Search Results

Search found 7061 results on 283 pages for 'target'.

Page 33/283 | < Previous Page | 29 30 31 32 33 34 35 36 37 38 39 40  | Next Page >

  • Ajax doesn't trigger a change-event on a webkit based browser

    - by user319464
    I have adapted a Jquery plugin to for-fill my needs to send GET requests to servers as a way of "pinging" them. I've also added some javascript code to add some fancy features like: depending on the changed value in a that the Jquery plugin changes, it changes the Icon accordingly. To make it all work essentially, I made so that when Ajax gets a "complete" event, it forces a "onChange" event to the span, triggering the javascript validation function to change the status icons. Here is the code of my slightly modified jQuery Plugin: /** * ping for jQuery * * Adapted by Carroarmato0 (to actually work instead of randomly "pinging" nowhere instead of faking * * @auth Jessica * @link http://www.skiyo.cn/demo/jquery.ping/ * */ (function($) { $.fn.ping = function(options) { var opts = $.extend({}, $.fn.ping.defaults, options); return this.each(function() { var ping, requestTime, responseTime ; var target = $(this); var server = target.html(); target.html('<img src="img/loading.gif" alt="loading" />'); function ping() { $.ajax({url: 'http://' + server, type: 'GET', dataType: 'html', timeout: 30000, beforeSend : function() { requestTime = new Date().getTime(); }, complete : function() { responseTime = new Date().getTime(); ping = Math.abs(requestTime - responseTime); if (ping > 2000) { target.text('niet bereikbaar'); } else { target.text(ping + opts.unit); } target.change(); } }); } ping(); opts.interval != 0 && setInterval(ping,opts.interval * 1000); }); }; $.fn.ping.defaults = { interval: 3, unit: 'ms' }; })(jQuery); target.change(); is the code that triggers the "onchange" event in the span: echo " <td class=\"center\"><span id=\"ping$pingNb\" onChange=\"checkServerIcon(this)\" >" .$server['IP'] . "</span></td>"; In Firefox this works, checkServerIcon(this) gets executed and passes the span object to the function. function checkServerIcon(object) { var delayText = object.innerHTML; var delay = delayText.substring(0, delayText.length - 2); if ( isInteger(delay) ) { object.parentNode.previousSibling.parentNode.getElementsByTagName('img')[0].src = 'img/servers/enable_server.png'; } else { if (delay == "bezig.") { object.parentNode.previousSibling.parentNode.getElementsByTagName('img')[0].src = 'img/servers/search_server.png'; } else { object.parentNode.previousSibling.parentNode.getElementsByTagName('img')[0].src = 'img/servers/desable_server.png'; } } } My guess would be that there's something different in WebKit browsers in the way object.parentNode.previousSibling.parentNode. .... works...

    Read the article

  • How can I have a Makefile automatically rebuild source files that include a modified header file? (I

    - by Nicholas Flynt
    I have the following makefile that I use to build a program (a kernel, actually) that I'm working on. Its from scratch and I'm learning about the process, so its not perfect, but I think its powerful enough at this point for my level of experience writing makefiles. AS = nasm CC = gcc LD = ld TARGET = core BUILD = build SOURCES = source INCLUDE = include ASM = assembly VPATH = $(SOURCES) CFLAGS = -Wall -O -fstrength-reduce -fomit-frame-pointer -finline-functions \ -nostdinc -fno-builtin -I $(INCLUDE) ASFLAGS = -f elf #CFILES = core.c consoleio.c system.c CFILES = $(foreach dir,$(SOURCES),$(notdir $(wildcard $(dir)/*.c))) SFILES = assembly/start.asm SOBJS = $(SFILES:.asm=.o) COBJS = $(CFILES:.c=.o) OBJS = $(SOBJS) $(COBJS) build : $(TARGET).img $(TARGET).img : $(TARGET).elf c:/python26/python.exe concat.py stage1 stage2 pad.bin core.elf floppy.img $(TARGET).elf : $(OBJS) $(LD) -T link.ld -o $@ $^ $(SOBJS) : $(SFILES) $(AS) $(ASFLAGS) $< -o $@ %.o: %.c @echo Compiling $<... $(CC) $(CFLAGS) -c -o $@ $< #Clean Script - Should clear out all .o files everywhere and all that. clean: -del *.img -del *.o -del assembly\*.o -del core.elf My main issue with this makefile is that when I modify a header file that one or more C files include, the C files aren't rebuilt. I can fix this quite easily by having all of my header files be dependencies for all of my C files, but that would effectively cause a complete rebuild of the project any time I changed/added a header file, which would not be very graceful. What I want is for only the C files that include the header file I change to be rebuilt, and for the entire project to be linked again. I can do the linking by causing all header files to be dependencies of the target, but I cannot figure out how to make the C files be invalidated when their included header files are newer. I've heard that GCC has some commands to make this possible (so the makefile can somehow figure out which files need to be rebuilt) but I can't for the life of me find an actual implementation example to look at. Can someone post a solution that will enable this behavior in a makefile? EDIT: I should clarify, I'm familiar with the concept of putting the individual targets in and having each target.o require the header files. That requires me to be editing the makefile every time I include a header file somewhere, which is a bit of a pain. I'm looking for a solution that can derive the header file dependencies on its own, which I'm fairly certain I've seen in other projects.

    Read the article

  • Why is my namespace not recognized in Visual Studio / xaml

    - by msfanboy
    Hello, these are my 2 classes a Attachable Property SelectedItems: code is from here: http://stackoverflow.com/questions/1297643/sync-selecteditems-in-a-muliselect-listbox-with-a-collection-in-viewmodel The namespace TBM.Helper is for sure proper as it works for other classes too. The namespace reference is also in the xaml file: xmlns:Helper="clr_namespace:TBM.Helper" But <ListBox Helper:SelectedItems.Items="{Binding SelectedItems}" ... does not work because = The property 'SelectedItems.Items' does not exist in XML namespace 'clr_namespace:TBM.Helper'. The attachable property 'Items' was not found in type 'SelectedItems What do I have to change ? using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Windows.Controls; using System.Collections; using System.Windows; namespace TBM.Helper { public static class SelectedItems : DependencyObject { private static readonly DependencyProperty SelectedItemsBehaviorProperty = DependencyProperty.RegisterAttached( "SelectedItemsBehavior", typeof(SelectedItemsBehavior), typeof(ListBox), null); public static readonly DependencyProperty ItemsProperty = DependencyProperty.RegisterAttached( "Items", typeof(IList), typeof(SelectedItems), new PropertyMetadata(null, ItemsPropertyChanged)); public static void SetItems(ListBox listBox, IList list) { listBox.SetValue(ItemsProperty, list); } public static IList GetItems(ListBox listBox) { return listBox.GetValue(ItemsProperty) as IList; } private static void ItemsPropertyChanged(DependencyObject d, DependencyPropertyChangedEventArgs e) { var target = d as ListBox; if (target != null) { GetOrCreateBehavior(target, e.NewValue as IList); } } private static SelectedItemsBehavior GetOrCreateBehavior(ListBox target, IList list) { var behavior = target.GetValue(SelectedItemsBehaviorProperty) as SelectedItemsBehavior; if (behavior == null) { behavior = new SelectedItemsBehavior(target, list); target.SetValue(SelectedItemsBehaviorProperty, behavior); } return behavior; } } } using System.Windows; using System.Windows.Controls; using System.Collections; namespace TBM.Helper { public class SelectedItemsBehavior { private readonly ListBox _listBox; private readonly IList _boundList; public SelectedItemsBehavior(ListBox listBox, IList boundList) { _boundList = boundList; _listBox = listBox; SetSelectedItems(); _listBox.SelectionChanged += OnSelectionChanged; _listBox.DataContextChanged += OnDataContextChanged; } private void SetSelectedItems() { _listBox.SelectedItems.Clear(); foreach (object item in _boundList) { // References in _boundList might not be the same as in _listBox.Items int i = _listBox.Items.IndexOf(item); if (i >= 0) _listBox.SelectedItems.Add(_listBox.Items[i]); } } private void OnDataContextChanged(object sender, DependencyPropertyChangedEventArgs e) { SetSelectedItems(); } private void OnSelectionChanged(object sender, SelectionChangedEventArgs e) { _boundList.Clear(); foreach (var item in _listBox.SelectedItems) _boundList.Add(item); } } }

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Code Golf: Countdown Number Game

    - by Noldorin
    Challenge Here is the task, inspired by the well-known British TV game show Countdown. The challenge should be pretty clear even without any knowledge of the game, but feel free to ask for clarifications. And if you fancy seeing a clip of this game in action, check out this YouTube clip. It features the wonderful late Richard Whitely in 1997. You are given 6 numbers, chosen at random from the set {1, 2, 3, 4, 5, 6, 8, 9, 10, 25, 50, 75, 100}, and a random target number between 100 and 999. The aim is to make use the six given numbers and the four common arithmetic operations (addition, subtraction, multiplication, division; all over the rational numbers) to generate the target - or as close as possible either side. Each number may only be used once at most, while each arithmetic operator may be used any number of times (including zero.) Note that it does not matter how many numbers are used. Write a function that takes the target number and set of 6 numbers (can be represented as list/collection/array/sequence) and returns the solution in any standard numerical notation (e.g. infix, prefix, postfix). The function must always return the closest-possible result to the target, and must run in at most 1 minute on a standard PC. Note that in the case where more than one solution exists, any single solution is sufficient. Examples: {50, 100, 4, 2, 2, 4}, target 203 e.g. 100 * 2 + 2 + (4 / 4) e.g. (100 + 50) * 4 * 2 / (4 + 2) {25, 4, 9, 2, 3, 10}, target 465 e.g. (25 + 10 - 4) * (9 * 2 - 3) {9, 8, 10, 5, 9, 7), target 241 e.g. ((10 + 9) * 9 * 7) + 8) / 5 Rules Other than mentioned in the problem statement, there are no further restrictions. You may write the function in any standard language (standard I/O is not necessary). The aim as always is to solve the task with the smallest number of characters of code. Saying that, I may not simply accept the answer with the shortest code. I'll also be looking at elegance of the code and time complexity of the algorithm! My Solution I'm attempting an F# solution when I find the free time - will post it here when I have something! Format Please post all answers in the following format for the purpose of easy comparison: Language Number of characters: ??? Fully obfuscated function: (code here) Clear (ideally commented) function: (code here) Any notes on the algorithm/clever shortcuts it takes.

    Read the article

  • Simple MSBuild Configuration: Updating Assemblies With A Version Number

    - by srkirkland
    When distributing a library you often run up against versioning problems, once facet of which is simply determining which version of that library your client is running.  Of course, each project in your solution has an AssemblyInfo.cs file which provides, among other things, the ability to set the Assembly name and version number.  Unfortunately, setting the assembly version here would require not only changing the version manually for each build (depending on your schedule), but keeping it in sync across all projects.  There are many ways to solve this versioning problem, and in this blog post I’m going to try to explain what I think is the easiest and most flexible solution.  I will walk you through using MSBuild to create a simple build script, and I’ll even show how to (optionally) integrate with a Team City build server.  All of the code from this post can be found at https://github.com/srkirkland/BuildVersion. Create CommonAssemblyInfo.cs The first step is to create a common location for the repeated assembly info that is spread across all of your projects.  Create a new solution-level file (I usually create a Build/ folder in the solution root, but anywhere reachable by all your projects will do) called CommonAssemblyInfo.cs.  In here you can put any information common to all your assemblies, including the version number.  An example CommonAssemblyInfo.cs is as follows: using System.Reflection; using System.Resources; using System.Runtime.InteropServices;   [assembly: AssemblyCompany("University of California, Davis")] [assembly: AssemblyProduct("BuildVersionTest")] [assembly: AssemblyCopyright("Scott Kirkland & UC Regents")] [assembly: AssemblyConfiguration("")] [assembly: AssemblyTrademark("")]   [assembly: ComVisible(false)]   [assembly: AssemblyVersion("1.2.3.4")] //Will be replaced   [assembly: NeutralResourcesLanguage("en-US")] .csharpcode, .csharpcode pre { font-size: small; color: black; font-family: consolas, "Courier New", courier, monospace; background-color: #ffffff; /*white-space: pre;*/ } .csharpcode pre { margin: 0em; } .csharpcode .rem { color: #008000; } .csharpcode .kwrd { color: #0000ff; } .csharpcode .str { color: #006080; } .csharpcode .op { color: #0000c0; } .csharpcode .preproc { color: #cc6633; } .csharpcode .asp { background-color: #ffff00; } .csharpcode .html { color: #800000; } .csharpcode .attr { color: #ff0000; } .csharpcode .alt { background-color: #f4f4f4; width: 100%; margin: 0em; } .csharpcode .lnum { color: #606060; } .csharpcode, .csharpcode pre { font-size: small; color: black; font-family: consolas, "Courier New", courier, monospace; background-color: #ffffff; /*white-space: pre;*/ } .csharpcode pre { margin: 0em; } .csharpcode .rem { color: #008000; } .csharpcode .kwrd { color: #0000ff; } .csharpcode .str { color: #006080; } .csharpcode .op { color: #0000c0; } .csharpcode .preproc { color: #cc6633; } .csharpcode .asp { background-color: #ffff00; } .csharpcode .html { color: #800000; } .csharpcode .attr { color: #ff0000; } .csharpcode .alt { background-color: #f4f4f4; width: 100%; margin: 0em; } .csharpcode .lnum { color: #606060; }   Cleanup AssemblyInfo.cs & Link CommonAssemblyInfo.cs For each of your projects, you’ll want to clean up your assembly info to contain only information that is unique to that assembly – everything else will go in the CommonAssemblyInfo.cs file.  For most of my projects, that just means setting the AssemblyTitle, though you may feel AssemblyDescription is warranted.  An example AssemblyInfo.cs file is as follows: using System.Reflection;   [assembly: AssemblyTitle("BuildVersionTest")] .csharpcode, .csharpcode pre { font-size: small; color: black; font-family: consolas, "Courier New", courier, monospace; background-color: #ffffff; /*white-space: pre;*/ } .csharpcode pre { margin: 0em; } .csharpcode .rem { color: #008000; } .csharpcode .kwrd { color: #0000ff; } .csharpcode .str { color: #006080; } .csharpcode .op { color: #0000c0; } .csharpcode .preproc { color: #cc6633; } .csharpcode .asp { background-color: #ffff00; } .csharpcode .html { color: #800000; } .csharpcode .attr { color: #ff0000; } .csharpcode .alt { background-color: #f4f4f4; width: 100%; margin: 0em; } .csharpcode .lnum { color: #606060; } Next, you need to “link” the CommonAssemblyinfo.cs file into your projects right beside your newly lean AssemblyInfo.cs file.  To do this, right click on your project and choose Add | Existing Item from the context menu.  Navigate to your CommonAssemblyinfo.cs file but instead of clicking Add, click the little down-arrow next to add and choose “Add as Link.”  You should see a little link graphic similar to this: We’ve actually reduced complexity a lot already, because if you build all of your assemblies will have the same common info, including the product name and our static (fake) assembly version.  Let’s take this one step further and introduce a build script. Create an MSBuild file What we want from the build script (for now) is basically just to have the common assembly version number changed via a parameter (eventually to be passed in by the build server) and then for the project to build.  Also we’d like to have a flexibility to define what build configuration to use (debug, release, etc). In order to find/replace the version number, we are going to use a Regular Expression to find and replace the text within your CommonAssemblyInfo.cs file.  There are many other ways to do this using community build task add-ins, but since we want to keep it simple let’s just define the Regular Expression task manually in a new file, Build.tasks (this example taken from the NuGet build.tasks file). <?xml version="1.0" encoding="utf-8"?> <Project ToolsVersion="4.0" DefaultTargets="Go" xmlns="http://schemas.microsoft.com/developer/msbuild/2003"> <UsingTask TaskName="RegexTransform" TaskFactory="CodeTaskFactory" AssemblyFile="$(MSBuildToolsPath)\Microsoft.Build.Tasks.v4.0.dll"> <ParameterGroup> <Items ParameterType="Microsoft.Build.Framework.ITaskItem[]" /> </ParameterGroup> <Task> <Using Namespace="System.IO" /> <Using Namespace="System.Text.RegularExpressions" /> <Using Namespace="Microsoft.Build.Framework" /> <Code Type="Fragment" Language="cs"> <![CDATA[ foreach(ITaskItem item in Items) { string fileName = item.GetMetadata("FullPath"); string find = item.GetMetadata("Find"); string replaceWith = item.GetMetadata("ReplaceWith"); if(!File.Exists(fileName)) { Log.LogError(null, null, null, null, 0, 0, 0, 0, String.Format("Could not find version file: {0}", fileName), new object[0]); } string content = File.ReadAllText(fileName); File.WriteAllText( fileName, Regex.Replace( content, find, replaceWith ) ); } ]]> </Code> </Task> </UsingTask> </Project> .csharpcode, .csharpcode pre { font-size: small; color: black; font-family: consolas, "Courier New", courier, monospace; background-color: #ffffff; /*white-space: pre;*/ } .csharpcode pre { margin: 0em; } .csharpcode .rem { color: #008000; } .csharpcode .kwrd { color: #0000ff; } .csharpcode .str { color: #006080; } .csharpcode .op { color: #0000c0; } .csharpcode .preproc { color: #cc6633; } .csharpcode .asp { background-color: #ffff00; } .csharpcode .html { color: #800000; } .csharpcode .attr { color: #ff0000; } .csharpcode .alt { background-color: #f4f4f4; width: 100%; margin: 0em; } .csharpcode .lnum { color: #606060; } If you glance at the code, you’ll see it’s really just going a Regex.Replace() on a given file, which is exactly what we need. Now we are ready to write our build file, called (by convention) Build.proj. <?xml version="1.0" encoding="utf-8"?> <Project ToolsVersion="4.0" DefaultTargets="Go" xmlns="http://schemas.microsoft.com/developer/msbuild/2003"> <Import Project="$(MSBuildProjectDirectory)\Build.tasks" /> <PropertyGroup> <Configuration Condition="'$(Configuration)' == ''">Debug</Configuration> <SolutionRoot>$(MSBuildProjectDirectory)</SolutionRoot> </PropertyGroup>   <ItemGroup> <RegexTransform Include="$(SolutionRoot)\CommonAssemblyInfo.cs"> <Find>(?&lt;major&gt;\d+)\.(?&lt;minor&gt;\d+)\.\d+\.(?&lt;revision&gt;\d+)</Find> <ReplaceWith>$(BUILD_NUMBER)</ReplaceWith> </RegexTransform> </ItemGroup>   <Target Name="Go" DependsOnTargets="UpdateAssemblyVersion; Build"> </Target>   <Target Name="UpdateAssemblyVersion" Condition="'$(BUILD_NUMBER)' != ''"> <RegexTransform Items="@(RegexTransform)" /> </Target>   <Target Name="Build"> <MSBuild Projects="$(SolutionRoot)\BuildVersionTest.sln" Targets="Build" /> </Target>   </Project> Reviewing this MSBuild file, we see that by default the “Go” target will be called, which in turn depends on “UpdateAssemblyVersion” and then “Build.”  We go ahead and import the Bulid.tasks file and then setup some handy properties for setting the build configuration and solution root (in this case, my build files are in the solution root, but we might want to create a Build/ directory later).  The rest of the file flows logically, we setup the RegexTransform to match version numbers such as <major>.<minor>.1.<revision> (1.2.3.4 in our example) and replace it with a $(BUILD_NUMBER) parameter which will be supplied externally.  The first target, “UpdateAssemblyVersion” just runs the RegexTransform, and the second target, “Build” just runs the default MSBuild on our solution. Testing the MSBuild file locally Now we have a build file which can replace assembly version numbers and build, so let’s setup a quick batch file to be able to build locally.  To do this you simply create a file called Build.cmd and have it call MSBuild on your Build.proj file.  I’ve added a bit more flexibility so you can specify build configuration and version number, which makes your Build.cmd look as follows: set config=%1 if "%config%" == "" ( set config=debug ) set version=%2 if "%version%" == "" ( set version=2.3.4.5 ) %WINDIR%\Microsoft.NET\Framework\v4.0.30319\msbuild Build.proj /p:Configuration="%config%" /p:build_number="%version%" .csharpcode, .csharpcode pre { font-size: small; color: black; font-family: consolas, "Courier New", courier, monospace; background-color: #ffffff; /*white-space: pre;*/ } .csharpcode pre { margin: 0em; } .csharpcode .rem { color: #008000; } .csharpcode .kwrd { color: #0000ff; } .csharpcode .str { color: #006080; } .csharpcode .op { color: #0000c0; } .csharpcode .preproc { color: #cc6633; } .csharpcode .asp { background-color: #ffff00; } .csharpcode .html { color: #800000; } .csharpcode .attr { color: #ff0000; } .csharpcode .alt { background-color: #f4f4f4; width: 100%; margin: 0em; } .csharpcode .lnum { color: #606060; } Now if you click on the Build.cmd file, you will get a default debug build using the version 2.3.4.5.  Let’s run it in a command window with the parameters set for a release build version 2.0.1.453.   Excellent!  We can now run one simple command and govern the build configuration and version number of our entire solution.  Each DLL produced will have the same version number, making determining which version of a library you are running very simple and accurate. Configure the build server (TeamCity) Of course you are not really going to want to run a build command manually every time, and typing in incrementing version numbers will also not be ideal.  A good solution is to have a computer (or set of computers) act as a build server and build your code for you, providing you a consistent environment, excellent reporting, and much more.  One of the most popular Build Servers is JetBrains’ TeamCity, and this last section will show you the few configuration parameters to use when setting up a build using your MSBuild file created earlier.  If you are using a different build server, the same principals should apply. First, when setting up the project you want to specify the “Build Number Format,” often given in the form <major>.<minor>.<revision>.<build>.  In this case you will set major/minor manually, and optionally revision (or you can use your VCS revision number with %build.vcs.number%), and then build using the {0} wildcard.  Thus your build number format might look like this: 2.0.1.{0}.  During each build, this value will be created and passed into the $BUILD_NUMBER variable of our Build.proj file, which then uses it to decorate your assemblies with the proper version. After setting up the build number, you must choose MSBuild as the Build Runner, then provide a path to your build file (Build.proj).  After specifying your MSBuild Version (equivalent to your .NET Framework Version), you have the option to specify targets (the default being “Go”) and additional MSBuild parameters.  The one parameter that is often useful is manually setting the configuration property (/p:Configuration="Release") if you want something other than the default (which is Debug in our example).  Your resulting configuration will look something like this: [Under General Settings] [Build Runner Settings]   Now every time your build is run, a newly incremented build version number will be generated and passed to MSBuild, which will then version your assemblies and build your solution.   A Quick Review Our goal was to version our output assemblies in an automated way, and we accomplished it by performing a few quick steps: Move the common assembly information, including version, into a linked CommonAssemblyInfo.cs file Create a simple MSBuild script to replace the common assembly version number and build your solution Direct your build server to use the created MSBuild script That’s really all there is to it.  You can find all of the code from this post at https://github.com/srkirkland/BuildVersion. Enjoy!

    Read the article

  • Drop outs when accessing share by DFS name.

    - by Stephen Woolhead
    I have a strange problem, aren't they all! I have a DFS root \domain\files\vms, it has a single target on a different server than the namespace. I can copy a test file set from the target directly via \server\vms$\testfiles and all is well, the files copy fine. I have repeated these tests many times. If I try and copy the files from the dfs root I get big pauses in the network traffic, about 50 seconds every couple of minutes, all the traffic just stops for the copy. If I start another copy between the same two machines during this pause, it starts copying fine, so I know it's not an issue with the disks on the server. Every once in a while the copy will fail, no errors, the progress bar will just zip all the way to 100% and the copy dialog will close. Checking the target folder show that the copy is incomplete. I've moved the LUN to another server and had the same problem. The servers are all 2008 R2, the clients are Vista x64, Windows7 x64 and 2008 R2, all have the same problem. Anyone got any ideas? Cheers, Stephen More Information: I've been running a NetMon trace on the connection when the file copy fails and what seems to be standing out is that when opening a file that the copy completes on the SMB command looks like this: SMB2: C CREATE (0x5), Name=Training\PDC2008\BB34 Live Services Notifications, Awareness, and Communications.wmv@#422082, Context=DHnQ, Context=MxAc, Context=QFid, Context=RqLs, Mid = 245376 SMB2: R CREATE (0x5), Context=MxAc, Context=RqLs, Context=DHnQ, Context=QFid, FID=0xFFFFFFFF00000015, Mid = 245376 But for the last file when the copy dialog closes looks like this: SMB2: C CREATE (0x5), Name=gt\files\Media\Training\PDC2008\BB36 FAST Building Search-Driven Portals with Microsoft Office SharePoint Server 2007 and Microsoft Silverlight.wmv@#859374, Context=DHnQ, Context=MxAc, Context=QFid, Context=RqLs, Mid = 77 SMB2: R , Mid = 77 - NT Status: System - Error, Code = (58) STATUS_OBJECT_PATH_NOT_FOUND The main difference seems to be in the name, one is relative to the open file share, the other has gained the gt\files\media prefix which is the name of the DFS target. These failures are always preceded by logoff and back on of the SMB target. Might have to bump this one to PSS.

    Read the article

  • Can't install NPM after installing Node on EC2 Linux instance?

    - by frequent
    I'm trying my first attempt on getting a node server set up on an amazon ec2 linux instance. I think I made it quite far. First problem I ran into was when trying to make Node the connection timed out after a while, so I need three attempts until I got this: LINK(target) /home/ec2-user/node/out/Release/node: Finished touch /home/ec2-user/node/out/Release/obj.target/node_dtrace_header.stamp touch /home/ec2-user/node/out/Release/obj.target/node_dtrace_provider.stamp touch /home/ec2-user/node/out/Release/obj.target/node_dtrace_ustack.stamp touch /home/ec2-user/node/out/Release/obj.target/node_etw.stamp make[1]: Leaving directory `/home/ec2-user/node/out' ln -fs out/Release/node node Which tells me, "Node is done", although I'm not sure it is also working as it should. Following this,this and this tutorial, I'm now stuck at installing npm. I think I first cloned into the wrong folder, which always gave me error 127, but even if I'm doing this: cd ~ git clone git://github.com/isaacs/npm.git cd npm sudo -s PATH=/usr/local/bin:$PATH make install I'm still getting this: #after cloning# make[1]: Entering directory `/root/npm' node cli.js install bash: node: command not found make[1]: *** [node_modules/.bin/ronn] Error 127 make[1]: Leaving directory `/root/npm' make: *** [man/man3/start.3] Error 2 Question:: Since I'm pretty much a newby at everything I'm trying here, can someone please tell me what I'm doing wrong and how to get npm to install? Also, in case I cloned into the wrong folder, is there a way to remove the "false clone" or is this not written to disk until I call make install and I don't need to worry? Thanks for helping out!

    Read the article

  • iptables (NAT/PAT) setup for SSH & Samba

    - by IanVaughan
    I need to access a Linux box via SSH & Samba that is hidden/connected behind another one. Setup :- A switch B C |----| |---| |----| |----| |eth0|----| |----|eth0| | | |----| |---| |eth1|----|eth1| |----| |----| Eg, SSH/Samba from A to C How does one go about this? I was thinking that it cannot be done via IP alone? Or can it? Could B say "hi on eth0, if your looking for 192.168.0.2, its here on eth1"? Is this NAT? This is a large private network, so what about if another PC has that IP?! More likely it would be PAT? A would say "hi 192.168.109.15:1234" B would say "hi on eth0, traffic for port 1234 goes on here eth1" How could that be done? And would the SSH/Samba demons see the correct packet header info and work?? IP info :- A - eth0 - 192.168.109.2 B - eth0 - B1 = 192.168.109.15 B2 = 172.24.40.130 - eth1 - 192.168.0.1 C - eth1 - 192.168.0.2 A, B & C are RHEL (RedHat) But Windows computers can be connected to the switch. I configured the 192.168.0.* IPs, they are changeable. Update after response from Eddie Few problems (and Machines' B IP is different!) From A :- ssh 172.24.40.130 works ok, (can get to B2) but ssh 172.24.40.130 -p 2022 -vv times out with :- OpenSSH_4.3p2, OpenSSL 0.9.8e-fips-rhel5 01 Jul 2008 debug1: Reading configuration data /etc/ssh/ssh_config debug1: Applying options for * debug2: ssh_connect: needpriv 0 debug1: Connecting to 172.24.40.130 [172.24.40.130] port 2022. ...wait ages... debug1: connect to address 172.24.40.130 port 2022: Connection timed out ssh: connect to host 172.24.40.130 port 2022: Connection timed out From B2 :- $ service iptables status Table: filter Chain INPUT (policy ACCEPT) num target prot opt source destination Chain FORWARD (policy ACCEPT) num target prot opt source destination 1 ACCEPT tcp -- 0.0.0.0/0 192.168.0.2 tcp dpt:22 Chain OUTPUT (policy ACCEPT) num target prot opt source destination Table: nat Chain PREROUTING (policy ACCEPT) num target prot opt source destination 1 DNAT tcp -- 0.0.0.0/0 0.0.0.0/0 tcp dpt:2022 to:192.168.0.2:22 Chain POSTROUTING (policy ACCEPT) num target prot opt source destination Chain OUTPUT (policy ACCEPT) num target prot opt source destination And ssh from B2 to C works fine :- $ ssh 192.168.0.2 Route info :- $ route Kernel IP routing table Destination Gateway Genmask Flags Metric Ref Use Iface 192.168.0.0 * 255.255.255.0 U 0 0 0 eth1 172.24.40.0 * 255.255.255.0 U 0 0 0 eth0 169.254.0.0 * 255.255.0.0 U 0 0 0 eth1 default 172.24.40.1 0.0.0.0 UG 0 0 0 eth0 $ ip route 192.168.0.0/24 dev eth1 proto kernel scope link src 192.168.0.1 172.24.40.0/24 dev eth0 proto kernel scope link src 172.24.40.130 169.254.0.0/16 dev eth1 scope link default via 172.24.40.1 dev eth0 So I just dont know why the port forward doesnt work from A to B2?

    Read the article

  • Windows computer account appears to reset its own password, why?

    - by David Yu
    Has anyone seen this where a computer account appears to reset its password? The password for user 'WEST\SQLCLUSTER$' was reset by 'WEST\SQLCLUSTER$' on 'DOMAINCONTROLLER.WEST.company.corp' at '04/23/10 20:47:41' Event Type: Success Audit Event Source: Security Event Category: Account Management Event ID: 628 Date: Friday, April 23, 2010 Time: 8:47 PM User: WEST\SQLCLUSTER$ Computer: DOMAINCONTROLLER.WEST.company.corp Description: User Account password set: Target Account Name: SQLCLUSTER$ Target Domain: WEST Target Account ID: WEST\SQLCLUSTER$ Caller User Name: SQLCLUSTER$ Caller Domain: WEST Caller Logon ID: (0x0,0x7A518945)

    Read the article

  • Resize videos with different widths to a fixed height preserving aspect ratio with ffmpeg

    - by Axarydax
    I'd like to convert a lot of video files to flash video for our company's website. I have a requirement that all of the videos must be in 360p format, so their size would be Nx360. FFMpeg uses -s argument to specify target resolution as WxH. I don't know Width, as it depends on source file aspect ratio. If source is 640x480, target will be 480x360. If source is 848x480, target will be 636x360. Is there a way to do it with some switch of ffmpeg? That it will preserve aspect ratio and I'll only specify the height of target video? I could easily solve it by making a program that will launch ffprobe to get source video size, calculate aspect ratio and then calculate a new width.

    Read the article

  • Variable directory names over SCP

    - by nedm
    We have a backup routine that previously ran from one disk to another on the same server, but have recently moved the source data to a remote server and are trying to replicate the job via scp. We need to run the script on the target server, and we've set up key-based scp (no username/password required) between the two servers. Using scp to copy specific files and directories works perfectly: scp -r -p -B [email protected]:/mnt/disk1/bsource/filename.txt /mnt/disk2/btarget/ However, our previous routine iterates through directories on the source disk to determine which files to copy, then runs them individually through gpg encryption. Is there any way to do this only by using scp? Again, this script needs to run from the target server, and the user the job runs under only has scp (no ssh) access to the target system. The old job would look something like this: #Change to source dir cd /mnt/disk1 #Create variable to store # directories named by date YYYYMMDD j="20000101/" #Iterate though directories in the current dir # to get the most recent folder name for i in $(ls -d */); do if [ "$j" \< "$i" ]; then j=${i%/*} fi done #Encrypt individual files from $j to target directory cd ./${j%%}/bsource/ for k in $(ls -p | grep -v /$); do sudo /usr/bin/gpg -e -r "Backup Key" --batch --no-tty -o "/mnt/disk2/btarget/$k.gpg" "$/mnt/disk1/$j/bsource/$k" done Can anyone suggest how to do this via scp from the target system? Thanks in advance.

    Read the article

  • BUILDROOT files during RPM generation

    - by khmarbaise
    Currently i have the following spec file to create a RPM. The spec file is generated by maven plugin to produce a RPM out of it. The question is: will i find files which are mentioned in the spec file after the rpm generation inside the BUILDROOT/SPECS/SOURCES/SRPMS structure? %define _unpackaged_files_terminate_build 0 Name: rpm-1 Version: 1.0 Release: 1 Summary: rpm-1 License: 2009 my org Distribution: My App Vendor: my org URL: www.my.org Group: Application/Collectors Packager: my org Provides: project Requires: /bin/sh Requires: jre >= 1.5 Requires: BASE_PACKAGE PreReq: dependency Obsoletes: project autoprov: yes autoreq: yes BuildRoot: /home/build/.jenkins/jobs/rpm-maven-plugin/workspace/target/it/rpm-1/target/rpm/rpm-1/buildroot %description %install if [ -e $RPM_BUILD_ROOT ]; then mv /home/build/.jenkins/jobs/rpm-maven-plugin/workspace/target/it/rpm-1/target/rpm/rpm-1/tmp-buildroot/* $RPM_BUILD_ROOT else mv /home/build/.jenkins/jobs/rpm-maven-plugin/workspace/target/it/rpm-1/target/rpm/rpm-1/tmp-buildroot $RPM_BUILD_ROOT fi ln -s /usr/myusr/app $RPM_BUILD_ROOT/usr/myusr/app2 ln -s /tmp/myapp/somefile $RPM_BUILD_ROOT/tmp/myapp/somefile2 ln -s name.sh $RPM_BUILD_ROOT/usr/myusr/app/bin/oldname.sh %files %defattr(-,myuser,mygroup,-) %dir "/usr/myusr/app" "/usr/myusr/app2" "/tmp/myapp/somefile" "/tmp/myapp/somefile2" "/usr/myusr/app/lib" %attr(755,myuser,mygroup) "/usr/myusr/app/bin/start.sh" %attr(755,myuser,mygroup) "/usr/myusr/app/bin/filter-version.txt" %attr(755,myuser,mygroup) "/usr/myusr/app/bin/name.sh" %attr(755,myuser,mygroup) "/usr/myusr/app/bin/name-Linux.sh" %attr(755,myuser,mygroup) "/usr/myusr/app/bin/filter.txt" %attr(755,myuser,mygroup) "/usr/myusr/app/bin/oldname.sh" %dir "/usr/myusr/app/conf" %config "/usr/myusr/app/conf/log4j.xml" "/usr/myusr/app/conf/log4j.xml.deliver" %prep echo "hello from prepare" %pre -p /bin/sh #!/bin/sh if [ -s "/etc/init.d/myapp" ] then /etc/init.d/myapp stop rm /etc/init.d/myapp fi %post #!/bin/sh #create soft link script to services directory ln -s /usr/myusr/app/bin/start.sh /etc/init.d/myapp chmod 555 /etc/init.d/myapp %preun #!/bin/sh #the argument being passed in indicates how many versions will exist #during an upgrade, this value will be 1, in which case we do not want to stop #the service since the new version will be running once this script is called #during an uninstall, the value will be 0, in which case we do want to stop #the service and remove the /etc/init.d script. if [ "$1" = "0" ] then if [ -s "/etc/init.d/myapp" ] then /etc/init.d/myapp stop rm /etc/init.d/myapp fi fi; %triggerin -- dependency, dependency1 echo "hello from install" %changelog * Tue May 23 2000 Vincent Danen <[email protected]> 0.27.2-2mdk -update BuildPreReq to include rep-gtk and rep-gtkgnome * Thu May 11 2000 Vincent Danen <[email protected]> 0.27.2-1mdk -0.27.2 * Thu May 11 2000 Vincent Danen <[email protected]> 0.27.1-2mdk -added BuildPreReq -change name from Sawmill to Sawfish The problem i found is that the files (filter.txt in particular) after the generation process on a Ubuntu system but not on SuSE system. Which might be caused by different rpm versions ? Currently we have an integration test which fails based on the non existing of the file (filter.txt under a buildroot folder?)

    Read the article

  • How to unblock outgoing HTTP and HTTPS traffic in iptables?

    - by EApubs
    With the following iptable rules, I was unable to do an apt update and ping a website. Whats wrong with the rules? How to fix it? What is the exact rule to fix it? Chain INPUT (policy ACCEPT) target prot opt source destination ACCEPT tcp -- anywhere anywhere tcp dpt:325 DROP all -- anywhere anywhere Chain FORWARD (policy DROP) target prot opt source destination Chain OUTPUT (policy ACCEPT) target prot opt source destination

    Read the article

  • Kernel Logging disabled?

    - by Tiffany Walker
    uname -a Linux host 2.6.32-279.9.1.el6.i686 #1 SMP Tue Sep 25 20:26:47 UTC 2012 i686 i686 i386 GNU/Linux And start ups: ls /etc/init.d/ abrt-ccpp certmonger dovecot irqbalance matahari-broker mdmonitor nfs proftpd rpcbind single ypbind abrtd cgconfig functions kdump matahari-host messagebus nfslock psacct rpcgssd smartd abrt-oops cgred haldaemon killall matahari-network mysqld ntpd qpidd rpcidmapd sshd acpid cpuspeed halt ktune matahari-rpc named ntpdate quota_nld rpcsvcgssd sssd atd crond httpd lfd ma tahari-service netconsole oddjobd rdisc rsyslog sysstat auditd csf ip6tables lvm2-lvmetad matahari-sysconfig netfs portreserve restorecond sandbox tuned autofs cups iptables lvm2-monitor matahari-sysconfig-console network postfix rngd saslauthd udev-post But when I installed CSF/LFD I am getting nothing. LFD does not create lfd.log and nor are any blocks being logged in /var/log/messages either from the firewall. This is not natural. I looked for klogd but maybe I am looking in the wrong place for it to see if it is enabled? ls /etc/init.d/syslog ls: cannot access /etc/init.d/syslog: No such file or directory Also noticed no syslog? Also noticed this: csf -d 84.113.21.201 Adding 84.113.21.201 to csf.deny and iptables DROP... iptables: No chain/target/match by that name. iptables: No chain/target/match by that name. I've never seen this before and this is a dedicated box. Also: ./csftest.pl Testing ip_tables/iptable_filter...OK Testing ipt_LOG...OK Testing ipt_multiport/xt_multiport...OK Testing ipt_REJECT...OK Testing ipt_state/xt_state...OK Testing ipt_limit/xt_limit...OK Testing ipt_recent...OK Testing xt_connlimit...OK Testing ipt_owner/xt_owner...OK Testing iptable_nat/ipt_REDIRECT...OK Testing iptable_nat/ipt_DNAT...OK RESULT: csf should function on this server iptables -L Chain INPUT (policy ACCEPT) target prot opt source destination Chain FORWARD (policy ACCEPT) target prot opt source destination Chain OUTPUT (policy ACCEPT) target prot opt source destination

    Read the article

  • Nginx proxy cache (proxy_pass $request_uri;)

    - by imastar
    I need to create proxy web using nginx. If I access http://myweb.com/http://www.target.com/ the proxy_pass should be http://www.target.com/ Here is my configuration: location / { proxy_pass $request_uri; proxy_cache_methods GET; proxy_set_header Referer "$request_uri"; proxy_redirect off; proxy_set_header X-Real-IP $remote_addr; proxy_set_header X-Forwarded-For $proxy_add_x_forwarded_for; proxy_ignore_headers Cache-Control; proxy_hide_header Pragma; proxy_hide_header Set-Cookie; proxy_set_header Cache-Control Public; proxy_cache cache; proxy_cache_valid 200 10h; proxy_cache_valid 301 302 1h; proxy_cache_valid any 1h; } Here is the log error 2013/02/05 12:58:51 [error] 2118#0: *8 invalid URL prefix in "/http://www.target.com/", client: 108.59.8.83, server: myweb.com, request: "HEAD /http://www.target.com/ HTTP/1.1", host: "myweb.com"

    Read the article

  • KVM + Cloudmin + IpTables

    - by Alex
    I have a KVM virtualization on a machine. I use Ubuntu Server + Cloudmin (in order to manage virtual machine instances). On a host system I have four network interfaces: ebadmin@saturn:/var/log$ ifconfig br0 Link encap:Ethernet HWaddr 10:78:d2:ec:16:38 inet addr:192.168.0.253 Bcast:192.168.0.255 Mask:255.255.255.0 inet6 addr: fe80::1278:d2ff:feec:1638/64 Scope:Link UP BROADCAST RUNNING MULTICAST MTU:1500 Metric:1 RX packets:589337 errors:0 dropped:0 overruns:0 frame:0 TX packets:334357 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:0 RX bytes:753652448 (753.6 MB) TX bytes:43385198 (43.3 MB) br1 Link encap:Ethernet HWaddr 6e:a4:06:39:26:60 inet addr:192.168.10.1 Bcast:192.168.10.255 Mask:255.255.255.0 inet6 addr: fe80::6ca4:6ff:fe39:2660/64 Scope:Link UP BROADCAST RUNNING MULTICAST MTU:1500 Metric:1 RX packets:16995 errors:0 dropped:0 overruns:0 frame:0 TX packets:13309 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:0 RX bytes:2059264 (2.0 MB) TX bytes:1763980 (1.7 MB) eth0 Link encap:Ethernet HWaddr 10:78:d2:ec:16:38 UP BROADCAST RUNNING MULTICAST MTU:1500 Metric:1 RX packets:610558 errors:0 dropped:0 overruns:0 frame:0 TX packets:332382 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:1000 RX bytes:769477564 (769.4 MB) TX bytes:44360402 (44.3 MB) Interrupt:20 Memory:fe400000-fe420000 lo Link encap:Local Loopback inet addr:127.0.0.1 Mask:255.0.0.0 inet6 addr: ::1/128 Scope:Host UP LOOPBACK RUNNING MTU:16436 Metric:1 RX packets:239632 errors:0 dropped:0 overruns:0 frame:0 TX packets:239632 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:0 RX bytes:50738052 (50.7 MB) TX bytes:50738052 (50.7 MB) tap0 Link encap:Ethernet HWaddr 6e:a4:06:39:26:60 inet6 addr: fe80::6ca4:6ff:fe39:2660/64 Scope:Link UP BROADCAST RUNNING MULTICAST MTU:1500 Metric:1 RX packets:17821 errors:0 dropped:0 overruns:0 frame:0 TX packets:13703 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:500 RX bytes:2370468 (2.3 MB) TX bytes:1782356 (1.7 MB) br0 is connected to a real network, br1 is used to create a private network shared between guest systems. Now I need to configure iptables for network access. First of all I allow ssh sessions on port 8022 on the host system, then I allow all connections in state RELATED, ESTABLISHED. This is working ok. I install another system as guest, it's IP address is 192.168.10.2, and now I have two problems: I want to allow the access from this host to the outside world, cannot accomplish this. I can ssh from the host. I want to be able to ssh to the guest from the outside world using 8023 port. Cannot accomplish this. Full iptables configuration is following: ebadmin@saturn:/var/log$ sudo iptables --list [sudo] password for ebadmin: Chain INPUT (policy DROP) target prot opt source destination ACCEPT all -- anywhere anywhere ACCEPT tcp -- anywhere anywhere tcp dpt:8022 ACCEPT all -- anywhere anywhere state RELATED,ESTABLISHED LOG all -- anywhere anywhere LOG level warning Chain FORWARD (policy ACCEPT) target prot opt source destination LOG all -- anywhere anywhere LOG level warning Chain OUTPUT (policy ACCEPT) target prot opt source destination LOG all -- anywhere anywhere LOG level warning ebadmin@saturn:/var/log$ sudo iptables -t nat --list Chain PREROUTING (policy ACCEPT) target prot opt source destination DNAT tcp -- anywhere anywhere tcp spt:8023 to:192.168.10.2:22 Chain INPUT (policy ACCEPT) target prot opt source destination Chain OUTPUT (policy ACCEPT) target prot opt source destination Chain POSTROUTING (policy ACCEPT) target prot opt source destination The worst of all is that I don't know how to interpret iptables logs. I don't see the final decision of the firewall. Need help urgently.

    Read the article

  • SQL 2000 and group names

    - by Nasa
    I have a SQL 2000 server which has databases, under user section of the database object, I have some NT 4.0 groups. These groups were migrated over to Active Directory some time ago using ADMT with SID history. The original source domain groups have since been deleted. The access shown is olddomain\groupname. I don't know why, if they were ntfs permissions they would update automatically to target\groupname. The users in the AD domain still have access to the database as they are a member of the migrated group (Target\groupname). I was wondering 1) Why does the old group (source\groupname) show up as it doesn't exist anymore. But access is still granted to the target group? 2) Is there any easy way to update the group name from source\groupname to target\groupname? Thanks for any help.

    Read the article

  • iptables not writing rules.

    - by Darkmage
    im running these two rules as root, but when doing a iptables -L it dosent show any rules, any one have an idea of what the problem can be? iptables -A PREROUTING -t nat -i eth0 -p tcp --dport 80 --source 84.244.145.135 -j REDIRECT --to-port 1222 iptables -A PREROUTING -t nat -i eth0 -p tcp --dport 80 --source 243.134.97.194 -j REDIRECT --to-port 1222 duno@Virtual-Box:/home/glennwiz# iptables -L Chain INPUT (policy ACCEPT) target prot opt source destination Chain FORWARD (policy ACCEPT) target prot opt source destination Chain OUTPUT (policy ACCEPT) target prot opt source destination

    Read the article

  • How can I slightly delay the pop up of the task bar?

    - by Xavierjazz
    Windows XP SP3 Many times as I head to the bottom of my desktop, I will slightly overshoot the target at the bottom and the task bar will pop up, hiding the target. I then have to move the cursor out of it so it retreats and then again try to access the target. Is there a way to add an interval, say, 1 second, to the task bar popping up so I can adjust to the target before the task bar covers it? EDIT: as per my answer below, "What I ended up doing is just docking it on the LH side of the screen. There is no change in response but I don't go to that location so often so it's much better.".

    Read the article

  • How to get physical partition name from iSCSI details on Windows?

    - by Barry Kelly
    I've got a piece of software that needs the name of a partition in \Device\Harddisk2\Partition1 style, as shown e.g. in WinObj. I want to get this partition name from details of the iSCSI connection that underlies the partition. The trouble is that disk order is not fixed - depending on what devices are connected and initialized in what order, it can move around. So suppose I have the portal name (DNS of the iSCSI target), target IQN, etc. I'd like to somehow discover which volumes in the system relate to it, in an automated fashion. I can write some PowerShell WMI queries that get somewhat close to the desired info: PS> get-wmiobject -class Win32_DiskPartition NumberOfBlocks : 204800 BootPartition : True Name : Disk #0, Partition #0 PrimaryPartition : True Size : 104857600 Index : 0 ... From the Name here, I think I can fabricate the corresponding name by adding 1 to the partition number: \Device\Harddisk0\Partition1 - Partition0 appears to be a fake partition mapping to the whole disk. But the above doesn't have enough information to map to the underlying physical device, unless I take a guess based on exact size matching. I can get some info on SCSI devices, but it's not helpful in joining things up (iSCSI target is Nexenta/Solaris COMSTAR): PS> get-wmiobject -class Win32_SCSIControllerDevice __GENUS : 2 __CLASS : Win32_SCSIControllerDevice ... Antecedent : \\COBRA\root\cimv2:Win32_SCSIController.DeviceID="ROOT\\ISCSIPRT\\0000" Dependent : \\COBRA\root\cimv2:Win32_PnPEntity.DeviceID="SCSI\\DISK&VEN_NEXENTA&PROD_COMSTAR... Similarly, I can run queries like these: PS> get-wmiobject -namespace ROOT\WMI -class MSiSCSIInitiator_TargetClass PS> get-wmiobject -namespace ROOT\WMI -class MSiSCSIInitiator_PersistentDevices These guys return information relating to my iSCSI target name and the GUID volume name respectively (a volume name like \\?\Volume{guid-goes-here}), but the GUID volume name is no good to me, and there doesn't appear to be a reliable correspondence between the target name and the volume that I can join on. I simply can't find an easy way of getting from an IQN (e.g. iqn.1992-01.com.example:storage:diskarrays-sn-a8675309) to physical partitions mapped from that target. The way I do it by hand? I start Disk Management, and look for a partition of the correct size, verify that its driver says NEXENTA COMSTAR, and look at the disk number. But even this is unreliable if I have multiple iSCSI volumes of the exact same size. Any suggestions?

    Read the article

  • iptables rule(s) to send openvpn traffic from clients over an sshuttle tunnel?

    - by Sam Martin
    I have an Ubuntu 12.04 box with OpenVPN. The VPN is working as expected -- clients can connect, browse the Web, etc. The OpenVPN server IP is 10.8.0.1 on tun0. On that same box, I can use sshuttle to tunnel into another network to access a Web server on 10.10.0.9. sshuttle does its magic using the following iptables commands: iptables -t nat -N sshuttle-12300 iptables -t nat -F sshuttle-12300 iptables -t nat -I OUTPUT 1 -j sshuttle-12300 iptables -t nat -I PREROUTING 1 -j sshuttle-12300 iptables -t nat -A sshuttle-12300 -j REDIRECT --dest 10.10.0.0/24 -p tcp --to-ports 12300 -m ttl ! --ttl 42 iptables -t nat -A sshuttle-12300 -j RETURN --dest 127.0.0.0/8 -p tcp Is it possible to forward traffic from OpenVPN clients over the sshuttle tunnel to the remote Web server? I'd ultimately like to be able to set up any complicated tunneling on the server, and have relatively "dumb" clients (iPad, etc.) be able to access the remote servers via OpenVPN. Below is a basic diagram of the scenario: [Edit: added output from the OpenVPN box] $ sudo iptables -nL -v -t nat Chain PREROUTING (policy ACCEPT 1498 packets, 252K bytes) pkts bytes target prot opt in out source destination 1512 253K sshuttle-12300 all -- * * 0.0.0.0/0 0.0.0.0/0 Chain INPUT (policy ACCEPT 322 packets, 58984 bytes) pkts bytes target prot opt in out source destination Chain OUTPUT (policy ACCEPT 584 packets, 43241 bytes) pkts bytes target prot opt in out source destination 587 43421 sshuttle-12300 all -- * * 0.0.0.0/0 0.0.0.0/0 Chain POSTROUTING (policy ACCEPT 589 packets, 43595 bytes) pkts bytes target prot opt in out source destination 1175 76298 MASQUERADE all -- * eth0 10.8.0.0/24 0.0.0.0/0 Chain sshuttle-12300 (2 references) pkts bytes target prot opt in out source destination 17 1076 REDIRECT tcp -- * * 0.0.0.0/0 10.10.0.0/24 TTL match TTL != 42 redir ports 12300 0 0 RETURN tcp -- * * 0.0.0.0/0 127.0.0.0/8 $ sudo iptables -nL -v -t filter Chain INPUT (policy ACCEPT 97493 packets, 30M bytes) pkts bytes target prot opt in out source destination Chain FORWARD (policy ACCEPT 0 packets, 0 bytes) pkts bytes target prot opt in out source destination 131K 109M ACCEPT all -- * * 0.0.0.0/0 0.0.0.0/0 state RELATED,ESTABLISHED 1370 89160 ACCEPT all -- * * 10.8.0.0/24 0.0.0.0/0 0 0 REJECT all -- * * 0.0.0.0/0 0.0.0.0/0 reject-with icmp-port-unreachable [Edit 2: more OpenVPN server output] $ netstat -r Kernel IP routing table Destination Gateway Genmask Flags MSS Window irtt Iface default 192.168.1.1 0.0.0.0 UG 0 0 0 eth0 10.8.0.0 10.8.0.2 255.255.255.0 UG 0 0 0 tun0 10.8.0.2 * 255.255.255.255 UH 0 0 0 tun0 192.168.1.0 * 255.255.255.0 U 0 0 0 eth0 [Edit 3: still more debug output] IP forwarding appears to be enabled correctly on the OpenVPN server: # find /proc/sys/net/ipv4/conf/ -name forwarding -ls -execdir cat {} \; 18926 0 -rw-r--r-- 1 root root 0 Mar 5 13:31 /proc/sys/net/ipv4/conf/all/forwarding 1 18954 0 -rw-r--r-- 1 root root 0 Mar 5 13:31 /proc/sys/net/ipv4/conf/default/forwarding 1 18978 0 -rw-r--r-- 1 root root 0 Mar 5 13:31 /proc/sys/net/ipv4/conf/eth0/forwarding 1 19003 0 -rw-r--r-- 1 root root 0 Mar 5 13:31 /proc/sys/net/ipv4/conf/lo/forwarding 1 19028 0 -rw-r--r-- 1 root root 0 Mar 5 13:31 /proc/sys/net/ipv4/conf/tun0/forwarding 1 Client routing table: $ netstat -r Routing tables Internet: Destination Gateway Flags Refs Use Netif Expire 0/1 10.8.0.5 UGSc 8 48 tun0 default 192.168.1.1 UGSc 2 1652 en1 10.8.0.1/32 10.8.0.5 UGSc 1 0 tun0 10.8.0.5 10.8.0.6 UHr 13 0 tun0 10.10.0/24 10.8.0.5 UGSc 0 0 tun0 <snip> Traceroute from client: $ traceroute 10.10.0.9 traceroute to 10.10.0.9 (10.10.0.9), 64 hops max, 52 byte packets 1 10.8.0.1 (10.8.0.1) 5.403 ms 1.173 ms 1.086 ms 2 192.168.1.1 (192.168.1.1) 4.693 ms 2.110 ms 1.990 ms 3 l100.my-verizon-garbage (client-ext-ip) 7.453 ms 7.089 ms 6.248 ms 4 * * * 5 10.10.0.9 (10.10.0.9) 14.915 ms !N * 6.620 ms !N

    Read the article

  • Django HttpResponseRedirect acting as proxy rather than 302

    - by Trevor Burnham
    I have a Django method that's returning return HttpResponseRedirect("/redirect-target") When running the server locally, if I visit the page that returns that redirect, I get the log output [17/Oct/2013 15:26:02] "GET /redirecter HTTP/1.1" 302 0 [17/Oct/2013 15:26:02] "GET /redirect-target HTTP/1.1" 404 0 as expected. But, when I visit that page in Chrome, the Network tab shows the request to /redirecter with the response from /redirect-target, rather than showing the 302. cURL does the same: $ curl -I -X GET http://localhost/redirecter HTTP/1.1 404 Not Found date: Thu, 17 Oct 2013 19:32:30 GMT connection: keep-alive transfer-encoding: chunked In production, the same Django code does show a 302 redirect in Chrome and cURL. What could be going on here? Is there some kind of Django setting that might be causing it to proxy the target rather than send a redirect when HttpResponseRedirect is used (but lie about it in the log)? Or is there a quirk on my system (OS X) that might cause localhost redirects to behave this way?

    Read the article

  • How to forward OpenVPN Port to NAT'd XEN domU

    - by John
    I want to install a OpenVPN domU on XEN. Dom0 and domU are running Debian Squeeze, all domU are on a NAT'd privat network 10.0.0.1/24 My VPN-Gate is von 10.0.0.1 and running. How can I make it accessible under the dom0 public IP? I tried forwarding the port using iptables, but without any success. Here is what i did: ~ # iptables -L -n -v Chain INPUT (policy ACCEPT 1397 packets, 118K bytes) pkts bytes target prot opt in out source destination Chain FORWARD (policy ACCEPT 930 packets, 133K bytes) pkts bytes target prot opt in out source destination 0 0 ACCEPT all -- * * 0.0.0.0/0 0.0.0.0/0 state RELATED,ESTABLISHED PHYSDEV match --physdev-out vif5.0 0 0 ACCEPT udp -- * * 0.0.0.0/0 0.0.0.0/0 PHYSDEV match --physdev-in vif5.0 udp spt:68 dpt:67 0 0 ACCEPT all -- * * 0.0.0.0/0 0.0.0.0/0 state RELATED,ESTABLISHED PHYSDEV match --physdev-out vif5.0 0 0 ACCEPT all -- * * 10.0.0.1 0.0.0.0/0 PHYSDEV match --physdev-in vif5.0 0 0 ACCEPT all -- * * 0.0.0.0/0 0.0.0.0/0 state RELATED,ESTABLISHED PHYSDEV match --physdev-out vif3.0 0 0 ACCEPT udp -- * * 0.0.0.0/0 0.0.0.0/0 PHYSDEV match --physdev-in vif3.0 udp spt:68 dpt:67 0 0 ACCEPT all -- * * 0.0.0.0/0 0.0.0.0/0 state RELATED,ESTABLISHED PHYSDEV match --physdev-out vif3.0 0 0 ACCEPT all -- * * 10.0.0.5 0.0.0.0/0 PHYSDEV match --physdev-in vif3.0 0 0 ACCEPT all -- * * 0.0.0.0/0 0.0.0.0/0 state RELATED,ESTABLISHED PHYSDEV match --physdev-out vif2.0 0 0 ACCEPT udp -- * * 0.0.0.0/0 0.0.0.0/0 PHYSDEV match --physdev-in vif2.0 udp spt:68 dpt:67 0 0 ACCEPT all -- * * 0.0.0.0/0 0.0.0.0/0 state RELATED,ESTABLISHED PHYSDEV match --physdev-out vif2.0 0 0 ACCEPT all -- * * 10.0.0.2 0.0.0.0/0 PHYSDEV match --physdev-in vif2.0 147 8236 ACCEPT tcp -- eth0 * 0.0.0.0/0 0.0.0.0/0 state NEW tcp dpt:80 13 546 ACCEPT udp -- eth0 * 0.0.0.0/0 0.0.0.0/0 udp dpt:1194 Chain OUTPUT (policy ACCEPT 1000 packets, 99240 bytes) pkts bytes target prot opt in out source destination ~ # iptables -L -t nat -n -v Chain PREROUTING (policy ACCEPT 324 packets, 23925 bytes) pkts bytes target prot opt in out source destination 139 7824 DNAT tcp -- eth0 * 0.0.0.0/0 0.0.0.0/0 tcp dpt:80 to:10.0.0.5:80 1 42 DNAT udp -- * * 0.0.0.0/0 0.0.0.0/0 udp dpt:1194 to:10.0.0.1:1194 Chain POSTROUTING (policy ACCEPT 92 packets, 5030 bytes) pkts bytes target prot opt in out source destination 863 64983 MASQUERADE all -- * eth0 0.0.0.0/0 0.0.0.0/0 0 0 MASQUERADE all -- * eth0 0.0.0.0/0 0.0.0.0/0 0 0 MASQUERADE all -- * eth0 0.0.0.0/0 0.0.0.0/0 Chain OUTPUT (policy ACCEPT 180 packets, 13953 bytes) pkts bytes target prot opt in out source destination

    Read the article

  • Bandwidth monitoring with iptables for non-router machine

    - by user1591276
    I came across this tutorial here that describes how to monitor bandwidth using iptables. I wanted to adapt it for a non-router machine, so I want to know how much data is going in/coming out and not passing through. Here are the rules I added: iptables -N ETH0_IN iptables -N ETH0_OUT iptables -I INPUT -i eth0 -j ETH0_IN iptables -I OUTPUT -o eth0 -j ETH0_OUT And here is a sample of the output: user@host:/tmp$ sudo iptables -x -vL -n Chain INPUT (policy ACCEPT 1549 packets, 225723 bytes) pkts bytes target prot opt in out source destination 199 54168 ETH0_IN all -- eth0 * 0.0.0.0/0 0.0.0.0/0 Chain FORWARD (policy ACCEPT 0 packets, 0 bytes) pkts bytes target prot opt in out source destination Chain OUTPUT (policy ACCEPT 1417 packets, 178128 bytes) pkts bytes target prot opt in out source destination 201 19597 ETH0_OUT all -- * eth0 0.0.0.0/0 0.0.0.0/0 Chain ETH0_IN (1 references) pkts bytes target prot opt in out source destination Chain ETH0_OUT (1 references) pkts bytes target prot opt in out source destination As seen above, there are no packet and byte values for ETH0_IN and ETH0_OUT, which is not the same result in the tutorial I referenced. Is there a mistake that I made somewhere? Thanks for your time.

    Read the article

< Previous Page | 29 30 31 32 33 34 35 36 37 38 39 40  | Next Page >