Search Results

Search found 19265 results on 771 pages for 'country specific'.

Page 336/771 | < Previous Page | 332 333 334 335 336 337 338 339 340 341 342 343  | Next Page >

  • Why do browser vendors make their own css properties?

    - by jitendra
    Why do browser vendors make their own css properties, even they know these will not pass the w3c validation? What is the purpose? Is for their own testing, or for web developers, or to demonstrate browser capabilities to the world and to the W3C organizations and to CSS development team of W3C? is it like a beta version of demonstration? if i use any browser specific for now can they remove that property's support from future versions.will i have to edit my css in future For example: https://developer.mozilla.org/en/CSS_Reference/Mozilla_Extensions

    Read the article

  • Win32: How do I get the listbox for a combobox

    - by Adam Tegen
    I'm writing some code and I need to get the window handle of the listbox associated with a combo box. When looking in spy++, it looks like the parent of the listbox is the desktop, not the combo box. How can I programmatically find the listbox window handle? I know I'd be looking for a window class of ComboLBox that belongs to my process, but how do I narrow that down to the specific one I am looking for? Adam

    Read the article

  • Object responsibilities - list and item

    - by Mark Tyler
    My question is more like a theoretical. Say you have an object, that represents the list of something (articles, pages, accounts etc.) class ObjCollection You have a class, that represents a specific item in collection: class objItem I have a problem thinking of a basic responsibilities of each object. Which class is responsible for creating a new objItem? Which class is responsible for deleting a objItem? Should it delete itself as a method?

    Read the article

  • Launch an app from within another (iPhone)

    - by Jeff
    Is it possible to launch any arbitrary iPhone application from within another app? For example in my application if I want the user to push a button and launch right into the Phone app (close the current app, open the Phone app), would this be possible? I know this can be done for making phone calls with the tel URL link, but I want to instead just have the Phone app launch without dialing any specific number.

    Read the article

  • Parallel software?

    - by mavric
    What is the meaning of "parallel software" and what are the differences between "parallel software" and "regular software"? What are its advantages and disadvantages? Does writing "parallel software" require a specific hardware or programming language ?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • .Net WebDAV Server

    - by Andrew Theken
    Hi all, I am looking to implement a WebDAV server in ASP.Net. the app will be deployed to IIS 6. I have seen a few frameworks that provide this functionality, but I can't seem to identify how they're able to accomplish it without (apparently) modifying IIS settings. My specific question is how do I configure IIS and ASP.Net so that a IHttpModule/IHttpHandler might have an opportunity to handle any of the additional WebDAV verbs (i.e. LOCK, OPTIONS, PROFIND, etc.)

    Read the article

  • Recommendations for Open Source Parallel programming IDE

    - by Andrew Bolster
    What are the best IDE's / IDE plugins / Tools, etc for programming with CUDA / MPI etc? I've been working in these frameworks for a short while but feel like the IDE could be doing more heavy lifting in terms of scaling and job processing interactions. (I usually use Eclipse or Netbeans, and usually in C/C++ with occasional Java, and its a vague question but I can't think of any more specific way to put it)

    Read the article

  • SDL_GL_SwapBuffers Segfault

    - by RyanG
    I'm getting a segfault that GDB says is coming from SDL_GL_SwapBuffers. However, I can't imagine why. The SDL documentation mentions no specific pre-conditions for calling swapBuffers except that double buffering be allowed. Is this an option I have to turn on while initializing OpenGL or is this a hardware capability thing? My code: http://pastie.org/859721 (Ignore the unused variables, strange comments and other things. I haven't prettied this up at all. :P)

    Read the article

  • ActiveRecord finding from inside a serialized field

    - by JP
    While working with ActiveRecord I have a table which stores a serialized array of participant usernames for each row. Is there an easy way to search for all rows who contain a specific user? I realise I could just make a new linked table for the participants, but I feel like that would increase my overhead unnecessarily -- what do you think?

    Read the article

  • Trace the function implemented by DeviceioControl

    - by ame
    I am working with a WinCE device which has a radio manager driver written for it in MFC. In the code for the Radio GUI, I can see the function Deviceiocontrol with a specific IOCTL being called. However, I'm unable to trace the particular piece of code called by this function. Can someone tell me how Deviceiocontrol works?

    Read the article

  • per process configurable core dump directory

    - by Hanno Stock
    Is there a way to configure the directory where core dump files are placed for a specific process? I have a daemon process written in C++ for which I would like to configure the core dump directory. Optionally the filename pattern should be configurable, too. I know about /proc/sys/kernel/core_name_format, however this would change the pattern and directory structure globally. Apache has the directive CoreDumpDirectory - so it seems to be possible.

    Read the article

  • jQueryt Search for Text in a Variable?

    - by thatryan
    I have a variable that contains some text, some html, basically can be a string. I need to search the variable for a specific string to process that variable differently if it is contained. Here is a snippet of what I am trying to do, does not work obviously :) $.each(data.results, function(i, results) { var text = this.text var pattern = new RegExp("^[SEARCHTERM]$"); if(pattern.test( text ) ) alert(text); //was hoping this would alert the SEARCHTERM if found...

    Read the article

  • Localization of attribute values in .NET

    - by Alex Angas
    How can I localize/internationalize attribute values in .NET? My specific example is for ASP.NET web parts such as WebDisplayName, WebDescription, etc. where I inherit from the base class that uses these attributes. Also, is there any difference to doing this with attributes declared in my own classes? Thanks!

    Read the article

  • How do you manage the namespaces of your extension methods?

    - by Robert Harvey
    Do you use a global, catchall namespace for all of your extension methods, or do you put the extension methods in the same namespace as the class(es) they extend? Or do you use some other method, like an application or library-specific namespace? EDIT: I ask because I have a need to extend System.Security.Principal.IIdentity, and putting the extension method in the System.Security.Principal namespace seems to make sense, but I've never seen it done this way.

    Read the article

< Previous Page | 332 333 334 335 336 337 338 339 340 341 342 343  | Next Page >