Search Results

Search found 8800 results on 352 pages for 'import'.

Page 333/352 | < Previous Page | 329 330 331 332 333 334 335 336 337 338 339 340  | Next Page >

• How can I prevent external MSBuild files from being cached (by Visual Studio) during a project build

  - by Damian Powell

  I have a project in my solution which started life as a C# library project. It's got nothing of any interest in it in terms of code, it is merely used as a dependency in the other projects in my solution in order to ensure that it is built first. One of the side-effects of building this project is that a shared AssemblyInfo.cs is created which contains the version number in use by the other projects. I have done this by adding the following to the .csproj file: <ItemGroup> <None Include="Properties\AssemblyInfo.Shared.cs.in" /> <Compile Include="Properties\AssemblyInfo.Shared.cs" /> <None Include="VersionInfo.targets" /> </ItemGroup> <Import Project="$(ProjectDir)VersionInfo.targets" /> <Target Name="BeforeBuild" DependsOnTargets="UpdateSharedAssemblyInfo" /> The referenced file, VersionInfo.targets, contains the following: <Project ToolsVersion="4.0" DefaultTargets="Build" xmlns="http://schemas.microsoft.com/developer/msbuild/2003"> <PropertyGroup> <!-- Some properties defining tool locations and the name of the AssemblyInfo.Shared.cs.in file etc. --> </PropertyGroup> <Target Name="UpdateSharedAssemblyInfo"> <!-- Uses the Exec task to run one of the tools to generate AssemblyInfo.Shared.cs based on the location of AssemblyInfo.Shared.cs.in and some of the other properties. --> </Target> </Project> The contents of the VersionInfo.targets file could simply be embedded within the .csproj file but it is external because I am trying to turn all of this into a project template. I want the users of the template to be able to add the new project to the solution, edit the VersionInfo.targets file, and run the build. The problem is that modifying and saving the VersionInfo.targets file and rebuilding the solution has no effect - the project file uses the values from the .targets file as they were when the project was opened. Even unloading and reloading the project has no effect. In order to get the new values, I need to close Visual Studio and reopen it (or reload the solution). How can I set this up so that the configuration is external to the .csproj file and not cached between builds?

  Read the article

• Static method not called

  - by Smile

  I'm trying to call a static method (printABC()) in this class but it's not working. If I uncomment both of the lines marked T_T (1 and 2), it works! Why does it fail with only one of the lines? import java.util.Scanner; class pro0009 { static Scanner in = new Scanner(System.in); static int A,B,C; static void printABC(){ String ABC = in.nextLine(); ABC=ABC.replace("A"," "+A+" "); ABC=ABC.replace("B"," "+B+" "); ABC=ABC.replace("C"," "+C+" "); //System.out.print(ABC.substring(1)); System.out.print(ABC); } public static void main(String[] args){ int x = in.nextInt(); //1 int y = in.nextInt(); //2 int z = in.nextInt(); //3 if(x<y){//1<2 if(x<z){ //1<3 if(y<z){//x<y<z 2<3 //1<2<3 A=x; B=y; C=z; printABC();//T_T 1 System.out.println("Here"); //pro0009.printABC();//T_T 2 //System.out.println("Here2"); }else{ //x<z<y A=x; B=z; C=y; } }else{//z<x<y A=z; B=x; C=y; } }else{//y<x if(y<z){ if(x<z){//y<x<z A=y; B=x; C=z; }else{//y<z<x A=y; B=z; C=x; } }else{//z<y<x A=z; B=y; C=x; } } } }

  Read the article

• Best way to run remote VBScript in ASP.net? WMI or PsExec?

  - by envinyater

  I am doing some research to find out the best and most efficient method for this. I will need to execute remote scripts on a number of Window Servers/Computers (while we are building them). I have a web application that is going to automate this task, I currently have my prototype working to use PsExec to execute remote scripts. This requires PsExec to be installed on the system. A colleague suggested I should use WMI for this. I did some research in WMI and I couldn't find what I'm looking for. I want to either upload the script to the server and execute it and read the results, or already have the script on the server and execute it and read the results. I would prefer the first option though! Which is more ideal, PsExec or WMI? For reference, this is my prototype PsExec code. This script is only executing a small script to get the Windows OS and Service Pack Info. Protected Sub windowsScript(ByVal COMPUTERNAME As String) ' Create an array to store VBScript results Dim winVariables(2) As String nameLabel.Text = Name.Text ' Use PsExec to execute remote scripts Dim Proc As New System.Diagnostics.Process ' Run PsExec locally Proc.StartInfo = New ProcessStartInfo("C:\Windows\psexec.exe") ' Pass in following arguments to PsExec Proc.StartInfo.Arguments = COMPUTERNAME & " -s cmd /C c:\systemInfo.vbs" Proc.StartInfo.RedirectStandardInput = True Proc.StartInfo.RedirectStandardOutput = True Proc.StartInfo.UseShellExecute = False Proc.Start() ' Pause for script to run System.Threading.Thread.Sleep(1500) Proc.Close() System.Threading.Thread.Sleep(2500) 'Allows the system a chance to finish with the process. Dim filePath As String = COMPUTERNAME & "\TTO\somefile.txt" 'Download file created by script on Remote system to local system My.Computer.Network.DownloadFile(filePath, "C:\somefile.txt") System.Threading.Thread.Sleep(1000) ' Pause so file gets downloaded ''Import data from text file into variables textRead("C:\somefile.txt", winVariables) WindowsOSLbl.Text = winVariables(0).ToString() SvcPckLbl.Text = winVariables(1).ToString() System.Threading.Thread.Sleep(1000) ' ''Delete the file on server - we don't need it anymore Dim Proc2 As New System.Diagnostics.Process Proc2.StartInfo = New ProcessStartInfo("C:\Windows\psexec.exe") Proc2.StartInfo.Arguments = COMPUTERNAME & " -s cmd /C del c:\somefile.txt" Proc2.StartInfo.RedirectStandardInput = True Proc2.StartInfo.RedirectStandardOutput = True Proc2.StartInfo.UseShellExecute = False Proc2.Start() System.Threading.Thread.Sleep(500) Proc2.Close() ' Delete file locally File.Delete("C:\somefile.txt") End Sub

  Read the article

• Will this ever result in a stack overflow error?

  - by David

  Will incrementing the instance variables of an object ever lead to a stack overflow error? For example: This method (java) will cause a stack overflow error: class StackOverflow { public static void StackOverflow (int x) { System.out.println (x) ; StackOverflow(x+1) ; } public static void main (String[]arg) { StackOverflow (0) ; } but will this?: (..... is a gap that i've put in to shorten the code. its long enough as it is.) import java.util.*; class Dice { String name ; int x ; int[] sum ; .... public Dice (String name) { this.name = name ; this.x = 0 ; this.sum = new int[7] ; } .... public static void main (String[] arg) { Dice a1 = new Dice ("a1") ; for (int i = 0; i<6000000; i++) { a1.roll () ; printDice(a1) ; } } .... public void roll () { this.x = randNum(1, this.sum.length) ; this.sum[x] ++ ; } public static int randNum (int a, int b) { Random random = new Random() ; int c = (b-a) ; int randomNumber = ((random.nextInt(c)) + a) ; return randomNumber ; } public static void printDice (Dice Dice) { System.out.println (Dice.name) ; System.out.println ("value: "+Dice.x) ; printValues (Dice) ; } public static void printValues (Dice Dice) { for (int i = 0; i<Dice.sum.length; i++) System.out.println ("#of "+i+"'s: "+Dice.sum[i]) ; } } The above doesn't currently cause a stack overflow error but could i get it too if i changed this line in main: for (int i = 0; i<6000000; i++) so that instead of 6 million something sufficiently high were there?

  Read the article

• Getting instance crashes on IntelliJ IDEA with scala plugin.

  - by egervari

  I am building a scala web project using scala test, lift, jpa, hibernate, mercurial plugin, etc. I am getting instant crashes, where the ide just bombs, the window shuts down, and it gives no error messages whatsoever when I am doing any amount of copy/pasting of code. This started happening once my project got to about 100 unit tests. This problem is incredibly annoying, because when the crash happens, 30-60 seconds of activity is not saved. Even IDEA will forget which files were last opened and will forget where the cursor was, which makes it really hard to continue where you left off after the crash. A lot can happen in 60 seconds! Now, I've given up, because it seems like all sorts of things cause the IntelliJ IDEA to crash over and over. For example, if I were to copy and paste this code, to write a similar test for another collection type, it would crash shortly after: it should "cascade save and delete status messages" in { val statusMessage = new StatusMessage("message") var user = userDao.find(1).get user.addToStatusMessages(statusMessage) userDao.save(user) statusMessage.isPersistent should be (true) userDao.delete(user) statusMessageDao.find(statusMessage.id) should equal (None) } There is nothing special about this piece of code. It's code that is working just fine. However, IDEA bombs shortly after I paste something like this. For example, I might change StatusMessage to the new class I want to test cascading on... and then have to import that class into the test... and BOOM... it crashed. On windows 7, the IDEA window literally just minimizes and crashes with no warning. The next time I startup IDEA, it has no memory of what happened. Now, I've had this problem before. I posted it way back on IDEA's YouTrack. I was told to invalidate my caches. That never fixed it then, and it's not fixing it now. Please help. This error is fairly random, but it's happening constantly now. I could program for hours and not see it before... and the fact that my work just gets destroyed and I can't remember what I did during the last minute causes me to swear at my monitor at a db level higher than my stereo can go.

  Read the article

• I want to get the value from one class (SearchTableViewController.m) to another class (HistoryTableV

  - by ahmet732

  #import <UIKit/UIKit.h> @class SearchDetailViewController; @interface SearchTableViewController : UITableViewController <UISearchBarDelegate, UITableViewDelegate, UITableViewDataSource>{ IBOutlet UITableView *myTableView; NSMutableArray *tableData;//will be storing data that will be displayed in table. //Search array den buna aktarma yapcaz ilerde görceksin. NSMutableArray *searchedData;//will be storing data matching with the search string UISearchBar *sBar;//search bar NSMutableArray *searchArray; // It holds the medicines that are shown in tableview SearchDetailViewController * searchDetailViewController; NSMutableArray *deneme; } @property(nonatomic,retain)UISearchBar *sBar; @property(nonatomic,retain)IBOutlet UITableView *myTableView; @property(nonatomic,retain)NSMutableArray *tableData; @property(nonatomic,retain)NSMutableArray *searchedData; @property (nonatomic, retain) NSMutableArray *searchArray; @property (nonatomic, retain) SearchDetailViewController *searchDetailViewController; @property (nonatomic, copy) NSMutableArray *deneme; @end SearchTableViewController.m - (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { // Navigation logic may go here. Create and push another view controller. // AnotherViewController *anotherViewController = [[AnotherViewController alloc] initWithNibName:@"AnotherView" bundle:nil]; // [self.navigationController pushViewController:anotherViewController]; // [anotherViewController release]; **deneme= [[NSMutableArray alloc]init]; deneme=[tableData objectAtIndex:indexPath.row];** ****NSLog(@"my row = %@", deneme);**// I holded one of the selected cells here** HistoryTableViewController.m - (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { // Navigation logic may go here. Create and push another view controller. // AnotherViewController *anotherViewController = [[AnotherViewController alloc] initWithNibName:@"AnotherView" bundle:nil]; // [self.navigationController pushViewController:anotherViewController]; // [anotherViewController release]; **SearchTableViewController *obj= [[SearchTableViewController alloc]init];** **NSLog(@"my 2nd row= %@", [obj deneme]); //it prints nil** } My project is TabBar. There are two buttons on it- Search and History. I want to display selected items in a table in History tab. But i can not bring the selected item from SearchTableViewController.m to the class (HistoryTableViewController.m) The problem is : I can hold one of the selected items in an array (named deneme)from table in SearchTableViewController.m but i can not take it to HistoryTableViewController.m. It prints nil in console screen.... If I can make it visible in History class, I display those selected items on table. Please help me !!!

  Read the article

• Django: Grouping by Dates and Servers

  - by TheLizardKing

  So I am trying to emulate google app's status page: http://www.google.com/appsstatus#hl=en but for backups for our own servers. Instead of service names on the left it'll be server names but the dates and hopefully the pagination will be there too. My models look incredibly similar to this: from django.db import models STATUS_CHOICES = ( ('UN', 'Unknown'), ('NI', 'No Issue'), ('IS', 'Issue'), ('NR', 'Not Running'), ) class Server(models.Model): name = models.CharField(max_length=32) def __unicode__(self): return self.name class Backup(models.Model): server = models.ForeignKey(Server) created = models.DateField(auto_now_add=True) modified = models.DateTimeField(auto_now=True) status = models.CharField(max_length=2, choices=STATUS_CHOICES, default='UN') issue = models.TextField(blank=True) def __unicode__(self): return u'%s: %s' % (self.server, self.get_status_display()) My issue is that I am having a hell of a time displaying the information I need. Everyday a little after midnight a cron job will run and add a row for each server for that day, defaulting on status unknown (UN). My backups.html: {% extends "base.html" %} {% block content %} <table> <tr> <th>Name</th> {% for server in servers %} <th>{{ created }}</th> </tr> <tr> <td>{{ server.name }}</td> {% for backup in server.backup_set.all %} <td>{{ backup.get_status_display }}</td> {% endfor %} </tr> {% endfor %} </table> {% endblock content %} This actually works but I do not know how to get the dates to show. Obviously {{ created }} doesn't do anything but the servers don't have create dates. Backups do and because it's a cron job there should only be X number of rows with any particular date (depending on how many servers we are following for that day). Summary I want to create a table, X being server names, Y being dates starting at today while all the cells being the status of a backup. The above model and template should hopefully give you an idea what my thought process but I am willing to alter anything. Basically I am create a fancy excel spreadsheet.

  Read the article

• overwrite existing entity via bulkloader.Loader

  - by Ray Yun

  I was going to CSV based export/import for large data with app engine. My idea was just simple. First column of CSV would be key of entity. If it's not empty, that row means existing entity and should overwrite old one. Else, that row is new entity and should create new one. I could export key of entity by adding key property. class FrontExporter(bulkloader.Exporter): def __init__(self): bulkloader.Exporter.__init__(self, 'Front', [ ('__key__', str, None), ('name', str, None), ]) But when I was trying to upload CSV, it had failed because bulkloader.Loader.generate_key() was just for "key_name" not "key" itself. That means all exported entities in CSV should have unique 'key_name' if I want to modify-and-reupload them. class FrontLoader(bulkloader.Loader): def __init__(self): bulkloader.Loader.__init__(self, 'Front', [ ('_UNUSED', lambda x: None), ('name', lambda x: x.decode('utf-8')), ]) def generate_key(self,i,values): # first column is key keystr = values[0] if len(keystr)==0: return None return keystr I also tried to load key directly without using generate_key(), but both failed. class FrontLoader(bulkloader.Loader): def __init__(self): bulkloader.Loader.__init__(self, 'Front', [ ('Key', db.Key), # not working. just create new one. ('__key__', db.Key), # same... So, how can I overwrite existing entity which has no 'key_name'? It would be horrible if I should give unique name to all entities..... From the first answer, I could handle this problem. :) def create_entity(self, values, key_name=None, parent=None): # if key_name is None: # print 'key_name is None' # else: # print 'key_name=<',key_name,'> : length=',len(key_name) Validate(values, (list, tuple)) assert len(values) == len(self._Loader__properties), ( 'Expected %d columns, found %d.' % (len(self._Loader__properties), len(values))) model_class = GetImplementationClass(self.kind) properties = { 'key_name': key_name, 'parent': parent, } for (name, converter), val in zip(self._Loader__properties, values): if converter is bool and val.lower() in ('0', 'false', 'no'): val = False properties[name] = converter(val) if key_name is None: entity = model_class(**properties) #print 'create new one' else: entity = model_class.get(key_name) for key, value in properties.items(): setattr(entity, key, value) #print 'overwrite old one' entities = self.handle_entity(entity) if entities: if not isinstance(entities, (list, tuple)): entities = [entities] for entity in entities: if not isinstance(entity, db.Model): raise TypeError('Expected a db.Model, received %s (a %s).' % (entity, entity.__class__)) return entities def generate_key(self,i,values): # first column is key if values[0] is None or values[0] in ('',' ','-','.'): return None return values[0]

  Read the article

• jar dependencies in android- no class definition found exception

  - by Dave.B

  I'm trying to use the gdata java client library on android and have managed a decent hack to get it working. However because the jar for gdata had some package discrepancies with android I had to import the source into my project. This source is dependent on the JavaMail API and the JavaBeans Activation Framework as specified here. My issue is that the JavaMail jar throws a class definition not found when seeking a class which is in the Activation Framework jar. A stack trace is listed below. I am working in Eclipse and have both jars in a lib folder and added to my build path. I'm not very experienced dealing with jars in a situation like this so any help or insight would be appreciated. 03-29 09:55:26.204: ERROR/AndroidRuntime(331): Uncaught handler: thread AsyncTask #3 exiting due to uncaught exception 03-29 09:55:26.215: ERROR/AndroidRuntime(331): java.lang.RuntimeException: An error occured while executing doInBackground() 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at android.os.AsyncTask$3.done(AsyncTask.java:200) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at java.util.concurrent.FutureTask$Sync.innerSetException(FutureTask.java:273) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at java.util.concurrent.FutureTask.setException(FutureTask.java:124) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at java.util.concurrent.FutureTask$Sync.innerRun(FutureTask.java:307) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at java.util.concurrent.FutureTask.run(FutureTask.java:137) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1068) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:561) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at java.lang.Thread.run(Thread.java:1096) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): Caused by: java.lang.NoClassDefFoundError: javax.activation.DataHandler 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at javax.mail.internet.MimeBodyPart.setContent(MimeBodyPart.java:684) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at com.google.gdata.data.media.MediaBodyPart.<init>(MediaBodyPart.java:95) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at com.google.gdata.data.media.MediaMultipart.<init>(MediaMultipart.java:126) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at com.google.gdata.client.media.MediaService.insert(MediaService.java:382) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at android.os.AsyncTask$2.call(AsyncTask.java:185) 03-29 09:55:26.215: ERROR/AndroidRuntime(331): at java.util.concurrent.FutureTask$Sync.innerRun(FutureTask.java:305)

  Read the article

• Help with listView in Android

  - by jul

  Hi, I'm just starting with Android and can't find how to display a list in my activity. I get some restaurant data from a web service and I'd like to show the results in a list. The activity, the restaurant class and the layout main.xml are shown below. How can I display, for instance, the list of the restaurant names in the ListView 'list' of my layout? thank you Jul public class Atable extends ListActivity { RestaurantList restaurantList; public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); //Here I set restaurantList //Now how can I display, for example, the list of the names of the restaurants } main.xml <LinearLayout android:orientation="horizontal" android:layout_width="fill_parent" android:layout_height="wrap_content"> <TextView android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/search" /> <EditText android:id="@+id/search" android:layout_width="wrap_content" android:layout_height="wrap_content" android:layout_weight="1"/> </LinearLayout> <LinearLayout android:orientation="vertical" android:layout_width="wrap_content" android:layout_height="wrap_content"> <ListView android:id="@+id/android:list" android:layout_width="wrap_content" android:layout_height="wrap_content"/> <TextView android:id="@+id/android:empty" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/noresults"/> </LinearLayout> </LinearLayout> Restaurant list class package org.digitalfarm.atable; import java.util.List; public class RestaurantList { private List<Restaurant> restaurants; public List<Restaurant> getRestaurants() { return restaurants; } public void setRestaurants(List<Restaurant> restaurants) { this.restaurants = restaurants; } } Restaurant class package org.digitalfarm.atable; public class Restaurant { private String name; private float latitude; private float longitude; public String getName() { return name; } public void setName(String name) { this.name = name; } public float getLatitude() { return latitude; } public void setLatitude(float latitude) { this.latitude = latitude; } public float getLongitude() { return longitude; } public void setLongitude(float longitude) { this.longitude = longitude; } }

  Read the article

• Load a 6 MB binary file in a SQL Server 2005 VARBINARY(MAX) column using ADO/VC++?

  - by Feroz Khan

  How to load a binary file(.bin) of size 6 MB in a varbinary(MAX) column of SQL Server 2005 database using ADO in a VC++ application. This is the code I am using to load the file which I used to load a .bmp file: BOOL CSaveView::PutECGInDB(CString strFilePath, FieldPtr pFileData) { //Open File CFile fileImage; CFileStatus fileStatus; fileImage.Open(strFilePath,CFile::modeRead); fileImage.GetStatus(fileStatus); //Alocating memory for data ULONG nBytes = (ULONG)fileStatus.m_size; HGLOBAL hGlobal = GlobalAlloc(GPTR,nBytes); LPVOID lpData = GlobalLock(hGlobal); //Putting data into file fileImage.Read(lpData,nBytes); HRESULT hr; _variant_t varChunk; long lngOffset = 0; UCHAR chData; SAFEARRAY FAR *psa = NULL; SAFEARRAYBOUND rgsabound[1]; try { //Create a safe array to store the BYTES rgsabound[0].lLbound = 0; rgsabound[0].cElements = nBytes; psa = SafeArrayCreate(VT_UI1,1,rgsabound); while(lngOffset<(long)nBytes) { chData = ((UCHAR*)lpData)[lngOffset]; hr = SafeArrayPutElement(psa,&lngOffset,&chData); if(hr != S_OK) { return false; } lngOffset++; } lngOffset = 0; //Assign the safe array to a varient varChunk.vt = VT_ARRAY|VT_UI1; varChunk.parray = psa; hr = pFileData->AppendChunk(varChunk); if(hr != S_OK) { return false; } } catch(_com_error &e) { //get info from _com_error _bstr_t bstrSource(e.Source()); _bstr_t bstrDescription(e.Description()); _bstr_t bstrErrorMessage(e.ErrorMessage()); _bstr_t bstrErrorCode(e.Error()); TRACE("Exception thrown for classes generated by #import"); TRACE("\tCode= %08lx\n",(LPCSTR)bstrErrorCode); TRACE("\tCode Meaning = %s\n",(LPCSTR)bstrErrorMessage); TRACE("\tSource = %s\n",(LPCSTR)bstrSource); TRACE("\tDescription = %s\n",(LPCSTR)bstrDescription); } catch(...) { TRACE("***Unhandle Exception***"); } //Free Memory GlobalUnlock(lpData); return true; } But when I read the same file using Getchunk function it gives me all 0s but the size of the file I get is same as the one uploaded. Your help will be highly appreciated.

  Read the article

• Finding contained bordered regions from Excel imports.

  - by dmaruca

  I am importing massive amounts of data from Excel that have various table layouts. I have good enough table detection routines and merge cell handling, but I am running into a problem when it comes to dealing with borders. Namely performance. The bordered regions in some of these files have meaning. Data Setup: I am importing directly from Office Open XML using VB6 and MSXML. The data is parsed from the XML into a dictionary of cell data. This wonks wonderfully and is just as fast as using docmd.transferspreadsheet in Access, but returns much better results. Each cell contains a pointer to a style element which contains a pointer to a border element that defines the visibility and weight of each border (this is how the data is structured inside OpenXML, also). Challenge: What I'm trying to do is find every region that is enclosed inside borders, and create a list of cells that are inside that region. What I have done: I initially created a BFS(breadth first search) fill routine to find these areas. This works wonderfully and fast for "normal" sized spreadsheets, but gets way too slow for imports into the thousands of rows. One problem is that a border in Excel could be stored in the cell you are checking or the opposing border in the adjacent cell. That's ok, I can consolidate that data on import to reduce the number of checks needed. One thing I thought about doing is to create a separate graph that outlines the cells using the borders as my edges and using a graph algorithm to find regions that way, but I'm having trouble figuring out how to implement the algorithm. I've used Dijkstra in the past and thought I could do similar with this. So I can span out using no endpoint to search the entire graph, and if I encounter a closed node I know that I just found an enclosed region, but how can I know if the route I've found is the optimal one? I guess I could flag that to run a separate check for the found closed node to the previous node ignoring that one edge. This could work, but wouldn't be much better performance wise on dense graphs. Can anyone else suggest a better method? Thanks for taking the time to read this.

  Read the article

• App losing db connection

  - by DaveKub

  I'm having a weird issue with an old Delphi app losing it's database connection. Actually, I think it's losing something else that then makes the connection either drop or be unusable. The app is written in Delphi 6 and uses the Direct Oracle Access component (v4.0.7.1) to connect to an Oracle 9i database. The app runs as a service and periodically queries the db using a TOracleQuery object (qryAlarmList). The method that is called to do this looks like this: procedure TdmMain.RefreshAlarmList; begin try qryAlarmList.Execute; except on E: Exception do begin FStatus := ssError; EventLog.LogError(-1, 'TdmMain.RefreshAlarmList', 'Message: ' + E.Message); end; end; end; It had been running fine for years, until a couple of Perl scripts were added to this machine. These scripts run every 15 minutes and look for datafiles to import into the db, and then they do a some calculations and a bunch of reads/writes to/from the db. For some reason, when they are processing large amounts of data, and then the Delphi app tries to query the db, the Delphi app throws an exception at the "qryAlarmList.Execute" line in the above code listing. The exception is always: Access violation at address 00000000. read of address 00000000 HOW can something that the Perl scripts are doing cause this?? There are other Perl scripts on this machine that load data using the same modules and method calls and we didn't have problems. To make it even weirder, there are two other apps that will also suddenly lose their ability to talk to the database at the same time as the Perl stuff is running. Neither of those apps run on this machine, but both are Delphi 6 apps that use the same DOA component to connect to the same database. We have other apps that connect to the same db, written in Java or C# and they don't seem to have any problems. I've tried adding code before the '.Execute' method is called to: check the session's connection (session.CheckConnection(true); always comes back as 'ccOK'). see whether I can access a field of the qryAlarmList object to see if maybe it's become null; can access it fine. check the state of the qryAlarmList; always says it's qsIdle. Does anyone have any suggestions of something to try? This is driving me nuts! Dave

  Read the article

• Cross-site request forgery protections: Where do I put all these lines?

  - by brilliant

  Hello, I was looking for a python code that would be able to log in from "Google App Engine" to some of my accounts on some websites (like yahoo or eBay) and was given this code: import urllib, urllib2, cookielib url = "https://login.yahoo.com/config/login?" form_data = {'login' : 'my-login-here', 'passwd' : 'my-password-here'} jar = cookielib.CookieJar() opener = urllib2.build_opener(urllib2.HTTPCookieProcessor(jar)) form_data = urllib.urlencode(form_data) # data returned from this pages contains redirection resp = opener.open(url, form_data) # yahoo redirects to http://my.yahoo.com, so lets go there instead resp = opener.open('http://mail.yahoo.com') print resp.read() Unfortunately, this code didn't work, so I asked another question here and one supporter among other things said this: "You send MD5 hash and not plain password. Also you'd have to play along with all kinds of CSRF protections etc. that they're implementing. Look: <input type="hidden" name=".tries" value="1"> <input type="hidden" name=".src" value="ym"> <input type="hidden" name=".md5" value=""> <input type="hidden" name=".hash" value=""> <input type="hidden" name=".js" value=""> <input type="hidden" name=".last" value=""> <input type="hidden" name="promo" value=""> <input type="hidden" name=".intl" value="us"> <input type="hidden" name=".bypass" value=""> <input type="hidden" name=".partner" value=""> <input type="hidden" name=".u" value="bd5tdpd5rf2pg"> <input type="hidden" name=".v" value="0"> <input type="hidden" name=".challenge" value="5qUiIPGVFzRZ2BHhvtdGXoehfiOj"> <input type="hidden" name=".yplus" value=""> <input type="hidden" name=".emailCode" value=""> <input type="hidden" name="pkg" value=""> <input type="hidden" name="stepid" value=""> <input type="hidden" name=".ev" value=""> <input type="hidden" name="hasMsgr" value="0"> <input type="hidden" name=".chkP" value="Y"> <input type="hidden" name=".done" value="http://mail.yahoo.com"> <input type="hidden" name=".pd" value="ym_ver=0&c=&ivt=&sg="> I am not quite sure where he got all these lines from and where in my code I am supposed to add them. Do You have any idea? I know I was supposed to ask him this question first, and I did, but he never returned, so I decided to ask a separate question here.

  Read the article

• How do I solve "405 Method Not Allowed" for our subversion setup?

  - by macke

  We're serving our source code using VisualSVN running on Windows Server 2003. Recently, we split a portion of a project into a new project in it's own repository, and then linked it back to the original project using svn:externals. Since then, we've been having issues when we try to commit files with Subclipse. The error we're getting is: svn: Commit failed (details follow): svn: PROPFIND of '/svn': 405 Method Not Allowed (https://svn.ourserver.com) Googling for a while didn't really help, our config seems to be correct. It should also be noted that we've been running this server for a while no without these problems and apart from splitting the project into two repositories, no changes have been made to the server (ie, config files are the same). It should also be noted that these errors only appear when we try to check in multiple files at once. If we check in one file at a time there are no errors. Also, it only appears in Subclipse as far as we know right now, Versions.app (OS X) seems to work fine so that is our current workaround. So, the questions is how do I analyze the error to find the cause and subsequently fix it? I'm by no means a svn guru and right now I'm clueless. EDIT: It seems we can check in multiple files in the same package, but not files from multiple packages. Also, when I "split" the project into two repositories, I imported the original repository with a new name. I did not do a dump and then import that dump. Could that be the source of our issues, and if so, how would I solve that? EDIT: After some jerking around it seems as though it is indeed related to when checking in files in different repositories. If I try to do a single commit in both Repo A and Repo B (referenced by svn:externals) at the same time, I get the error. Versions.app handles this correctly, but I guess it might just be doing two commits, not a single one. Subclipse fails miserably. For now, we simply do multiple commits, one for Repo A and one for Repo B, that works just fine. If anyone smarter than me could fill in the details why this is happening, whether or not this kind of setup is stupid etc, please go right ahead.

  Read the article

• Sessions not persisting between requests

  - by klonq

  My session objects are only stored within the request scope on google app engine and I can't figure out how to persist objects between requests. The docs are next to useless on this matter and I can't find anyone who's experienced a similar problem. Please help. When I store session objects in the servlet and forward the request to a JSP using: getServletContext().getRequestDispatcher("/example.jsp").forward(request,response); Everything works like it should. But when I store objects to the session and redirect the request using: response.sendRedirect("/example/url"); The session objects are lost to the ether. In fact when I dump session key/value pairs on new requests there is absolutely nothing, session objects only appear within the request scope of servlets which create session objects. It appears to me that the objects are not being written to Memcache or Datastore. In terms of configuring sessions for my application I have set <sessions-enabled>true</sessions-enabled> In appengine-web.xml. Is there anything else I am missing? The single paragraph of documentation on sessions also notes that only objects which implement Serializable can be stored in the session between requests. I have included an example of the code which is not working below. The obvious solution is to not use redirects, and this might be ok for the example given below but some application data does need to be stored in the session between requests so I need to find a solution to this problem. EXAMPLE: The class FlashMessage gives feedback to the user from server-side operations. if (email.send()) { FlashMessage flash = new FlashMessage(FlashMessage.SUCCESS, "Your message has been sent."); session.setAttribute(FlashMessage.SESSION_KEY, flash); // The flash message will not be available in the session object in the next request response.sendRedirect(URL.HOME); } else { FlashMessage flash = new FlashMessage(FlashMessage.ERROR, FlashMessage.INVALID_FORM_DATA); session.setAttribute(FlashMessage.SESSION_KEY, flash); // The flash message is displayed without problem getServletContext().getRequestDispatcher(Templates.CONTACT_FORM).forward(request,response); } FlashMessage.java import java.io.Serializable; public class FlashMessage implements Serializable { private static final long serialVersionUID = 8109520737272565760L; // I have tried using different, default and no serialVersionUID public static final String SESSION_KEY = "flashMessage"; public static final String ERROR = "error"; public static final String SUCCESS = "success"; public static final String INVALID_FORM_DATA = "Your request failed to validate."; private String message; private String type; public FlashMessage (String type, String message) { this.type = type; this.message = message; } public String display(){ return "<div id='flash' class='" + type + "'>" + message + "</div>"; } }

  Read the article

• JSP to Bean to Java class Validation

  - by littlevahn

  I have a rather simple form in JSP that looks like this: <form action="response.jsp" method="POST"> <label>First Name:</label><input type="text" name="firstName" /><br> <label>Last Name:</label><input type="text" name="lastName" /><br> <label>Email:</label><input type="text" name="email" /><br> <label>Re-enter Email:</label><input type="text" name="emailRe" /><br> <label>Address:</label><input type="text" name="address" /><br> <label>Address 2:</label><input type="text" name="address2" /><br> <label>City:</label><input type="text" name="city" /><br> <label>Country:</label> <select name="country"> <option value="0">--Country--</option> <option value="1">United States</option> <option value="2">Canada</option> <option value="3">Mexico</option> </select><br> <label>Phone:</label><input type="text" name="phone" /><br> <label>Alt Phone:</label><input type="text" name="phoneAlt" /><br> <input type="submit" value="submit" /> </form> But when I try and access the value of the select box in my Java class I get null. Ive tried reading it in as a String and an Array of strings neither though seems to be grabbing the right value. The response.jsp looks like this: <%@ page language="java" %> <%@ page import="java.util.*" %> <%@page contentType="text/html" pageEncoding="UTF-8"%> <%! %> <jsp:useBean id="formHandler" class="validation.RegHandler" scope="request"> <jsp:setProperty name="formHandler" property="*" /> </jsp:useBean> <% if (formHandler.validate()) { %> <jsp:forward page="success.jsp"/> <% } else { %> <jsp:forward page="retryReg.jsp"/> <% } %> I already have Java script validation in place but I wanted to make sure I covered validation and checking for non-JS users. The RegHandler just uses the name field to refer to the value in the form. Any Idea how I could access the select box's value?

  Read the article

• Can sorting Japanese kanji words be done programatically?

  - by Mason

  I've recently discovered, to my astonishment (having never really thought about it before), machine-sorting Japanese proper nouns is apparently not possible. I work on an application that must allow the user to select a hospital from a 3-menu interface. The first menu is Prefecture, the second is City Name, and the third is Hospital. Each menu should be sorted, as you might expect, so the user can find what they want in the menu. Let me outline what I have found, as preamble to my question: The expected sort order for Japanese words is based on their pronunciation. Kanji do not have an inherent order (there are tens of thousands of Kanji in use), but the Japanese phonetic syllabaries do have an order: ???????????????????... and on for the fifty traditional distinct sounds (a few of which are obsolete in modern Japanese). This sort order is called ???? (gojuu on jun , or '50-sound order'). Therefore, Kanji words should be sorted in the same order as they would be if they were written in hiragana. (You can represent any kanji word in phonetic hiragana in Japanese.) The kicker: there is no canonical way to determine the pronunciation of a given word written in kanji. You never know. Some kanji have ten or more different pronunciations, depending on the word. Many common words are in the dictionary, and I could probably hack together a way to look them up from one of the free dictionary databases, but proper nouns (e.g. hospital names) are not in the dictionary. So, in my application, I have a list of every prefecture, city, and hospital in Japan. In order to sort these lists, which is a requirement, I need a matching list of each of these names in phonetic form (kana). I can't come up with anything other than paying somebody fluent in Japanese (I'm only so-so) to manually transcribe them. Before I do so though: Is it possible that I am totally high on fire, and there actually is some way to do this sorting without creating my own mappings of kanji words to phonetic readings, that I have somehow overlooked? Is there a publicly available mapping of prefecture/city names, from the government or something? That would reduce the manual mapping I'd need to do to only hospital names. Does anybody have any other advice on how to approach this problem? Any programming language is fine--I'm working with Ruby on Rails but I would be delighted if I could just write a program that would take the kanji input (say 40,000 proper nouns) and then output the phonetic representations as data that I could import into my Rails app. ??????????

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• How to access a field's value in an object using reflection

  - by kentcdodds

  My Question: How to overcome an IllegalAccessException to access the value of a an object's field using reflection. Expansion: I'm trying to learn about reflection to make some of my projects more generic. I'm running into an IllegalAccessException when trying to call field.getValue(object) to get the value of that field in that object. I can get the name and type just fine. If I change the declaration from private to public then this works fine. But in an effort to follow the "rules" of encapsulation I don't want to do this. Any help would be greatly appreciated! Thanks! My Code: package main; import java.lang.reflect.Field; public class Tester { public static void main(String args[]) throws Exception { new Tester().reflectionTest(); } public void reflectionTest() throws Exception { Person person = new Person("John Doe", "555-123-4567", "Rover"); Field[] fields = person.getClass().getDeclaredFields(); for (Field field : fields) { System.out.println("Field Name: " + field.getName()); System.out.println("Field Type: " + field.getType()); System.out.println("Field Value: " + field.get(person)); //The line above throws: Exception in thread "main" java.lang.IllegalAccessException: Class main.Tester can not access a member of class main.Tester$Person with modifiers "private final" } } public class Person { private final String name; private final String phoneNumber; private final String dogsName; public Person(String name, String phoneNumber, String dogsName) { this.name = name; this.phoneNumber = phoneNumber; this.dogsName = dogsName; } } } The Output: run: Field Name: name Field Type: class java.lang.String Exception in thread "main" java.lang.IllegalAccessException: Class main.Tester can not access a member of class main.Tester$Person with modifiers "private final" at sun.reflect.Reflection.ensureMemberAccess(Reflection.java:95) at java.lang.reflect.AccessibleObject.slowCheckMemberAccess(AccessibleObject.java:261) at java.lang.reflect.AccessibleObject.checkAccess(AccessibleObject.java:253) at java.lang.reflect.Field.doSecurityCheck(Field.java:983) at java.lang.reflect.Field.getFieldAccessor(Field.java:927) at java.lang.reflect.Field.get(Field.java:372) at main.Tester.reflectionTest(Tester.java:17) at main.Tester.main(Tester.java:8) Java Result: 1 BUILD SUCCESSFUL (total time: 0 seconds)

  Read the article

• A question about making a C# class persistent during a file load

  - by Adam

  Apologies for the indescriptive title, however it's the best I could think of for the moment. Basically, I've written a singleton class that loads files into a database. These files are typically large, and take hours to process. What I am looking for is to make a method where I can have this class running, and be able to call methods from within it, even if it's calling class is shut down. The singleton class is simple. It starts a thread that loads the file into the database, while having methods to report on the current status. In a nutshell it's al little like this: public sealed class BulkFileLoader { static BulkFileLoader instance = null; int currentCount = 0; BulkFileLoader() public static BulkFileLoader Instance { // Instanciate the instance class if necessary, and return it } public void Go() { // kick of 'ProcessFile' thread } public void GetCurrentCount() { return currentCount; } private void ProcessFile() { while (more rows in the import file) { // insert the row into the database currentCount++; } } } The idea is that you can get an instance of BulkFileLoader to execute, which will process a file to load, while at any time you can get realtime updates on the number of rows its done so far using the GetCurrentCount() method. This works fine, except the calling class needs to stay open the whole time for the processing to continue. As soon as I stop the calling class, the BulkFileLoader instance is removed, and it stops processing the file. What I am after is a solution where it will continue to run independently, regardless of what happens to the calling class. I then tried another approach. I created a simple console application that kicks off the BulkFileLoader, and then wrapped it around as a process. This fixes one problem, since now when I kick off the process, the file will continue to load even if I close the class that called the process. However, now the problem I have is that cannot get updates on the current count, since if I try and get the instance of BulkFileLoader (which, as mentioned before is a singleton), it creates a new instance, rather than returning the instance that is currently in the executing process. It would appear that singletons don't extend into the scope of other processes running on the machine. In the end, I want to be able to kick off the BulkFileLoader, and at any time be able to find out how many rows it's processed. However, that is even if I close the application I used to start it. Can anyone see a solution to my problem?

  Read the article

• POST parameters strangely parsed inside phantomjs

  - by user61629

  I am working with PHP/CURL and would like to send POST data to my phantomjs script, by setting the postfields array below: In my php controller I have: $data=array('first' => 'John', 'last' => 'Smith'); $url='http://localhost:7788/'; $output = $this->my_model->get_data($url,$data); In my php model I have: public function get_data($url,$postFieldArray) { $ch = curl_init(); curl_setopt($ch, CURLOPT_COOKIEJAR, $cookieFile); curl_setopt($ch, CURLOPT_FOLLOWLOCATION, TRUE); curl_setopt($ch, CURLOPT_RETURNTRANSFER, TRUE); curl_setopt($ch, CURLOPT_USERAGENT, "Mozilla/4.0 (compatible; MSIE 7.0; Windows NT 6.0)"); curl_setopt($ch, CURLOPT_POST, TRUE); curl_setopt($ch, CURLOPT_POSTFIELDS, $postFieldArray); curl_setopt($ch, CURLOPT_URL, $url); $output = curl_exec($ch); In my phantomJS script that I am running locally I have: // import the webserver module, and create a server var server = require('webserver').create(); var port = require('system').env.PORT || 7788; console.log("Start Application"); console.log("Listen port " + port); // Create serever and listen port server.listen(port, function(request, response) { // Print some information Just for debbug console.log("We got some requset !!!"); console.log("request method: ", request.method); // request.method POST or GET if(request.method == 'POST' ){ console.log("POST params should be next: "); console.log("POST params: ",request.post); exit; } I first start and run the phantomjs script (myscript.js) from the command line, then I run my php script. The output is: $ phantomjs.exe myscript.js Start Application Listen port 7788 null We got some requset !!! request method: POST POST params should be next: POST params: ------------------------------e70d439800f9 Content-Disposition: form-data; name="first" John ------------------------------e70d439800f9 Content-Disposition: form-data; name="last" Smith ------------------------------e70d439800f9-- I'm confused about the the output. I was expecting something more like: first' => 'John', 'last' => 'Smith Can someone explain why it looks this way? How can I parse the request.post object to assign to variables inside myscript.js

  Read the article

• Parsing CSV File to MySQL DB in PHP

  - by Austin

  I have a some 350-lined CSV File with all sorts of vendors that fall into Clothes, Tools, Entertainment, etc.. categories. Using the following code I have been able to print out my CSV File. <?php $fp = fopen('promo_catalog_expanded.csv', 'r'); echo '<tr><td>'; echo implode('</td><td>', fgetcsv($fp, 4096, ',')); echo '</td></tr>'; while(!feof($fp)) { list($cat, $var, $name, $var2, $web, $var3, $phone,$var4, $kw,$var5, $desc) = fgetcsv($fp, 4096); echo '<tr><td>'; echo $cat. '</td><td>' . $name . '</td><td><a href="http://www.' . $web .'" target="_blank">' .$web.'</a></td><td>'.$phone.'</td><td>'.$kw.'</td><td>'.$desc.'</td>' ; echo '</td></tr>'; } fclose($file_handle); show_source(__FILE__); ?> First thing you will probably notice is the extraneous vars within the list(). this is because of how the excel spreadsheet/csv file: Category,,Company Name,,Website,,Phone,,Keywords,,Description ,,,,,,,,,, Clothes,,4imprint,,4imprint.com,,877-466-7746,,"polos, jackets, coats, workwear, sweatshirts, hoodies, long sleeve, pullovers, t-shirts, tees, tshirts,",,An embroidery and apparel company based in Wisconsin. ,,Apollo Embroidery,,apolloemb.com,,1-800-982-2146,,"hats, caps, headwear, bags, totes, backpacks, blankets, embroidery",,An embroidery sales company based in California. One thing to note is that the last line starts with two commas as it is also listed within "Clothes" category. My concern is that I am going about the CSV output wrong. Should I be using a foreach loop instead of this list way? Should I first get rid of any unnecessary blank columns? Please advise any flaws you may find, improvements I can use so I can be ready to import this data to a MySQL DB.

  Read the article

• Write PEM encoded certificate in file - java

  - by user1349407

  Good day. I recently create X.509 certificate by using bouncy castle API. I need to save the certificate result rather than display the result. I tried to use FileOutputStream, but it does not work. regards the result is like follows -----BEGIN CERTIFICATE----- MIICeTCCAeKgAwIBAgIGATs8OWsXMA0GCSqGSIb3DQEBCwUAMBsxGTAXBgNVBAMT... -----END CERTIFICATE----- The code is belows import java.io.FileOutputStream; //example of a basic CA public class PKCS10CertCreateExample { public static X509Certificate[] buildChain() throws Exception { //create the certification request KeyPair pair = chapter7.Utils.generateRSAKeyPair(); PKCS10CertificationRequest request = PKCS10ExtensionExample.generateRequest(pair); //create a root certificate KeyPair rootPair=chapter7.Utils.generateRSAKeyPair(); X509Certificate rootCert = X509V1CreateExample.generateV1Certificate (rootPair); //validate the certification request if(!request.verify("BC")) { System.out.println("request failed to verify!"); System.exit(1); } //create the certificate using the information in the request X509V3CertificateGenerator certGen = new X509V3CertificateGenerator(); certGen.setSerialNumber(BigInteger.valueOf(System.currentTimeMillis())); certGen.setIssuerDN(rootCert.getSubjectX500Principal()); certGen.setNotBefore(new Date(System.currentTimeMillis())); certGen.setNotAfter(new Date(System.currentTimeMillis()+50000)); certGen.setSubjectDN(request.getCertificationRequestInfo().getSubject()); certGen.setPublicKey(request.getPublicKey("BC")); certGen.setSignatureAlgorithm("SHA256WithRSAEncryption"); certGen.addExtension(X509Extensions.AuthorityKeyIdentifier, false, new AuthorityKeyIdentifierStructure(rootCert)); certGen.addExtension(X509Extensions.SubjectKeyIdentifier, false, new SubjectKeyIdentifierStructure(request.getPublicKey("BC"))); certGen.addExtension(X509Extensions.BasicConstraints, true, new BasicConstraints(false)); //certGen.addExtension(X509Extensions.KeyUsage, true, new BasicConstraints(false)); certGen.addExtension(X509Extensions.KeyUsage, true, new KeyUsage(KeyUsage.digitalSignature | KeyUsage.keyEncipherment)); certGen.addExtension(X509Extensions.ExtendedKeyUsage, true, new ExtendedKeyUsage(KeyPurposeId.id_kp_serverAuth)); //extract the extension request attribute ASN1Set attributes = request.getCertificationRequestInfo().getAttributes(); for(int i=0;i!=attributes.size();i++) { Attribute attr = Attribute.getInstance(attributes.getObjectAt(i)); //process extension request if(attr.getAttrType().equals(PKCSObjectIdentifiers.pkcs_9_at_extensionRequest)) { X509Extensions extensions = X509Extensions.getInstance(attr.getAttrValues().getObjectAt(0)); Enumeration<?> e = extensions.oids(); while(e.hasMoreElements()) { DERObjectIdentifier oid = (DERObjectIdentifier)e.nextElement(); X509Extension ext = extensions.getExtension(oid); certGen.addExtension(oid, ext.isCritical(), ext.getValue().getOctets()); } } } X509Certificate issuedCert = certGen.generateX509Certificate(rootPair.getPrivate()); return new X509Certificate[]{issuedCert, rootCert}; } public static void main(String[] args) throws Exception { X509Certificate[] chain = buildChain(); PEMWriter pemWrt = new PEMWriter(new OutputStreamWriter(System.out)); pemWrt.writeObject(chain[0]); //pemWrt.writeObject(chain[1]); pemWrt.close(); //write it out //FileOutputStream fOut = new FileOutputStream("pkcs10req.req"); //fOut.write(chain[0].toString()); //fOut.write() //System.out.println(chain[0].toString()); //fOut.close(); } }

  Read the article

• Basic drawing with Quartz 2D on iPhone

  - by wwrob

  My goal is to make a program that will draw points whenever the screen is touched. This is what I have so far: The header file: #import <UIKit/UIKit.h> @interface ElSimView : UIView { CGPoint firstTouch; CGPoint lastTouch; UIColor *pointColor; CGRect *points; int npoints; } @property CGPoint firstTouch; @property CGPoint lastTouch; @property (nonatomic, retain) UIColor *pointColor; @property CGRect *points; @property int npoints; @end The implementation file: //@synths etc. - (id)initWithFrame:(CGRect)frame { return self; } - (id)initWithCoder:(NSCoder *)coder { if(self = [super initWithCoder:coder]) { self.npoints = 0; } return self; } - (void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event { UITouch *touch = [touches anyObject]; firstTouch = [touch locationInView:self]; lastTouch = [touch locationInView:self]; } - (void)touchesEnded:(NSSet *)touches withEvent:(UIEvent *)event { UITouch *touch = [touches anyObject]; lastTouch = [touch locationInView:self]; points = (CGRect *)malloc(sizeof(CGRect) * ++npoints); points[npoints-1] = CGRectMake(lastTouch.x-15, lastTouch.y-15,30,30); [self setNeedsDisplay]; } - (void)touchesMoved:(NSSet *)touches withEvent:(UIEvent *)event { UITouch *touch = [touches anyObject]; lastTouch = [touch locationInView:self]; [self setNeedsDisplay]; } - (void)drawRect:(CGRect)rect { CGContextRef context = UIGraphicsGetCurrentContext(); CGContextSetLineWidth(context, 2.0); CGContextSetStrokeColorWithColor(context, [UIColor blackColor].CGColor); CGContextSetFillColorWithColor(context, pointColor.CGColor); for(int i=0; i<npoints; i++) CGContextAddEllipseInRect(context, points[i]); CGContextDrawPath(context, kCGPathFillStroke); } - (void)dealloc { free(points); [super dealloc]; } @end When I load this and click some points, it draws the first points normally, then then next points are drawn along with random ellipses (not even circles). Also I have another question: When is exactly drawRect executed?

  Read the article

< Previous Page | 329 330 331 332 333 334 335 336 337 338 339 340  | Next Page >