documents now available in ITSO Reference Library

    - by Bob Rhubart
    Nine documents within the IT Strategies from Oracle (ITSO) reference library have recently been updated. (Access to the ITSO collection is free to registered Oracle.com members -- and that membership is free.) All nine documents fall within the Service Oriented Architecture section of the ITSO collection, and cover the following topics: SOA Practitioner Guides Creating an SOA Roadmap (PDF, 54 pages, published: February 2012) The secret to successful SOA is to build a roadmap that can be successfully executed. SOA offers an opportunity to adopt an iterative technique to deliver solutions incrementally. This document offers a structured, iterative methodology to help you stay focused on business results, mitigate technology and organizational risk, and deliver successful SOA projects. A Framework for SOA Governance (PDF, 58 pages, published: February 2012) Successful SOA requires a strong governance strategy that designs-in measurement, management, and enforcement procedures. Enterprise SOA adoption introduces new assets, processes, technologies, standards, roles, etc. which require application of appropriate governance policies and procedures. This document offers a framework for defining and building a proper SOA governance model. Determining ROI of SOA through Reuse (PDF, 28 pages, published: February 2012) SOA offers the opportunity to save millions of dollars annually through reuse. Sharing common services intuitively reduces workload, increases developer productivity, and decreases maintenance costs. This document provides an approach for estimating the reuse value of the various software assets contained in a typical portfolio. Identifying and Discovering Services (PDF, 64 pages, published: March 2012) What services should we build? How can we promote the reuse of existing services? A sound approach to answer these questions is a primary measure for the success of a SOA initiative. This document describes a pragmatic approach for collecting the necessary information for identifying proper services and facilitating service reuse. Software Engineering in an SOA Environment (PDF, 66 pages, published: March 2012) Traditional software delivery methods are too narrowly focused and need to be adjusted to enable SOA. This document describes an engineering approach for delivering projects within an SOA environment. It identifies the unique software engineering challenges faced by enterprises adopting SOA and provides a framework to remove the hurdles and improve the efficiency of the SOA initiative. SOA Reference Architectures SOA Foundation (PDF, 70 pages, published: February 2012) This document describes they key tenets for SOA design, development, and execution environments. Topics include: service definition, service layering, service types, the service model, composite applications, invocation patterns, and standards. SOA Infrastructure (PDF, 86 pages, published: February 2012) Properly architected, SOA provides a robust and manageable infrastructure that enables faster solution delivery. This document describes the role of infrastructure and its capabilities. Topics include: logical architecture, deployment views, and Oracle product mapping. SOA White Papers and Data Sheets Oracle's Approach to SOA (white paper) (PDF, 14 pages, published: February 2012) Oracle has developed a pragmatic, holistic approach, based on years of experience with numerous companies to help customers successfully adopt SOA and realize measureable business benefits. This executive datasheet and whitepaper describe Oracle's proven approach to SOA. Oracle's Approach to SOA (data sheet) (PDF, 3 pages, published: March 2012) SOA adoption is complex and success is far from assured. This is why Oracle has developed a pragmatic, holistic approach, based on years of experience with numerous companies, to help customers successfully adopt SOA and realize measurable business benefits. This data sheet provides an executive overview of Oracle's proven approach to SOA.

    Read the article

  • Mastering snow and Java development at jDays in Gothenburg

    - by JavaCecilia
    Last weekend, I took the train from Stockholm to Gothenburg to attend and present at the new Java developer conference jDays. It was professionally arranged in the Swedish exhibition hall close to the amusement park Liseberg and we got a great deal out of the top-level presenters and hallway discussions. Understanding and Improving Your Java Process Our main purpose was to spread information on JVM and our monitoring tools for Java processes, so I held a crash course in the most important terms and concepts if you want to affect the performance of your Java process. From the beginning - the JVM specification to interpretation of heap usage graphs. For correct analysis, you also need to understand something about process memory - you need space for the Java heap (-Xms for initial size and -Xmx for max heap size), but the process memory also contain the thread stacks (to a size of -Xss), JVM internal data structures used for keeping track of Java objects on the heap, method compilation/optimization, native libraries, etc. If you get long pause times, make sure to monitor your application, see the allocation rate and frequency of pause times.My colleague Klara Ward then held a presentation on the Java Mission Control product, the profiling and diagnostics tools suite for HotSpot, coming soon. The room was packed and very appreciated, Klara demonstrated four different scenarios, e.g. how to diagnose and fix latencies due to lock contention for logging.My German colleague, OpenJDK ambassador Dalibor Topic travelled to Sweden to do the second keynote on "Make the Future Java". He let us in on the coming features and roadmaps of Java, now delivering major versions on a two-year schedule (Java 7 2011, Java 8 2013, etc). Also letting us in on where to download early versions of 8, to report problems early on. Software Development in teams Being a scout leader, I'm drilled in different team building and workshop techniques, creating strong groups - of course, I had to attend Henrik Berglund's session on building successful teams. He spoke about the importance of clear goals, autonomy and agreed processes. Thomas Sundberg ended the conference by doing live remote pair programming with Alex in Rumania and a concrete tips for people wanting to try it out (for local collaboration, remember to wash and change clothes). Memory Master Keynote The conference keynote was delivered by the Swedish memory master Mattias Ribbing, showing off by remembering the order of a deck of cards he'd seen once. He made it interactive by forcing the audience to learn a memory mastering technique of remembering ten ordered things by heart, asking us to shout out the order backwards and we made it! I desperately need this - bought the book, will get back on the subject. Continuous Delivery The most impressive presenter was Axel Fontaine on Continuous Delivery. Very well prepared slides with key images of his message and moved about the stage like a rock star. The topic is of course highly interesting, how to create an infrastructure enabling immediate feedback to developers and ability to release your product several times per day. Tomek Kaczanowski delivered a funny and useful presentation on good and bad tests, providing comic relief with poorly written tests and the useful rules of thumb how to rewrite them. To conclude, we had a great time and hope to see you at jDays next year :)

    Read the article

  • What is a good design pattern / lib for iOS 5 to synchronize with a web service?

    - by Junto
    We are developing an iOS application that needs to synchronize with a remote server using web services. The existing web services have an "operations" style rather than REST (implemented in WCF but exposing JSON HTTP endpoints). We are unsure of how to structure the web services to best fit with iOS and would love some advice. We are also interested in how to manage the synchronization process within iOS. Without going into detailed specifics, the application allows the user to estimate repair costs at a remote site. These costs are broken down by room and item. If the user has an internet connection this data can be sent back to the server. Multiple photographs can be taken of each item, but they will be held in a separate queue, which sends when the connection is optimal (ideally wifi). Our backend application controls the unique ids for each room and item. Thus, each time we send these costs to the server, the server echoes the central database ids back, thus, that they can be synchronized in the mobile app. I have simplified this a little, since the operations contract is actually much larger, but I just want to illustrate the basic requirements without complicating matters. Firstly, the web service architecture: We currently have two operations: GetCosts and UpdateCosts. My assumption is that if we used a strict REST architecture we would need to break our single web service operations into multiple smaller services. This would make the services much more chatty and we would also have to guarantee a delivery order from the app. For example, we need to make sure that containing rooms are added before the item. Although this seems much more RESTful, our perception is that these extra calls are expensive connections (security checks, database calls, etc). Does the type of web api (operation over service focus) determine chunky vs chatty? Since this is mobile (3G), are we better handling lots of smaller messages, or a few large ones? Secondly, the iOS side. What is the current advice on how to manage data synchronization within the iOS (5) app itself. We need multiple queues and we need to guarantee delivery order in each queue (and technically, ordering between queues). The server needs to control unique ids and other properties and echo them back to the application. The application then needs to update an internal database and when re-updating, make sure the correct ids are available in the update message (essentially multiple inserts and updates in one call). Our backend has a ton of business logic operating on these cost estimates. We don't want any of this in the app itself. Currently the iOS app sends the cost data, and then the server echoes that data back with populated ids (and other data). The existing cost data is deleted and the echoed response data is added to the client database on the device. This is causing us problems, because any photos might not have been sent, but the original entity tree has been removed and replaced. Obviously updating the costs tree rather than replacing it would remove this problem, but I'm not sure if there are any nice xcode libraries out there to do such things. I welcome any advice you might have.

    Read the article

  • Localize WiX installer which uses the Firewall extension

    - by tronda
    I've got a WiX installer project which uses MSBuild to generate the MSI file. The WXS file includes the WiX firewall extension: xmlns:fire="http://schemas.microsoft.com/wix/FirewallExtension" I've defined two cultures in the MSBuild file with the following definition: <PropertyGroup> ... <Cultures>en-us;no-no</Cultures> </PropertyGroup> I've also added the translated resources: <ItemGroup> <EmbeddedResource Include="lang\Firewall_no-no.wxl" /> <EmbeddedResource Include="lang\WixUI_no-no.wxl" /> </ItemGroup> These represents translation to Norwegian for the Firewall extension and the WixUI extension. When I run the build it succeeds with the en-us part, but the no-no part fails with the following error messages: C:\delivery\Dev\wix30_public\src\ext\FirewallExtension\wixlib\FirewallExtension.wxs(19): error LGHT0102: The localization variable !(loc.WixSchedFirewallExceptionsInstall) is unknown. Please ensure the variable is defined. .... Couple of issues: I don't know where the C:\delivery directory comes from. I don't have such a directory. The localization variables referenced in the error message have been translated in the Firewall_no-no.wxl file. When I run MSBuild with more detailed information I see the following output right before the error message: Task "Light" Command: C:\Program Files (x86)\Windows Installer XML v3\bin\Light.exe -cultures:no-no -ext "C:\Program Files (x86)\Windows Installer XML v3\bin\WixUIExtension.dll" -ext "C:\Program Files (x86)\Windows I nstaller XML v3\bin\WixUtilExtension.dll" -ext "C:\Program Files (x86)\Windows Installer XML v3\bin\WixFirewallExtension.dll" -loc lang\Firewall_no-no.wxl -loc lang\WixUI_no-no.wxl -out F:\Projects\MyProd\MyProj\Installer\bin\Debug\no-no\MyInstaller.msi -pdbout F:\Projects\MyProd\MyProj\Installer\bin\Debug\no-no\MyInstaller.wixpdb obj\Debug\MyProj.wixobj As the details show, the MSBuild task results in having two -loc parameters to the Light executable. Not sure if that would be the reason for this problem. Any ideas on how to solve this?

    Read the article

  • Find the "largest" dense sub matrix in a large sparse matrix

    - by BCS
    Given a large sparse matrix (say 10k+ by 1M+) I need to find a subset, not necessarily continuous, of the rows and columns that form a dense matrix (all non-zero elements). I want this sub matrix to be as large as possible (not the largest sum, but the largest number of elements) within some aspect ratio constraints. Are there any known exact or aproxamate solutions to this problem? A quick scan on Google seems to give a lot of close-but-not-exactly results. What terms should I be looking for? edit: Just to clarify; the sub matrix need not be continuous. In fact the row and column order is completely arbitrary so adjacency is completely irrelevant. A thought based on Chad Okere's idea Order the rows from largest count to smallest count (not necessary but might help perf) Select two rows that have a "large" overlap Add all other rows that won't reduce the overlap Record that set Add whatever row reduces the overlap by the least Repeat at #3 until the result gets to small Start over at #2 with a different starting pair Continue until you decide the result is good enough

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Timer a usage in msp430 in high compiler optimization mode

    - by Vishal
    Hi, I have used timer A in MSP430 with high compiler optimization, but found that my timer code is failing when high compiler optimization used. When none optimization is used code works fine. This code is used to achieve 1 ms timer tick. timeOutCNT is increamented in interrupt. Following is the code, //Disable interrupt and clear CCR0 TIMER_A_TACTL = TIMER_A_TASSEL | // set the clock source as SMCLK TIMER_A_ID | // set the divider to 8 TACLR | // clear the timer MC_1; // continuous mode TIMER_A_TACTL &= ~TIMER_A_TAIE; // timer interrupt disabled TIMER_A_TACTL &= 0; // timer interrupt flag disabled CCTL0 = CCIE; // CCR0 interrupt enabled CCR0 = 500; TIMER_A_TACTL &= TIMER_A_TAIE; //enable timer interrupt TIMER_A_TACTL &= TIMER_A_TAIFG; //enable timer interrupt TACTL = TIMER_A_TASSEL + MC_1 + ID_3; // SMCLK, upmode timeOutCNT = 0; //timeOutCNT is increased in timer interrupt while(timeOutCNT <= 1); //delay of 1 milisecond TIMER_A_TACTL = TIMER_A_TASSEL | // set the clock source as SMCLK TIMER_A_ID | // set the divider to 8 TACLR | // clear the timer MC_1; // continuous mode TIMER_A_TACTL &= ~TIMER_A_TAIE; // timer interrupt disabled TIMER_A_TACTL &= 0x00; // timer interrupt flag disabled Can anybody help me here to resolve this issue? Is there any other way we can use timer A so it works fine in optimization modes? Or do I have used is wrongly to achieve 1 ms interrupt? Thanks in advanced. Vishal N

    Read the article

  • My timer code is failing when IAR is configured to do max optimization

    - by Vishal
    Hi, I have used timer A in MSP430 with high compiler optimization, but found that my timer code is failing when high compiler optimization used. When none optimization is used code works fine. This code is used to achieve 1 ms timer tick. timeOutCNT is increamented in interrupt. Following is the code [Code] //Disable interrupt and clear CCR0 TIMER_A_TACTL = TIMER_A_TASSEL | // set the clock source as SMCLK TIMER_A_ID | // set the divider to 8 TACLR | // clear the timer MC_1; // continuous mode TIMER_A_TACTL &= ~TIMER_A_TAIE; // timer interrupt disabled TIMER_A_TACTL &= 0; // timer interrupt flag disabled CCTL0 = CCIE; // CCR0 interrupt enabled CCR0 = 500; TIMER_A_TACTL &= TIMER_A_TAIE; //enable timer interrupt TIMER_A_TACTL &= TIMER_A_TAIFG; //enable timer interrupt TACTL = TIMER_A_TASSEL + MC_1 + ID_3; // SMCLK, upmode timeOutCNT = 0; //timeOutCNT is increased in timer interrupt while(timeOutCNT <= 1); //delay of 1 milisecond TIMER_A_TACTL = TIMER_A_TASSEL | // set the clock source as SMCLK TIMER_A_ID | // set the divider to 8 TACLR | // clear the timer MC_1; // continuous mode TIMER_A_TACTL &= ~TIMER_A_TAIE; // timer interrupt disabled TIMER_A_TACTL &= 0x00; // timer interrupt flag disabled [/code] Can anybody help me here to resolve this issue? Is there any other way we can use timer A so it works fine in optimization modes? Or do I have used is wrongly to achieve 1 ms interrupt? Thanks in advanced. Vishal N

    Read the article

  • What guidelines should be followed when using an unstable/testing/stable branching scheme?

    - by Elliot
    My team is currently using feature branches while doing development. For each user story in our sprint, we create a branch and work it in isolation. Hence, according to Martin Fowler, we practice Continuous Building, not Continuous Integration. I am interested in promoting an unstable/testing/stable scheme, similar to that of Debian, so that code is promoted from unstable = testing = stable. Our definition of done, I'd recommend, is when unit tests pass (TDD always), minimal documentation is complete, automated functional tests pass, and feature has been demo'd and accepted by PO. Once accepted by the PO, the story will be merged into the testing branch. Our test developers spend most of their time in this branch banging on the software and continuously running our automated tests. This scares me, however, because commits from another incomplete story may now make it into the testing branch. Perhaps I'm missing something because this seems like an undesired consequence. So, if moving to a code promotion strategy to solve our problems with feature branches, what strategy/guidelines do you recommend? Thanks.

    Read the article

  • The Benefits of Smart Grid Business Software

    - by Sylvie MacKenzie, PMP
    Smart Grid Background What Are Smart Grids?Smart Grids use computer hardware and software, sensors, controls, and telecommunications equipment and services to: Link customers to information that helps them manage consumption and use electricity wisely. Enable customers to respond to utility notices in ways that help minimize the duration of overloads, bottlenecks, and outages. Provide utilities with information that helps them improve performance and control costs. What Is Driving Smart Grid Development? Environmental ImpactSmart Grid development is picking up speed because of the widespread interest in reducing the negative impact that energy use has on the environment. Smart Grids use technology to drive efficiencies in transmission, distribution, and consumption. As a result, utilities can serve customers’ power needs with fewer generating plants, fewer transmission and distribution assets,and lower overall generation. With the possible exception of wind farm sprawl, landscape preservation is one obvious benefit. And because most generation today results in greenhouse gas emissions, Smart Grids reduce air pollution and the potential for global climate change.Smart Grids also more easily accommodate the technical difficulties of integrating intermittent renewable resources like wind and solar into the grid, providing further greenhouse gas reductions. CostsThe ability to defer the cost of plant and grid expansion is a major benefit to both utilities and customers. Utilities do not need to use as many internal resources for traditional infrastructure project planning and management. Large T&D infrastructure expansion costs are not passed on to customers.Smart Grids will not eliminate capital expansion, of course. Transmission corridors to connect renewable generation with customers will require major near-term expenditures. Additionally, in the future, electricity to satisfy the needs of population growth and additional applications will exceed the capacity reductions available through the Smart Grid. At that point, expansion will resume—but with greater overall T&D efficiency based on demand response, load control, and many other Smart Grid technologies and business processes. Energy efficiency is a second area of Smart Grid cost saving of particular relevance to customers. The timely and detailed information Smart Grids provide encourages customers to limit waste, adopt energy-efficient building codes and standards, and invest in energy efficient appliances. Efficiency may or may not lower customer bills because customer efficiency savings may be offset by higher costs in generation fuels or carbon taxes. It is clear, however, that bills will be lower with efficiency than without it. Utility Operations Smart Grids can serve as the central focus of utility initiatives to improve business processes. Many utilities have long “wish lists” of projects and applications they would like to fund in order to improve customer service or ease staff’s burden of repetitious work, but they have difficulty cost-justifying the changes, especially in the short term. Adding Smart Grid benefits to the cost/benefit analysis frequently tips the scales in favor of the change and can also significantly reduce payback periods.Mobile workforce applications and asset management applications work together to deploy assets and then to maintain, repair, and replace them. Many additional benefits result—for instance, increased productivity and fuel savings from better routing. Similarly, customer portals that provide customers with near-real-time information can also encourage online payments, thus lowering billing costs. Utilities can and should include these cost and service improvements in the list of Smart Grid benefits. What Is Smart Grid Business Software? Smart Grid business software gathers data from a Smart Grid and uses it improve a utility’s business processes. Smart Grid business software also helps utilities provide relevant information to customers who can then use it to reduce their own consumption and improve their environmental profiles. Smart Grid Business Software Minimizes the Impact of Peak Demand Utilities must size their assets to accommodate their highest peak demand. The higher the peak rises above base demand: The more assets a utility must build that are used only for brief periods—an inefficient use of capital. The higher the utility’s risk profile rises given the uncertainties surrounding the time needed for permitting, building, and recouping costs. The higher the costs for utilities to purchase supply, because generators can charge more for contracts and spot supply during high-demand periods. Smart Grids enable a variety of programs that reduce peak demand, including: Time-of-use pricing and critical peak pricing—programs that charge customers more when they consume electricity during peak periods. Pilot projects indicate that these programs are successful in flattening peaks, thus ensuring better use of existing T&D and generation assets. Direct load control, which lets utilities reduce or eliminate electricity flow to customer equipment (such as air conditioners). Contracts govern the terms and conditions of these turn-offs. Indirect load control, which signals customers to reduce the use of on-premises equipment for contractually agreed-on time periods. Smart Grid business software enables utilities to impose penalties on customers who do not comply with their contracts. Smart Grids also help utilities manage peaks with existing assets by enabling: Real-time asset monitoring and control. In this application, advanced sensors safely enable dynamic capacity load limits, ensuring that all grid assets can be used to their maximum capacity during peak demand periods. Real-time asset monitoring and control applications also detect the location of excessive losses and pinpoint need for mitigation and asset replacements. As a result, utilities reduce outage risk and guard against excess capacity or “over-build”. Better peak demand analysis. As a result: Distribution planners can better size equipment (e.g. transformers) to avoid over-building. Operations engineers can identify and resolve bottlenecks and other inefficiencies that may cause or exacerbate peaks. As above, the result is a reduction in the tendency to over-build. Supply managers can more closely match procurement with delivery. As a result, they can fine-tune supply portfolios, reducing the tendency to over-contract for peak supply and reducing the need to resort to spot market purchases during high peaks. Smart Grids can help lower the cost of remaining peaks by: Standardizing interconnections for new distributed resources (such as electricity storage devices). Placing the interconnections where needed to support anticipated grid congestion. Smart Grid Business Software Lowers the Cost of Field Services By processing Smart Grid data through their business software, utilities can reduce such field costs as: Vegetation management. Smart Grids can pinpoint momentary interruptions and tree-caused outages. Spatial mash-up tools leverage GIS models of tree growth for targeted vegetation management. This reduces the cost of unnecessary tree trimming. Service vehicle fuel. Many utility service calls are “false alarms.” Checking meter status before dispatching crews prevents many unnecessary “truck rolls.” Similarly, crews use far less fuel when Smart Grid sensors can pinpoint a problem and mobile workforce applications can then route them directly to it. Smart Grid Business Software Ensures Regulatory Compliance Smart Grids can ensure compliance with private contracts and with regional, national, or international requirements by: Monitoring fulfillment of contract terms. Utilities can use one-hour interval meters to ensure that interruptible (“non-core”) customers actually reduce or eliminate deliveries as required. They can use the information to levy fines against contract violators. Monitoring regulations imposed on customers, such as maximum use during specific time periods. Using accurate time-stamped event history derived from intelligent devices distributed throughout the smart grid to monitor and report reliability statistics and risk compliance. Automating business processes and activities that ensure compliance with security and reliability measures (e.g. NERC-CIP 2-9). Grid Business Software Strengthens Utilities’ Connection to Customers While Reducing Customer Service Costs During outages, Smart Grid business software can: Identify outages more quickly. Software uses sensors to pinpoint outages and nested outage locations. They also permit utilities to ensure outage resolution at every meter location. Size outages more accurately, permitting utilities to dispatch crews that have the skills needed, in appropriate numbers. Provide updates on outage location and expected duration. This information helps call centers inform customers about the timing of service restoration. Smart Grids also facilitates display of outage maps for customer and public-service use. Smart Grids can significantly reduce the cost to: Connect and disconnect customers. Meters capable of remote disconnect can virtually eliminate the costs of field crews and vehicles previously required to change service from the old to the new residents of a metered property or disconnect customers for nonpayment. Resolve reports of voltage fluctuation. Smart Grids gather and report voltage and power quality data from meters and grid sensors, enabling utilities to pinpoint reported problems or resolve them before customers complain. Detect and resolve non-technical losses (e.g. theft). Smart Grids can identify illegal attempts to reconnect meters or to use electricity in supposedly vacant premises. They can also detect theft by comparing flows through delivery assets with billed consumption. Smart Grids also facilitate outreach to customers. By monitoring and analyzing consumption over time, utilities can: Identify customers with unusually high usage and contact them before they receive a bill. They can also suggest conservation techniques that might help to limit consumption. This can head off “high bill” complaints to the contact center. Note that such “high usage” or “additional charges apply because you are out of range” notices—frequently via text messaging—are already common among mobile phone providers. Help customers identify appropriate bill payment alternatives (budget billing, prepayment, etc.). Help customers find and reduce causes of over-consumption. There’s no waiting for bills in the mail before they even understand there is a problem. Utilities benefit not just through improved customer relations but also through limiting the size of bills from customers who might struggle to pay them. Where permitted, Smart Grids can open the doors to such new utility service offerings as: Monitoring properties. Landlords reduce costs of vacant properties when utilities notify them of unexpected energy or water consumption. Utilities can perform similar services for owners of vacation properties or the adult children of aging parents. Monitoring equipment. Power-use patterns can reveal a need for equipment maintenance. Smart Grids permit utilities to alert owners or managers to a need for maintenance or replacement. Facilitating home and small-business networks. Smart Grids can provide a gateway to equipment networks that automate control or let owners access equipment remotely. They also facilitate net metering, offering some utilities a path toward involvement in small-scale solar or wind generation. Prepayment plans that do not need special meters. Smart Grid Business Software Helps Customers Control Energy Costs There is no end to the ways Smart Grids help both small and large customers control energy costs. For instance: Multi-premises customers appreciate having all meters read on the same day so that they can more easily compare consumption at various sites. Customers in competitive regions can match their consumption profile (detailed via Smart Grid data) with specific offerings from competitive suppliers. Customers seeing inexplicable consumption patterns and power quality problems may investigate further. The result can be discovery of electrical problems that can be resolved through rewiring or maintenance—before more serious fires or accidents happen. Smart Grid Business Software Facilitates Use of Renewables Generation from wind and solar resources is a popular alternative to fossil fuel generation, which emits greenhouse gases. Wind and solar generation may also increase energy security in regions that currently import fossil fuel for use in generation. Utilities face many technical issues as they attempt to integrate intermittent resource generation into traditional grids, which traditionally handle only fully dispatchable generation. Smart Grid business software helps solves many of these issues by: Detecting sudden drops in production from renewables-generated electricity (wind and solar) and automatically triggering electricity storage and smart appliance response to compensate as needed. Supporting industry-standard distributed generation interconnection processes to reduce interconnection costs and avoid adding renewable supplies to locations already subject to grid congestion. Facilitating modeling and monitoring of locally generated supply from renewables and thus helping to maximize their use. Increasing the efficiency of “net metering” (through which utilities can use electricity generated by customers) by: Providing data for analysis. Integrating the production and consumption aspects of customer accounts. During non-peak periods, such techniques enable utilities to increase the percent of renewable generation in their supply mix. During peak periods, Smart Grid business software controls circuit reconfiguration to maximize available capacity. Conclusion Utility missions are changing. Yesterday, they focused on delivery of reasonably priced energy and water. Tomorrow, their missions will expand to encompass sustainable use and environmental improvement.Smart Grids are key to helping utilities achieve this expanded mission. But they come at a relatively high price. Utilities will need to invest heavily in new hardware, software, business process development, and staff training. Customer investments in home area networks and smart appliances will be large. Learning to change the energy and water consumption habits of a lifetime could ultimately prove even more formidable tasks.Smart Grid business software can ease the cost and difficulties inherent in a needed transition to a more flexible, reliable, responsive electricity grid. Justifying its implementation, however, requires a full understanding of the benefits it brings—benefits that can ultimately help customers, utilities, communities, and the world address global issues like energy security and climate change while minimizing costs and maximizing customer convenience. This white paper is available for download here. For further information about Oracle's Primavera Solutions for Utilities, please read our Utilities e-book.

    Read the article

  • Project Management Helps AmeriCares Deliver International Aid

    - by Sylvie MacKenzie, PMP
    Excerpt from PROFIT - ORACLE - by Alison Weiss Handle with Care Sound project management helps AmeriCares bring international aid to those in need. The stakes are always high for AmeriCares. On a mission to restore health and save lives during times of disaster, the nonprofit international relief and humanitarian aid organization delivers donated medicines, medical supplies, and humanitarian aid to people in the U.S. and around the globe. Founded in 1982 with the express mission of responding as quickly and efficiently as possible to help people in need, the Stamford, Connecticut-based AmeriCares has delivered more than US$10.5 billion in aid to 147 countries over the past three decades. Launch the Slideshow “It’s critically important to us that we steward all the donations and that the medical supplies and medicines get to people as quickly as possible with no loss,” says Kate Sears, senior vice president for finance and technology at AmeriCares. “Whether we’re shipping IV solutions to victims of cholera in Haiti or antibiotics to Somali famine victims, we need to get the medicines there sooner because it means more people will be helped and lives improved or even saved.” Ten years ago, the tracking systems used by AmeriCares associates were paper-based. In recent years, staff started using spreadsheets, but the tracking processes were not standardized between teams. “Every team was tracking completely different information,” says Megan McDermott, senior associate, Sub-Saharan Africa partnerships, at AmeriCares. “It was just a few key things. For example, we tracked the date a shipment was supposed to arrive and the date we got reports from our partner that a hospital received aid on their end.” While the data was accurate, much detail was being lost in the process. AmeriCares management knew it could do a better job of tracking this enterprise data and in 2011 took a significant step by implementing Oracle’s Primavera P6 Professional Project Management. “It’s a comprehensive solution that has helped us improve the monitoring and controlling processes. It has allowed us to do our distribution better,” says Sears. In addition, the implementation effort has been a change agent, helping AmeriCares leadership rethink project management across the entire organization. Initially, much of the focus was on standardizing processes, but staff members also learned the importance of thinking proactively to prevent possible problems and evaluating results to determine if goals and objectives are truly being met. Such data about process efficiency and overall results is critical not only to AmeriCares staff but also to the donors supporting the organization’s life-saving missions. Efficiency Saves Lives One of AmeriCares’ core operations is to gather product donations from the private sector, establish where the most-urgent needs are, and solicit monetary support to send the aid via ocean cargo or airlift to welfare- and health-oriented nongovernmental organizations, hospitals, health networks, and government ministries based in areas in need. In 2011 alone, AmeriCares sent more than 3,500 shipments to 95 countries in response to both ongoing humanitarian needs and more than two dozen emergencies, including deadly tornadoes and storms in the U.S. and the devastating tsunami in Japan. When it comes to nonprofits in general, donors want to know that the charitable organizations they support are using funds wisely. Typically, nonprofits are evaluated by donors in terms of efficiency, an area where AmeriCares has an excellent reputation: 98 percent of expenses go directly to supporting programs and less than 2 percent represent administrative and fundraising costs. Donors, however, should look at more than simple efficiency, says Peter York, senior partner and chief research and learning officer at TCC Group, a nonprofit consultancy headquartered in New York, New York. They should also look at whether organizations have the systems in place to sustain their missions and continue to thrive. An expert on nonprofit organizational management, York has spent years studying sustainable charitable organizations. He defines them as nonprofits that are able to achieve the ongoing financial support to stay relevant and continue doing core mission work. In his analysis of well over 2,500 larger nonprofits, York has found that many are not sustaining, and are actually scaling back in size. “One of the biggest challenges of nonprofit sustainability is the general public’s perception that every dollar donated has to go only to the delivery of service,” says York. “What our data shows is that there are some fundamental capacities that have to be there in order for organizations to sustain and grow.” York’s research highlights the importance of data-driven leadership at successful nonprofits. “You’ve got to have the tools, the systems, and the technologies to get objective information on what you do, the people you serve, and the results you’re achieving,” says York. “If leaders don’t have the knowledge and the data, they can’t make the strategic decisions about programs to take organizations to the next level.” Historically, AmeriCares associates have used time-tested and cost-effective strategies to ship and then track supplies from donation to delivery to their destinations in designated time frames. When disaster strikes, AmeriCares ships by air and generally pulls out all the stops to deliver the most urgently needed aid within the first few days and weeks. Then, as situations stabilize, AmeriCares turns to delivering sea containers for the postemergency and ongoing aid so often needed over the long term. According to McDermott, getting a shipment out the door is fairly complicated, requiring as many as five different AmeriCares teams collaborating together. The entire process can take months—from when products are received in the warehouse and deciding which recipients to allocate supplies to, to getting customs and governmental approvals in place, actually shipping products, and finally ensuring that the products are received in-country. Delivering that aid is no small affair. “Our volume exceeds half a billion dollars a year worth of donated medicines and medical supplies, so it’s a sizable logistical operation to bring these products in and get them out to the right place quickly to have the most impact,” says Sears. “We really pride ourselves on our controls and efficiencies.” Adding to that complexity is the fact that the longer it takes to deliver aid, the more dire the human need can be. Any time AmeriCares associates can shave off the complicated aid delivery process can translate into lives saved. “It’s really being able to track information consistently that will help us to see where are the bottlenecks and where can we work on improving our processes,” says McDermott. Setting a Standard Productivity and information management improvements were key objectives for AmeriCares when staff began the process of implementing Oracle’s Primavera solution. But before configuring the software, the staff needed to take the time to analyze the systems already in place. According to Greg Loop, manager of database systems at AmeriCares, the organization received guidance from several consultants, including Rich D’Addario, consulting project manager in the Primavera Global Business Unit at Oracle, who was instrumental in shepherding the critical requirements-gathering phase. D’Addario encouraged staff to begin documenting shipping processes by considering the order in which activities occur and which ones are dependent on others to get accomplished. This exercise helped everyone realize that to be more efficient, they needed to keep track of shipments in a more standard way. “The staff didn’t recognize formal project management methodology,” says D’Addario. “But they did understand what the most important things are and that if they go wrong, an entire project can go off course.” Before, if a boatload of supplies was being sent to Haiti and there was a problem somewhere, a lot of time was taken up finding out where the problem was—because staff was not tracking things in a standard way. As a result, even more time was needed to find possible solutions to the problem and alert recipients that the aid might be delayed. “For everyone to put on the project manager hat and standardize the way every single thing is done means that now the whole organization is on the same page as to what needs to occur from the time a hurricane hits Haiti and when a boat pulls in to unload supplies,” says D’Addario. With so much care taken to put a process foundation firmly in place, configuring the Primavera solution was actually quite simple. Specific templates were set up for different types of shipments, and dashboards were implemented to provide executives with clear overviews of every project in the system. AmeriCares’ Loop reports that system planning, refining, and testing, followed by writing up documentation and training, took approximately four months. The system went live in spring 2011 at AmeriCares’ Connecticut headquarters. While the nonprofit has an international presence, with warehouses in Europe and offices in Haiti, India, Japan, and Sri Lanka, most donated medicines come from U.S. entities and are shipped from the U.S. out to the rest of the world. In addition, all shipments are tracked from the U.S. office. AmeriCares doesn’t expect the Primavera system to take months off the shipping time, especially for sea containers. However, any time saved is still important because it will allow aid to be delivered to people more quickly at a lower overall cost. “If we can trim a day or two here or there, that can translate into lives that we’re saving, especially in emergency situations,” says Sears. A Cultural Change Beyond the measurable benefits that come with IT-driven process improvement, AmeriCares management is seeing a change in culture as a result of the Primavera project. One change has been treating every shipment of aid as a project, and everyone involved with facilitating shipments as a project manager. “This is a revolutionary concept for us,” says McDermott. “Before, we were used to thinking we were doing logistics—getting a container from point A to point B without looking at it as one project and really understanding what it meant to manage it.” AmeriCares staff is also happy to report that collaboration within the organization is much more efficient. When someone creates a shipment in the Primavera system, the same shared template is used, which means anyone can log in to the system to see the status of a shipment. Knowledgeable staff can access a shipment project to help troubleshoot a problem. Management can easily check the status of projects across the organization. “Dashboards are really useful,” says McDermott. “Instead of going into the details of each project, you can just see the high-level real-time information at a glance.” The new system is helping team members focus on proactively managing shipments rather than simply reacting when problems occur. For example, when a container is shipped, documents must be included for customs clearance. Now, the shipping template has built-in reminders to prompt team members to ask for copies of these documents from freight forwarders and to follow up with partners to discover if a shipment is on time. In the past, staff may not have worked on securing these documents until they’d been notified a shipment had arrived in-country. Another benefit of capturing and adopting best practices within the Primavera system is that staff training is easier. “Capturing the processes in documented steps and milestones allows us to teach new staff members how to do their jobs faster,” says Sears. “It provides them with the knowledge of their predecessors so they don’t have to keep reinventing the wheel.” With the Primavera system already generating positive results, management is eager to take advantage of advanced capabilities. Loop is working on integrating the company’s proprietary inventory management system with the Primavera system so that when logistics or warehousing operators input data, the information will automatically go into the Primavera system. In the past, this information had to be manually keyed into spreadsheets, often leading to errors. Mining Historical Data Another feature on the horizon for AmeriCares is utilizing Primavera P6 Professional Project Management reporting capabilities. As the system begins to include more historical data, management soon will be able to draw on this information to conduct analysis that has not been possible before and create customized reports. For example, at the beginning of the shipment process, staff will be able to use historical data to more accurately estimate how long the approval process should take for a particular country. This could help ensure that food and medicine with limited shelf lives do not get stuck in customs or used beyond their expiration dates. The historical data in the Primavera system will also help AmeriCares with better planning year to year. The nonprofit’s staff has always put together a plan at the beginning of the year, but this has been very challenging simply because it is impossible to predict disasters. Now, management will be able to look at historical data and see trends and statistics as they set current objectives and prepare for future need. In addition, this historical data will provide AmeriCares management with the ability to review year-end data and compare actual project results with goals set at the beginning of the year—to see if desired outcomes were achieved and if there are areas that need improvement. It’s this type of information that is so valuable to donors. And, according to York, project management software can play a critical role in generating the data to help nonprofits sustain and grow. “It is important to invest in systems to help replicate, expand, and deliver services,” says York. “Project management software can help because it encourages nonprofits to examine program or service changes and how to manage moving forward.” Sears believes that AmeriCares donors will support the return on investment the organization will achieve with the Primavera solution. “It won’t be financial returns, but rather how many more people we can help for a given dollar or how much more quickly we can respond to a need,” says Sears. “I think donors are receptive to such arguments.” And for AmeriCares, it is all about the future and increasing results. The project management environment currently may be quite simple, but IT staff plans to expand the complexity and functionality as the organization grows in its knowledge of project management and the goals it wants to achieve. “As we use the system over time, we’ll continue to refine our best practices and accumulate more data,” says Sears. “It will advance our ability to make better data-driven decisions.”

    Read the article

  • How do I make dashboard widgets active on logon?

    - by CharlesB
    There are a few dashboard widget that are useful even when not going in Dashboard. For example, SVN Notifier sends a Growl notification when commits are made to a repository you want to watch. Or, Delivery Status does the same for status update on tracked packages. The thing is when I log into OS X, those status updates won't happen until the first time I actually enter into Dashboard, so it looks like they are not initialized at startup. How to fix this?

    Read the article

  • Mail troubleshooting

    - by Jason Swett
    I'm just trying to send myself an e-mail. On on Ubuntu using sendmail. For some reason, it doesn't work. Here's the command I'm running and what shows up when I run it: jason@ve:~$ echo "Subject: test" | /usr/lib/sendmail -v [email protected] [email protected]... Connecting to [127.0.0.1] via relay... 220 ve.5wrvhfxg.vesrv.com ESMTP Sendmail 8.14.3/8.14.3/Debian-9.1ubuntu1; Wed, 29 Dec 2010 13:51:49 -0800; (No UCE/UBE) logging access from: localhost.localdomain(OK)-localhost.localdomain [127.0.0.1] >>> EHLO ve.5wrvhfxg.vesrv.com 250-ve.5wrvhfxg.vesrv.com Hello localhost.localdomain [127.0.0.1], pleased to meet you 250-ENHANCEDSTATUSCODES 250-PIPELINING 250-EXPN 250-VERB 250-8BITMIME 250-SIZE 250-DSN 250-ETRN 250-DELIVERBY 250 HELP >>> VERB 250 2.0.0 Verbose mode >>> MAIL From:<[email protected]> SIZE=14 250 2.1.0 <[email protected]>... Sender ok >>> RCPT To:<[email protected]> >>> DATA 250 2.1.5 <[email protected]>... Recipient ok 354 Enter mail, end with "." on a line by itself >>> . 050 <[email protected]>... Connecting to 205.186.165.157. via esmtp... 050 <[email protected]>... Deferred: Connection refused by 205.186.165.157. 250 2.0.0 oBTLpnEj012261 Message accepted for delivery [email protected]... Sent (oBTLpnEj012261 Message accepted for delivery) Closing connection to [127.0.0.1] >>> QUIT 221 2.0.0 ve.5wrvhfxg.vesrv.com closing connection It seems to me that the "Connection refused by 205.186.165.157" part is where things are going wrong, but I have no idea where or how to begin troubleshooting. Any advice?

    Read the article

< Previous Page | 29 30 31 32 33 34 35 36 37 38 39 40  | Next Page >