Search Results

Search found 35523 results on 1421 pages for 'nullable string'.

Page 334/1421 | < Previous Page | 330 331 332 333 334 335 336 337 338 339 340 341  | Next Page >

  • C# and com for vb6

    - by Jim
    Hi all I have an issue with C# and COM. :( [Guid("f7d936ba-d816-48d2-9bfc-c18be6873b4d")] [ComVisible(true)] [ClassInterface(ClassInterfaceType.None)] public class Process : IProcess { public Process() { } public int UpdateBalance(string accountNumber, string adminEventDescription, decimal curAmount) { return 10; } } [ComVisible(true)] [Guid("5c640a0f-0dce-47d4-87df-07cee3b9a1f9")] [InterfaceType(ComInterfaceType.InterfaceIsIUnknown)] public interface IProcess { int UpdateBalance(string accountNumber, string adminEventDescription, decimal curAmount); } And the VB code Private Sub Command1_Click() Dim test As Object Set test = New Forwardslash_PlayerTrackingSystem_Api.Process End Sub I get the following ActiveX component can't create object?

    Read the article

  • NHibernate : delete error

    - by MadSeb
    Hi, Model: I have a model in which one Installation can contain multiple "Computer Systems". Database: The table Installations has two columns Name and Description. The table ComputerSystems has three columsn Name, Description and InstallationId. Mappings: I have the following mapping for Installation: <?xml version="1.0" encoding="utf-8"?> <hibernate-mapping xmlns="urn:nhibernate-mapping-2.2" assembly="myProgram.Core" namespace="myProgram"> <class name="Installation" table="Installations" lazy="true"> <id name="Id" column="Id" type="int"> <generator class="native" /> </id> <property name="Name" column="Name" type="string" not-null="true" /> <property name="Description" column="Description" type="string" /> <bag name="ComputerSystems" inverse="true" lazy="true" cascade="all-delete-orphan"> <key column="InstallationId" /> <one-to-many class="ComputerSystem" /> </bag> </class> </hibernate-mapping> I have the following mapping for ComputerSystem: <?xml version="1.0" encoding="utf-8"?> <id name="Id" column="ID" type="int"> <generator class="native" /> </id> <property name="Name" column="Name" type="string" not-null="true" /> <property name="Description" column="Description" type="string" /> <many-to-one name="Installation" column="InstallationID" cascade="save-update" not-null="true" /> Classes: The Installation class is: public class Installation { public virtual String Description { get; set; } public virtual String Name { get; set; } public virtual IList<ComputerSystem> ComputerSystems { get { if (_computerSystemItems== null) { lock (this) { if (_computerSystemItems== null) _computerSystemItems= new List<ComputerSystem>(); } } return _computerSystemItems; } set { _computerSystemItems= value; } } protected IList<ComputerSystem> _computerSystemItems; public Installation() { Description = ""; Name= ""; } } The ComputerSystem class is: public class ComputerSystem { public virtual String Name { get; set; } public virtual String Description { get; set; } public virtual Installation Installation { get; set; } } The issue is that I get an error when trying to delete an installation that contains a ComputerSystem. The error is: "deleted object would be re-saved by cascade (remove deleted object from associations)". Can anyone help ? Regards, Seb

    Read the article

  • How does this Singleton-like web class persists session data, even though session is not updated in

    - by Micah Burnett
    Ok, I've got this singleton-like web class which uses session to maintain state. I initially thought I was going to have to manipulate the session variables on each "set" so that the new values were updated in the session. However I tried using it as-is, and somehow, it remembers state. For example, if run this code on one page: UserContext.Current.User.FirstName = "Micah"; And run this code in a different browser tab, FirstName is displayed correctly: Response.Write(UserContext.Current.User.FirstName); Can someone tell me (prove) how this data is getting persisted in the session? Here is the class: using System; using System.Collections.Generic; using System.Linq; using System.Web; public class UserContext { private UserContext() { } public static UserContext Current { get { if (System.Web.HttpContext.Current.Session["UserContext"] == null) { UserContext uc = new UserContext(); uc.User = new User(); System.Web.HttpContext.Current.Session["UserContext"] = uc; } return (UserContext)System.Web.HttpContext.Current.Session["UserContext"]; } } private string HospitalField; public string Hospital { get { return HospitalField; } set { HospitalField = value; ContractField = null; ModelType = null; } } private string ContractField; public string Contract { get { return ContractField; } set { ContractField = value; ModelType = string.Empty; } } private string ModelTypeField; public string ModelType { get { return ModelTypeField; } set { ModelTypeField = value; } } private User UserField; public User User { get { return UserField; } set { UserField = value; } } public void DoSomething() { } } public class User { public int UserId { get; set; } public string FirstName { get; set; } } I added this to a watch, and can see that the session variable is definitely being set somewhere: (UserContext)System.Web.HttpContext.Current.Session["UserContext"]; As soon as a setter is called the Session var is immediately updated: set { HospitalField = value; //<--- here ContractField = null; ModelType = null; }

    Read the article

  • Exploding by Array of Delimiters

    - by JoeC
    Is there any way to explode() using an array of delimiters? PHP Manual: array explode ( string $delimiter , string $string [, int $limit ] ) Instead of using string $delimiter is there any way to use array $delimiter without affecting performance too much?

    Read the article

  • Working through exercises in "Cocoa Programming for Mac OS X" - I'm stumped

    - by Zigrivers
    I've been working through the exercises in a book recommended here on stackoverflow, however I've run into a problem and after three days of banging my head on the wall, I think I need some help. I'm working through the "Speakline" exercise where we add a TableView to the interface and the table will display the "voices" that you can choose for the text to speech aspect of the program. I am having two problems that I can't seem to get to the bottom of: I get the following error: * Illegal NSTableView data source (). Must implement numberOfRowsInTableView: and tableView:objectValueForTableColumn:row: The tableView that is supposed to display the voices comes up blank I have a feeling that both of these problems are related. I'm including my interface code here: #import <Cocoa/Cocoa.h> @interface AppController : NSObject <NSSpeechSynthesizerDelegate, NSTableViewDelegate> { IBOutlet NSTextField *textField; NSSpeechSynthesizer *speechSynth; IBOutlet NSButton *stopButton; IBOutlet NSButton *startButton; IBOutlet NSTableView *tableView; NSArray *voiceList; } - (IBAction)sayIt:(id)sender; - (IBAction)stopIt:(id)sender; @end And my implementation code here: #import "AppController.h" @implementation AppController - (id)init { [super init]; //Log to help me understand what is happening NSLog(@"init"); speechSynth = [[NSSpeechSynthesizer alloc] initWithVoice:nil]; [speechSynth setDelegate:self]; voiceList = [[NSSpeechSynthesizer availableVoices] retain]; return self; } - (IBAction)sayIt:(id)sender { NSString *string = [[textField stringValue] stringByTrimmingCharactersInSet:[NSCharacterSet whitespaceCharacterSet]]; //Is the string zero-length? if([string length] == 0) { NSLog(@"String from %@ is a string with a length of %d.", textField, [string length]); [speechSynth startSpeakingString:@"Please enter a phrase first."]; } [speechSynth startSpeakingString:string]; NSLog(@"Started to say: %@", string); [stopButton setEnabled:YES]; [startButton setEnabled:NO]; } - (IBAction)stopIt:(id)sender { NSLog(@"Stopping..."); [speechSynth stopSpeaking]; } - (void) speechSynthesizer:(NSSpeechSynthesizer *)sender didFinishSpeaking:(BOOL)complete { NSLog(@"Complete = %d", complete); [stopButton setEnabled:NO]; [startButton setEnabled:YES]; } - (NSInteger)numberOfRowsInTableView:(NSTableView *)aTableView { return [voiceList count]; } - (id)tableView: (NSTableView *)tv objecValueForTableColumn: (NSTableColumn *)tableColumn row:(NSInteger)row { NSString *v = [voiceList objectAtIndex:row]; NSLog(@"v = %@",v); NSDictionary *dict = [NSSpeechSynthesizer attributesForVoice:v]; return [dict objectForKey:NSVoiceName]; } /* - (BOOL)respondsToSelector:(SEL)aSelector { NSString *methodName = NSStringFromSelector(aSelector); NSLog(@"respondsToSelector: %@", methodName); return [super respondsToSelector:aSelector]; } */ @end Hopefully, you guys can see something obvious that I've missed. Thank you!

    Read the article

  • Optional Argument: compile time constant issue

    - by Jack
    Why is this working: public int DoesEmailAddressExistsExcludingEmailAddressID( string emailAddress, string invitationCode, int emailAddressID = 0, int For = (int) Enums.FOR.AC) whereas this doesn't public int DoesEmailAddressExistsExcludingEmailAddressID( string emailAddress, string invitationCode, int emailAddressID = 0, int For = Enums.FOR.AC.GetHashCode()) where AC is enum. Can enums's hashcode change at runtime?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • What am I missing in this ASP.NET XSS Security Helper class?

    - by smartcaveman
    I need a generic method for preventing XSS attacks in ASP.NET. The approach I came up with is a ValidateRequest method that evaluates the HttpRequest for any potential issues, and if issues are found, redirect the user to the same page, but in a away that is not threatening to the application. (Source code below) While I know this method will prevent most XSS attacks, I am not certain that I am adequately preventing all possible attacks while also minimizing false positives. So, what is the most effective way to adequately prevent all possible attacks, while minimizing false positives? Are there changes I should make to the helper class below, or is there an alternative approach or third party library that offers something more convincing? public static class XssSecurity { public const string PotentialXssAttackExpression = "(http(s)*(%3a|:))|(ftp(s)*(%3a|:))|(javascript)|(alert)|(((\\%3C) <)[^\n]+((\\%3E) >))"; private static readonly Regex PotentialXssAttackRegex = new Regex(PotentialXssAttackExpression, RegexOptions.IgnoreCase); public static bool IsPotentialXssAttack(this HttpRequest request) { if(request != null) { string query = request.QueryString.ToString(); if(!string.IsNullOrEmpty(query) && PotentialXssAttackRegex.IsMatch(query)) return true; if(request.HttpMethod.Equals("post", StringComparison.InvariantCultureIgnoreCase)) { string form = request.Form.ToString(); if (!string.IsNullOrEmpty(form) && PotentialXssAttackRegex.IsMatch(form)) return true; } if(request.Cookies.Count > 0) { foreach(HttpCookie cookie in request.Cookies) { if(PotentialXssAttackRegex.IsMatch(cookie.Value)) { return true; } } } } return false; } public static void ValidateRequest(this HttpContext context, string redirectToPath = null) { if(context == null || !context.Request.IsPotentialXssAttack()) return; // expire all cookies foreach(HttpCookie cookie in context.Request.Cookies) { cookie.Expires = DateTime.Now.Subtract(TimeSpan.FromDays(1)); context.Response.Cookies.Set(cookie); } // redirect to safe path bool redirected = false; if(redirectToPath != null) { try { context.Response.Redirect(redirectToPath,true); redirected = true; } catch { redirected = false; } } if (redirected) return; string safeUrl = context.Request.Url.AbsolutePath.Replace(context.Request.Url.Query, string.Empty); context.Response.Redirect(safeUrl,true); } }

    Read the article

  • How to store date into Mysql database with play framework in scala?

    - by Rahul Kulhari
    I am working with play framework with scala and what am i doing : login page to login into web app sign up page to register into web app after login i want to store all databases values to user what i want to do: when user register for web app then i want to store user values into database with current time and date but my form is giving error. error: List(FormError(dates,error.required,List())),None) controllers/Application.scala object Application extends Controller { val ta:Form[Keyword] = Form( mapping( "id" -> ignored(NotAssigned:Pk[Long]), "word" -> nonEmptyText, "blog" -> nonEmptyText, "cat" -> nonEmptyText, "score"-> of[Long], "summaryId"-> nonEmptyText, "dates" -> date("yyyy-MM-dd HH:mm:ss") )(Keyword.apply)(Keyword.unapply) ) def index = Action { Ok(html.index(ta)); } def newTask= Action { implicit request => ta.bindFromRequest.fold( errors => {println(errors) BadRequest(html.index(errors))}, keywo => { Keyword.create(keywo) Ok(views.html.data(Keyword.all())) } ) } models/keyword.scala case class Keyword(id: Pk[Long],word: String,blog: String,cat: String,score: Long, summaryId: String,dates: Date ) object Keyword { val keyw = { get[Pk[Long]]("keyword.id") ~ get[String]("keyword.word")~ get[String]("keyword.blog")~ get[String]("keyword.cat")~ get[Long]("keyword.score") ~ get[String]("keyword.summaryId")~ get[Date]("keyword.dates") map { case id~blog~cat~word~score~summaryId~dates => Keyword(id,word,blog,cat,score, summaryId,dates) } } def all(): List[Keyword] = DB.withConnection { implicit c => SQL("select * from keyword").as(Keyword.keyw *) } def create(key: Keyword){DB.withConnection{implicit c=> SQL("insert into keyword values({word},{blog}, {cat}, {score},{summaryId},{dates})").on('word-> key.word,'blog->key.blog, 'cat -> key.cat, 'score-> key.score, 'summaryId -> key.summaryId, 'dates->new Date()).executeUpdate } } views/index.scala.html @(taskForm: Form[Keyword]) @import helper._ @main("Todo list") { @form(routes.Application.newTask) { @inputText(taskForm("word")) @inputText(taskForm("blog")) @inputText(taskForm("cat")) @inputText(taskForm("score")) @inputText(taskForm("summaryId")) <input type="submit"> <a href="">Go Back</a> } } please give me some idea to store date into mysql databse and date is not a field of form

    Read the article

  • Print XML file and download it

    - by Pankaj
    I am create xml using serialization and trying to print them using this code string xmlDate = xml.GetXML(); string name = string.Format("{0}_HighEST", ProjectName); Response.AddHeader("Content-disposition", "attachment; filename=\"" + name + "_HighEST.xml\""); Response.ContentType = string.Format("application/.xml", name); how can assign my xmldata to Response so that data will write on downloaded xml?

    Read the article

  • java filenames filter pattern

    - by Sergey
    Hello, I need to implement File[] files = getFiles( String folderName, String ptrn ); Where ptrn is a command prompt style pattern like "*2010*.txt" I'm familar with FilenameFilter class, but can't implement public boolean accept(File dir, String filename) because String.matches() doesn't accept such patterns. Thanks!

    Read the article

  • vim: How do I line up ruby options?

    - by TheDeeno
    With vim how do I to turn this: t.string :crypted_password :null => false t.string :password_salt, :null => false into this: t.string :crypted_password, :null => false t.string :password_salt, :null => false without manually adding the spaces to each line?

    Read the article

  • Using \b in C# regular expressions doesn't work?

    - by Nikhil
    I am wondering why the following regex does not match. string query = "\"1 2\" 3"; string pattern = string.Format(@"\b{0}\b", Regex.Escape("\"1 2\"")); string repl = Regex.Replace(query, pattern, "", RegexOptions.CultureInvariant); Note that if I remove the word boundary characters (\b) from pattern, it matches fine. Is there something about '\b' that might be tripping this up?

    Read the article

  • Java: How can a constructor return a value?

    - by HH
    $ cat Const.java public class Const { String Const(String hello) { return hello; } public static void main(String[] args) { System.out.println(new Const("Hello!")); } } $ javac Const.java Const.java:7: cannot find symbol symbol : constructor Const(java.lang.String) location: class Const System.out.println(new Const("Hello!")); ^ 1 error

    Read the article

  • Recursion problem; completely lost

    - by timeNomad
    So I've been trying to solve this assignment whole day, just can't get it. The following function accepts 2 strings, the 2nd (not 1st) possibly containing *'s (asterisks). An * is a replacement for a string (empty, 1 char or more), it can appear appear (only in s2) once, twice, more or not at all, it cannot be adjacent to another * (ab**c), no need to check that. public static boolean samePattern(String s1, String s2) It returns true if strings are of the same pattern. It must be recursive, not use any loops, static & global variables. Can use local variables & method overloading. Can use only these methods: charAt(i), substring(i), substring(i, j), length(). Examples: 1: TheExamIsEasy; 2: "The*xamIs*y" --- true 1: TheExamIsEasy; 2: "Th*mIsEasy*" --- true 1: TheExamIsEasy; 2: "*" --- true 1: TheExamIsEasy; 2: "TheExamIsEasy" --- true 1: TheExamIsEasy; 2: "The*IsHard" --- FALSE I tried comparing the the chars one by one using charAt until an asterisk is encountered, then check if the asterisk is an empty one by comparing is successive char (i+1) with the char of s1 at position i, if true -- continue recursion with i+1 as counter for s2 & i as counter for s1; if false -- continue recursion with i+1 as counters for both. Continue this until another asterisk is found or end of string. I dunno, my brain loses track of things, can't concentrate, any pointers / hints? Am I in the right direction? Also, it's been told that a backtracking technique is to be used to solve this. My code so far (doesn't do the job, even theoretically): public static boolean samePattern(String s1, String s2) { if (s1.equals(s2) || s2 == "*") { return true; } return samePattern(s1, s2, 1); } public static boolean samePattern(String s1, String s2, int i) { if (s1.equals(s2)) return true; if (i == s2.length() - 1) // No *'s found -- not same pattern. return false; if (s1.substring(0, i).equals(s2.substring(0, i))) samePattern(s1, s2, i+1); else if (s2.charAt(i-1) == '*') samePattern(s1.substring(0, i-1), s2.substring(0, i), 1); // new smaller strings. else samePattern(s1.substring(1), s2, i); }

    Read the article

  • C# Working with Linq binding

    - by Isuru
    I have designed Types as follow: class Cricket { string type; Team tm; public Team Team { get { return tm; } set { tm = value; } } public string Type { get { return type; } set { type = value; } } } class Team { string country; Players plr; public Players Players { get {return plr; } set { plr = value; } } public string Country { get { return country; } set { country = value; } } } class Players { string name; DateTime dob; int run; public string Name { get { return name; } set { name = value; } } public DateTime DOB { get { return dob; } set { dob = value; } } public int Run { get { return run; } set { run = value; } } } I have to get the following using LINQ techniques. 1) Youngest all data of the youngest player among all teams 2) Oldest Player of each team 3) The highest run scorer will receive Gold Medal,rest of the players of all team will receive Silver medal. (Please look at the GetPlayer() i have declared var Medal=new String[] {"Gold","Silver"} to associate the Medal ) public void GetPlayer() { var TeamMatrix = new Cricket[] { new Cricket{ Type="Twenty20", Team=new Team{ Country="England", Players=new Players{ DOB=Convert.ToDateTime("01/Jan/1989"), Name="Russel", Run=45}}}, new Cricket{ Type="Twenty20", Team=new Team{ Country="England", Players=new Players{ DOB=Convert.ToDateTime("01/Jan/1991"), Name="Joel", Run=56}}}, new Cricket{ Type="Twenty20", Team=new Team{ Country="Australia", Players=new Players{ DOB=Convert.ToDateTime("01/Jan/1990"), Name="Clark", Run=145}}}, new Cricket{ Type="Twenty20", Team=new Team{ Country="Australia", Players=new Players{ DOB=Convert.ToDateTime("01/Jan/1971"), Name="Bevan", Run=156}}} }; var Medal = new string[] { "Gold", "Silver" }; var tm = (from mat in TeamMatrix select new { mat.Team.Players.DOB }).Max(); Console.WriteLine("Youngest Age={0}",tm); } When I declare var tm = (from mat in TeamMatrix select new { mat.Team.Players.DOB }).Max(); I receive error atleast one object must implement IComparable. What is the actual way to complete the above three tasks? ( Tasks 1 ,2 ,3 are explained above). Thanks to all.

    Read the article

  • Serialization of non-required fields in protobuf-net

    - by David Hedlund
    I have a working java client that is communicating with Google, through ProtoBuf serialized messages. I am currently trying to translate that client into C#. I have a .proto file where the parameter appId is an optional string. Its default value in the C# representation as generated by the protobuf-net library is an empty string, just as it is in the java representation of the same file. message AppsRequest { optional AppType appType = 1; optional string query = 2; optional string categoryId = 3; optional string appId = 4; optional bool withExtendedInfo = 6; } I find that when I explicitly set appId to "" in the java client, the client stops working (403 Bad Request from Google). When I explicitly set appId to null in the java client, everything works, but only because hasAppId is being set to false (I'm uncertain as to how that affects the serialization). In the C# client, I always get 403 responses. I don't see any logic behind the distinction between not setting a value, and setting the default value, that seems to make all the difference in the java client. Since the output is always a binary stream, I am not sure if the successful java messages are being serialized with an empty string, or not serialized at all. In the C# client, I've tried setting IsRequired to true on the ProtoMember attribute, to force them to serialize, and I've tried setting the default value to null, and explicitly set "", so I'm quite sure I've tried some configuration where the value is being serialized. I've also played around with ProtoBuf.ProtoIgnore and at some point, removing the appId parameter altogether, but I haven't been able to avoid the 403 errors in C#. I've tried manually copying the serialized string from java, and that resolved my issues, so I'm certain that the rest of the HTTP Request is working, and the error can be traced to the serialized object. My serialization is simply this: var clone = ProtoBuf.Serializer.DeepClone(request); MemoryStream ms = new MemoryStream(2000); ProtoBuf.Serializer.Serialize(ms, clone); var bytearr = ms.ToArray(); string encodedData = Convert.ToBase64String(bytearr); I'll admit to not being quite sure about what DeepClone does. I've tried both with and without it...

    Read the article

  • Is it possible to swap lines of xml code in soap

    - by John
    I wish to send a request like <v:Envelope xmlns:i="xxx"> <v:Header /> <v:Body> <sendTwoWaySmsMessage xmlns="xxx" id="o0" c:root="1"> <connectionId i:type="d:string">connectionId</connectionId> <twoWaySmsMessage> <message i:type="d:string">love it. It seems to work</message> <mobiles i:type="d:string">345</mobiles> <messageId i:type="d:string">123</messageId> </twoWaySmsMessage> </sendTwoWaySmsMessage> </v:Body> </v:Envelope> what i get is <v:Envelope xmlns:i="xxx"> <v:Header /> <v:Body> <sendTwoWaySmsMessage xmlns="xxx" id="o0" c:root="1"> <twoWaySmsMessage> <message i:type="d:string">love it. It seems to work</message> <mobiles i:type="d:string">345</mobiles> <messageId i:type="d:string">123</messageId> </twoWaySmsMessage> <connectionId i:type="d:string">connectionId</connectionId> </sendTwoWaySmsMessage> </v:Body> </v:Envelope> code is SoapObject request = new SoapObject(WSDL_TARGET_NAMESPACE, url); SoapObject message = new SoapObject("", "twoWaySmsMessage"); request.addProperty("connectionId", did); message.addProperty("message", "love it. It seems to work"); message.addProperty("mobiles", "435"); message.addProperty("messageId", "123"); request.addSoapObject(message); request.setProperty(0, "connectionId"); when i use SoapUI with the second with the "connectionId" swaped it seem to work can anyone help. of have ideas. I have looked at just about every ksoap question out there and cant seem to find an answer?

    Read the article

  • Changing backgroundcolor in listview (expandable listview)

    - by Stofke
    I'm trying to dynamically change a backgroundcolor in a part of a listview, I have on example that works fine in a listview when I try to replicate it in another part with an expandable listview it fails This piece of code works and displays a different color if a student is online or not ... map.put(KEY_FIRSTNAME, temp.firstName); map.put(KEY_NAME, temp.name); map.put(KEY_EMAIL, temp.email); map.put(KEY_ISONLINE, temp.isOnLine); // change image if student is online or not Log.d("demo", "is on line= " + temp.isOnLine); if (temp.isOnLine.equalsIgnoreCase("1")) { map.put(KEY_IMAGE_ISONLINE, R.color.greenColor); } else { map.put(KEY_IMAGE_ISONLINE, R.color.greyColor); } listItem.add(map); } myListView = (ListView) findViewById(R.id.listViewTabLeerlingen); SimpleAdapter adapter = new SimpleAdapter(StudentTab.this, listItem, R.layout.list_item_student, new String[] { KEY_FIRSTNAME, KEY_NAME, KEY_IMAGE_ISONLINE }, new int[] { R.id.firstNameTextView, R.id.lastNameTextView, R.id.logo }); myListView.setAdapter(adapter); the xml that goes along with it <ImageView android:id="@+id/logo" android:layout_width="85dp" android:layout_height="match_parent" android:background="@color/greenColor" android:contentDescription="Image if student is online or not" android:src="@drawable/transparent_pixel" /> The above works fine however the following code (just part of the code) ... ArrayList<Map<String, Object>> children = new ArrayList<Map<String, Object>>(); for (int i = 0; i < _data.length(); i++) { try { JSONArray tmp = _data.getJSONArray(i); HashMap<String, Object> map = new HashMap<String, Object>(); // change image if student is online or not if (tmp.getString(3).equalsIgnoreCase("0")) { map.put(KEY_POINTS,R.color.redColor); }else{ map.put(KEY_POINTS,R.color.greenColor); } map.put(KEY_QUESTIONTEXT, tmp.getString(1)); map.put(KEY_ANSWER, tmp.getString(2)); children.add(map); } catch (JSONException e) { e.printStackTrace(); } childData.add(children); ... ... ArrayList<ArrayList<Map<String, Object>>> childData) { SimpleExpandableListAdapter listAdapter = new SimpleExpandableListAdapter( this, groupData, R.layout.list_item_results_students, new String[] { KEY_FIRSTNAME, KEY_NAME, KEY_ISJUIST }, new int[] { R.id.firstnameResults, R.id.nameResults, R.id.resultsTextView }, childData, R.layout.list_item_results_results, new String[] { KEY_QUESTIONTEXT, KEY_ANSWER, KEY_POINTS }, new int[] { R.id.questionTextView, R.id.answerTextTextView, R.id.score }); ExpandableListView myListView = (ExpandableListView) findViewById(R.id.listViewTabResultaten); myListView.setAdapter(listAdapter); with xml: <ImageView android:id="@+id/score" android:layout_width="16dp" android:layout_height="match_parent" android:background="@color/greenColor" android:contentDescription="Image if student has correct answer" android:src="@drawable/transparent_pixel" /> I will get this error: 06-09 10:35:21.490: E/AndroidRuntime(4406): java.lang.ClassCastException: android.widget.ImageView cannot be cast to android.widget.TextView

    Read the article

  • convert 0.5 to 0.50 in C#

    - by Rohit
    I have a string which holds 0.5. I have to convert in to 0.50. I have tried following ways but nothing works.Please help hdnSliderValue.Value is 0.5,I want workFlow.QualityThresholdScore to be 0.50 workFlow.QualityThresholdScore = Convert.ToDecimal(String.format("{0:d}",hdnSliderValue.Value)); workFlow.QualityThresholdScore = Convert.ToDecimal(String.format("{0:0.00}",hdnSliderValue.Value)); IS there any built in function or will i have to do string handling to accomplish this.

    Read the article

  • Can't figure out where race condition is occuring

    - by Nik
    I'm using Valgrind --tool=drd to check my application that uses Boost::thread. Basically, the application populates a set of "Book" values with "Kehai" values based on inputs through a socket connection. On a seperate thread, a user can connect and get the books send to them. Its fairly simple, so i figured using a boost::mutex::scoped_lock on the location that serializes the book and the location that clears out the book data should be suffice to prevent any race conditions. Here is the code: void Book::clear() { boost::mutex::scoped_lock lock(dataMutex); for(int i =NUM_KEHAI-1; i >= 0; --i) { bid[i].clear(); ask[i].clear(); } } int Book::copyChangedKehaiToString(char* dst) const { boost::mutex::scoped_lock lock(dataMutex); sprintf(dst, "%-4s%-13s",market.c_str(),meigara.c_str()); int loc = 17; for(int i = 0; i < Book::NUM_KEHAI; ++i) { if(ask[i].changed > 0) { sprintf(dst+loc,"A%i%-21s%-21s%-21s%-8s%-4s",i,ask[i].price.c_str(),ask[i].volume.c_str(),ask[i].number.c_str(),ask[i].postTime.c_str(),ask[i].status.c_str()); loc += 77; } } for(int i = 0; i < Book::NUM_KEHAI; ++i) { if(bid[i].changed > 0) { sprintf(dst+loc,"B%i%-21s%-21s%-21s%-8s%-4s",i,bid[i].price.c_str(),bid[i].volume.c_str(),bid[i].number.c_str(),bid[i].postTime.c_str(),bid[i].status.c_str()); loc += 77; } } return loc; } The clear() function and the copyChangedKehaiToString() function are called in the datagetting thread and data sending thread,respectively. Also, as a note, the class Book: struct Book { private: Book(const Book&); Book& operator=(const Book&); public: static const int NUM_KEHAI=10; struct Kehai; friend struct Book::Kehai; struct Kehai { private: Kehai& operator=(const Kehai&); public: std::string price; std::string volume; std::string number; std::string postTime; std::string status; int changed; Kehai(); void copyFrom(const Kehai& other); Kehai(const Kehai& other); inline void clear() { price.assign(""); volume.assign(""); number.assign(""); postTime.assign(""); status.assign(""); changed = -1; } }; std::vector<Kehai> bid; std::vector<Kehai> ask; tm recTime; mutable boost::mutex dataMutex; Book(); void clear(); int copyChangedKehaiToString(char * dst) const; }; When using valgrind --tool=drd, i get race condition errors such as the one below: ==26330== Conflicting store by thread 1 at 0x0658fbb0 size 4 ==26330== at 0x653AE68: std::string::_M_mutate(unsigned int, unsigned int, unsigned int) (in /usr/lib/libstdc++.so.6.0.8) ==26330== by 0x653AFC9: std::string::_M_replace_safe(unsigned int, unsigned int, char const*, unsigned int) (in /usr/lib/libstdc++.so.6.0.8) ==26330== by 0x653B064: std::string::assign(char const*, unsigned int) (in /usr/lib/libstdc++.so.6.0.8) ==26330== by 0x653B134: std::string::assign(char const*) (in /usr/lib/libstdc++.so.6.0.8) ==26330== by 0x8055D64: Book::Kehai::clear() (Book.h:50) ==26330== by 0x8094A29: Book::clear() (Book.cpp:78) ==26330== by 0x808537E: RealKernel::start() (RealKernel.cpp:86) ==26330== by 0x804D15A: main (main.cpp:164) ==26330== Allocation context: BSS section of /usr/lib/libstdc++.so.6.0.8 ==26330== Other segment start (thread 2) ==26330== at 0x400BB59: pthread_mutex_unlock (drd_pthread_intercepts.c:633) ==26330== by 0xC59565: pthread_mutex_unlock (in /lib/libc-2.5.so) ==26330== by 0x805477C: boost::mutex::unlock() (mutex.hpp:56) ==26330== by 0x80547C9: boost::unique_lock<boost::mutex>::~unique_lock() (locks.hpp:340) ==26330== by 0x80949BA: Book::copyChangedKehaiToString(char*) const (Book.cpp:134) ==26330== by 0x80937EE: BookSerializer::serializeBook(Book const&, std::string const&) (BookSerializer.cpp:41) ==26330== by 0x8092D05: BookSnapshotManager::getSnaphotDataList() (BookSnapshotManager.cpp:72) ==26330== by 0x8088179: SnapshotServer::getDataList() (SnapshotServer.cpp:246) ==26330== by 0x808870F: SnapshotServer::run() (SnapshotServer.cpp:183) ==26330== by 0x808BAF5: boost::_mfi::mf0<void, RealThread>::operator()(RealThread*) const (mem_fn_template.hpp:49) ==26330== by 0x808BB4D: void boost::_bi::list1<boost::_bi::value<RealThread*> >::operator()<boost::_mfi::mf0<void, RealThread>, boost::_bi::list0>(boost::_bi::type<void>, boost::_mfi::mf0<void, RealThread>&, boost::_bi::list0&, int) (bind.hpp:253) ==26330== by 0x808BB90: boost::_bi::bind_t<void, boost::_mfi::mf0<void, RealThread>, boost::_bi::list1<boost::_bi::value<RealThread*> > >::operator()() (bind_template.hpp:20) ==26330== Other segment end (thread 2) ==26330== at 0x400B62A: pthread_mutex_lock (drd_pthread_intercepts.c:580) ==26330== by 0xC59535: pthread_mutex_lock (in /lib/libc-2.5.so) ==26330== by 0x80546B8: boost::mutex::lock() (mutex.hpp:51) ==26330== by 0x805473B: boost::unique_lock<boost::mutex>::lock() (locks.hpp:349) ==26330== by 0x8054769: boost::unique_lock<boost::mutex>::unique_lock(boost::mutex&) (locks.hpp:227) ==26330== by 0x8094711: Book::copyChangedKehaiToString(char*) const (Book.cpp:113) ==26330== by 0x80937EE: BookSerializer::serializeBook(Book const&, std::string const&) (BookSerializer.cpp:41) ==26330== by 0x808870F: SnapshotServer::run() (SnapshotServer.cpp:183) ==26330== by 0x808BAF5: boost::_mfi::mf0<void, RealThread>::operator()(RealThread*) const (mem_fn_template.hpp:49) ==26330== by 0x808BB4D: void boost::_bi::list1<boost::_bi::value<RealThread*> >::operator()<boost::_mfi::mf0<void, RealThread>, boost::_bi::list0>(boost::_bi::type<void>, boost::_mfi::mf0<void, RealThread>&, boost::_bi::list0&, int) (bind.hpp:253) For the life of me, i can't figure out where the race condition is. As far as I can tell, clearing the kehai is done only after having taken the mutex, and the same holds true with copying it to a string. Does anyone have any ideas what could be causing this, or where I should look? Thank you kindly.

    Read the article

  • asp.net mvc HttpPostedFileBase getting file extension

    - by mazhar kaunain baig
    public string ContructOrganizationNameLogo(HttpPostedFileBase upload, string OrganizationName, int OrganizationID,string LangName) { var UploadedfileName = Path.GetFileName(upload.FileName); string type = upload.ContentType; } I want to get the extension of the file to dynamically generate the name of the file.One way i will use to split the type. but can i use HttpPostedFileBase object to get the extension in the clean way?

    Read the article

  • Type problem with Observable.Create from Boo

    - by Tristan
    I'm trying to use Reactive Extensions from Boo and am running into type problems. Here's the basic example: def OnSubscribe(observer as IObservable[of string]) as callable: print "subscribing" def Dispose(): print "disposing" return Dispose observable = System.Linq.Observable.Create[of string](OnSubscribe) observer = System.Linq.Observer.Create[of string]({x as string | print x}) observable.Subscribe(observer) The Subscribe here gives a System.InvalidCastException: Cannot cast from source type to destination type. The issue appears to be with how I'm creating the observable, but I've struggled to see where the type problem arises from. Ideas?

    Read the article

  • How does Java pick which method to call?

    - by Gaurav
    Given the following code: public class Test { public void method(Object o){ System.out.println("object"); } public void method(String s) { System.out.println("String"); } public void method() { System.out.println("blank"); } /** * @param args */ public static void main(String[] args) { // TODO Auto-generated method stub Test test=new Test(); test.method(null); } } Java prints "String". Why is this the case?

    Read the article

< Previous Page | 330 331 332 333 334 335 336 337 338 339 340 341  | Next Page >