Search Results

Search found 11752 results on 471 pages for 'phone numbers'.

Page 34/471 | < Previous Page | 30 31 32 33 34 35 36 37 38 39 40 41  | Next Page >

  • Haskell. Numbers in binary numbers. words

    - by Katja
    Hi! I need to code words into binary numbers. IN: "BCD..." OUT:1011... I have written already funktion for coding characters into siple numbers IN: 'C' OUT: 3 IN: 'c' OUT: 3 lett2num :: Char -> Int lett2num x | (ord 'A' <= ord x) && (ord x <= ord 'Z') = (ord x - ord 'A') + 1 | (ord 'a' <= ord x) && (ord x <= ord 'z') = (ord x - ord 'a') +1 num2lett :: Int -> Char num2lett n | (n <= ord 'A') && (n <= ord 'Z') = chr(ord 'A'+ n - 1) | (n <= ord 'a') && (n <= ord 'Z') = chr(ord 'A'+ n - 1) I wrote as well function for codind simple numbers into binary. num2bin :: Int->[Int] num2bin 0 = [] num2bin n | n>=0 = n `mod` 2 : (num2bin( n `div` 2)) | otherwise = error but I donw want those binary numbers to be in a list how can I get rid of the lists? Thanks

    Read the article

  • Best way to associate phone numbers with names

    - by Horace Loeb
    My application stores lots of its users friends' phone numbers. I'd like to allow users to associate names with these phone numbers, but I don't want to make users manually type in names (obviously). I'm curious what the best overall approach is here, as well as the best way to implement it Overall approach-wise, I imagine using Gmail / Yahoo / Windows Live contacts is best (the Facebook API doesn't let you access phone numbers), though the gems I've found for interacting with these contacts APIs (this and this) only give you access to the names and email addresses of each contact.

    Read the article

  • C# program for finding how many numbers are devidable by 5 in give range

    - by user1639735
    My task is: Write a program that reads two positive integer numbers and prints how many numbers p exist between them such that the reminder of the division by 5 is 0 (inclusive). Example: p(17,25) = 2. Console.Write("Enter min: "); int min = int.Parse(Console.ReadLine()); Console.Write("Enter max: "); int max = int.Parse(Console.ReadLine()); Console.WriteLine("The numbers devidable by 5 without remainder from {0} to {1} are: ",min,max); for (int i = min; i <= max; i++) { if (i % 5 == 0) { Console.WriteLine(i); } } This prints out the numbers that are devidable by 5 in the range...How do I count how many are there and print the count in the console? Thanks.

    Read the article

  • Extract string that is delimited with constant and ends with two numbers (numbers have to be included)

    - by Edmon
    I have a text that contains string of a following structure: text I do not care about, persons name followed by two IDs. I know that: a person's name is always preceded by XYZ code and that is always followed by two, space separated numbers. Name is not always just a last name and first name. It can be multiple last or first names (think Latin american names). So, I am looking to extract string that follows the constant XYZ code and that is always terminated by two separate numbers. You can say that my delimiter is XYZ and two numbers, but numbers need to be part of the extracted value as well. From blah, blah XYZ names, names 122322 344322 blah blah I want to extract: names, names 122322 344322 Would someone please advise on the regular expression for this that would work with Python's re package.

    Read the article

  • How computer multiplies 2 numbers?

    - by ckv
    How does a computer perform a multiplication on 2 numbers say 100 * 55. My guess was that the computer did repeated addition to achieve multiplication. Of course this could be the case for integer numbers. However for floating point numbers there must be some other logic. Note: This was asked in an interview.

    Read the article

  • Convert String containing several numbers into integers

    - by GobiasKoffi
    I realize that this question may have been asked several times in the past, but I am going to continue regardless. I have a program that is going to get a string of numbers from keyboard input. The numbers will always be in the form "66 33 9" Essentially, every number is separated with a space, and the user input will always contain a different amount of numbers. I'm aware that using 'sscanf' would work if the amount of numbers in every user-entered string was constant, but this is not the case for me. Also, because I'm new to C++, I'd prefer dealing with 'string' variables rather than arrays of chars.

    Read the article

  • Sorting a list of numbers with modified cost

    - by David
    First, this was one of the four problems we had to solve in a project last year and I couldn’t find a suitable algorithm so we handle in a brute force solution. Problem: The numbers are in a list that is not sorted and supports only one type of operation. The operation is defined as follows: Given a position i and a position j the operation moves the number at position i to position j without altering the relative order of the other numbers. If i j, the positions of the numbers between positions j and i - 1 increment by 1, otherwise if i < j the positions of the numbers between positions i+1 and j decreases by 1. This operation requires i steps to find a number to move and j steps to locate the position to which you want to move it. Then the number of steps required to move a number of position i to position j is i+j. We need to design an algorithm that given a list of numbers, determine the optimal (in terms of cost) sequence of moves to rearrange the sequence. Attempts: Part of our investigation was around NP-Completeness, we make it a decision problem and try to find a suitable transformation to any of the problems listed in Garey and Johnson’s book: Computers and Intractability with no results. There is also no direct reference (from our point of view) to this kind of variation in Donald E. Knuth’s book: The art of Computer Programing Vol. 3 Sorting and Searching. We also analyzed algorithms to sort linked lists but none of them gives a good idea to find de optimal sequence of movements. Note that the idea is not to find an algorithm that orders the sequence, but one to tell me the optimal sequence of movements in terms of cost that organizes the sequence, you can make a copy and sort it to analyze the final position of the elements if you want, in fact we may assume that the list contains the numbers from 1 to n, so we know where we want to put each number, we are just concerned with minimizing the total cost of the steps. We tested several greedy approaches but all of them failed, divide and conquer sorting algorithms can’t be used because they swap with no cost portions of the list and our dynamic programing approaches had to consider many cases. The brute force recursive algorithm takes all the possible combinations of movements from i to j and then again all the possible moments of the rest of the element’s, at the end it returns the sequence with less total cost that sorted the list, as you can imagine the cost of this algorithm is brutal and makes it impracticable for more than 8 elements. Our observations: n movements is not necessarily cheaper than n+1 movements (unlike swaps in arrays that are O(1)). There are basically two ways of moving one element from position i to j: one is to move it directly and the other is to move other elements around i in a way that it reaches the position j. At most you make n-1 movements (the untouched element reaches its position alone). If it is the optimal sequence of movements then you didn’t move the same element twice.

    Read the article

  • Help constructing query - Compare columns and replace numbers

    - by Tommy
    I have a feeling that this query is pretty easy to construct, I just can't figure it out. I want to replace all numbers in table X column C, with numbers in table Z column A, where numbers from table X column C matches numbers in table Z column B. I hope that makes sense. Perhaps a little background information will make it clearer. I've converted from one CMS to another, and the module I used to convert mapped the ids to the new database. Table X column A is the new id's. Table X column B is the old id's. Table Z is the table for an image gallery that I migrated, and column C contains the id's of the images owners. Can anyone crack this nut?

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Create numbers within an array that add up to a set amount

    - by RussellDias
    I'm fairly new to PHP - programming in general. So basically what I need to accomplish is, create an array of x amount of numbers (created randomly) who's value add up to n: Lets say, I have to create 4 numbers that add up to 30. I just need the first random dataset. The 4 and 30 here are variables which will be set by the user. Essentially something like x = amount of numbers; n = sum of all x's combined; create x random numbers which all add up to n; $row = array(5, 7, 10, 8) // these add up to 30 Also, no duplicates are allowed. I need the values with an array. I have been messing around with it sometime, however, my knowledge is fairly limited. Any help will be greatly appreciated. Cheers

    Read the article

  • Scaling range of values with negative numbers

    - by Pradeep Kumar
    How can I scale a set of values to fit a new range if they include negative numbers? For example, I have a set of numbers (-10, -9, 1, 4, 10) which have to scaled to a range [0 1], such that -10 maps to 0, and 10 maps to 1. The regular method for an arbitrary number 'x' would be: (x - from_min) * (to_max - to_min) / (from_max - from_min) + to_min but this does not work for negative numbers. Any help is appreciated. Thanks!!

    Read the article

  • Extracting numbers from a url using javascript?

    - by stormist
    var exampleURL = '/example/url/345234/test/'; var numbersOnly = [?] The /url/ and /test portions of the path will always be the same. Note that I need the numbers between /url/ and /test. In the example URL above, the placeholder word example might be numbers too from time to time but in that case it shouldn't be matched. Only the numbers between /url/ and /test. Thanks!

    Read the article

  • Pantech Link II, Ubuntu and Virtual XP

    - by user85041
    Okay this is my problem. I have a Pantech Link II, dmesg states: [ 896.072037] usb 2-3: new high-speed USB device number 3 using ehci_hcd [ 896.258562] cdc_acm 2-3:1.0: ttyACM0: USB ACM device [ 896.260039] usbcore: registered new interface driver cdc_acm [ 896.260042] cdc_acm: USB Abstract Control Model driver for USB modems and ISDN adapters Have it installed through wine (pc suite and driver) and it doesn't see it. Virtual XP through VMWare Player sees my device, knows it needs a driver. The removable devices says Curitel Pantech USB Device (Maybe Driver). I have PC Suite installed in XP, I install the driver through the executable.. it says problem with installing hardware, and then it disappears. Ubuntu sees it after restart, but if I start XP with that driver installed, it disappears from both and I get these errors in dmesg: [ 1047.760555] /dev/vmmon[2882]: PTSC: initialized at 3093322000 Hz using TSC, TSCs are synchronized. [ 1048.174033] /dev/vmmon[2882]: Monitor IPI vector: 0 [ 1055.293060] /dev/vmnet: open called by PID 3163 (vmx-vcpu-0) [ 1055.293074] /dev/vmnet: port on hub 8 successfully opened [ 1055.293088] /dev/vmnet: open called by PID 3163 (vmx-vcpu-0) [ 1055.293094] /dev/vmnet: port on hub 8 successfully opened [ 1072.446305] /dev/vmnet: open called by PID 3163 (vmx-vcpu-0) [ 1072.446316] /dev/vmnet: port on hub 8 successfully opened [ 1072.446328] /dev/vmnet: open called by PID 3163 (vmx-vcpu-0) [ 1072.446334] /dev/vmnet: port on hub 8 successfully opened [ 1072.856024] usb 1-1: reset high-speed USB device number 2 using ehci_hcd [ 1079.292024] usb 1-1: reset high-speed USB device number 2 using ehci_hcd [ 1079.732024] usb 1-1: reset high-speed USB device number 2 using ehci_hcd [ 1127.743034] NET: Registered protocol family 39 [ 1127.749320] [3163]: VMCI: IOCTL_VMCI_QUEUEPAIR_ALLOC (cid=1522210225,result=4). [ 1144.104031] usb 2-3: reset high-speed USB device number 3 using ehci_hcd [ 1144.412031] usb 2-3: reset high-speed USB device number 3 using ehci_hcd [ 1155.889976] ehci_hcd 0000:00:13.2: force halt; handshake ffffc90000642024 00004000 00000000 -> -110 [ 1155.889980] ehci_hcd 0000:00:13.2: HC died; cleaning up [ 1155.890008] usb 2-3: USB disconnect, device number 3 [ 1155.890013] usb 2-3: usbfs: usb_submit_urb returned -110 [ 1658.310777] [3163]: VMCI: IOCTL_VMCI_QUEUEPAIR_DETACH (cid=1522210225,result=3). [ 1658.392018] NET: Unregistered protocol family 39 [ 1666.546438] /dev/vmnet: open called by PID 3163 (vmx-vcpu-0) [ 1666.546450] /dev/vmnet: port on hub 8 successfully opened [ 1666.546462] /dev/vmnet: open called by PID 3163 (vmx-vcpu-0) [ 1666.546467] /dev/vmnet: port on hub 8 successfully opened [ 1671.431383] uvcvideo: Found UVC 1.00 device USB2.0 Camera (1871:0101) [ 1671.432533] input: USB2.0 Camera as /devices/pci0000:00/0000:00:12.2/usb1/1-1/1-1:1.0/input/input13 lessa@X:~$ dmesg|tail [ 1155.890008] usb 2-3: USB disconnect, device number 3 [ 1155.890013] usb 2-3: usbfs: usb_submit_urb returned -110 [ 1658.310777] [3163]: VMCI: IOCTL_VMCI_QUEUEPAIR_DETACH (cid=1522210225,result=3). [ 1658.392018] NET: Unregistered protocol family 39 [ 1666.546438] /dev/vmnet: open called by PID 3163 (vmx-vcpu-0) [ 1666.546450] /dev/vmnet: port on hub 8 successfully opened [ 1666.546462] /dev/vmnet: open called by PID 3163 (vmx-vcpu-0) [ 1666.546467] /dev/vmnet: port on hub 8 successfully opened [ 1671.431383] uvcvideo: Found UVC 1.00 device USB2.0 Camera (1871:0101) [ 1671.432533] input: USB2.0 Camera as /devices/pci0000:00/0000:00:12.2/usb1/1-1/1-1:1.0/input/input13 I have tried uninstalling, and installing manually from the device manager update driver while it's still has the warning sign.. it doesn't see the drivers as valid. No idea how to fix this.. would prefer to not have to go to another computer. I'm not trying to do anything but get the pictures off of it. I have to restart ubuntu, plug in device, for ubuntu to see it correctly again. I am like a month and a half old linux newbie so I have no idea the commands I could use for this, and I don't have a memory card in the phone to mount.

    Read the article

  • Asterisk - Trying to use call files to create a conference call between two dynamic numbers

    - by Hank
    I'm trying to setup an Asterisk system that will allow me to create a conference call between two dynamic numbers. It seems I can use 'call files' to make Asterisk initiate the call without needing an incoming call - http://www.voip-info.org/tiki-index.php?page=Asterisk+auto-dial+out This example seems to be what I'd need: Channel: SIP/mytrunk/12345678 MaxRetries: 2 RetryTime: 60 WaitTime: 30 Context: callme Extension: 800 Priority: 2 I can generate this file with some scripting language and then place it into the Asterisk Call File folder. The problem I'm having is: How do I call out to two numbers and join them in a conference call? The MeetMe plugin/extension seems to be what I need in terms of conference calling, I'm just unsure as to how I'd use the two together and join them. Also, is it possible to have multiple 2-person conference calls at the same time? Is setting this up as simple as setting aside X amount of 'channels' in the meetme.conf?

    Read the article

  • Asterisk - Trying to use call files to create a conference call between two dynamic numbers

    - by Hank
    I'm trying to setup an Asterisk system that will allow me to create a conference call between two dynamic numbers. It seems I can use 'call files' to make Asterisk initiate the call without needing an incoming call - http://www.voip-info.org/tiki-index.php?page=Asterisk+auto-dial+out This example seems to be what I'd need: Channel: SIP/mytrunk/12345678 MaxRetries: 2 RetryTime: 60 WaitTime: 30 Context: callme Extension: 800 Priority: 2 I can generate this file with some scripting language and then place it into the Asterisk Call File folder. The problem I'm having is: How do I call out to two numbers and join them in a conference call? The MeetMe plugin/extension seems to be what I need in terms of conference calling, I'm just unsure as to how I'd use the two together and join them. Also, is it possible to have multiple 2-person conference calls at the same time? Is setting this up as simple as setting aside X amount of 'channels' in the meetme.conf?

    Read the article

  • Context is Hindi when printing line numbers in Word 2007

    - by Lessan Vaezi
    I'm trying to print a Word 2007 document with Line Numbering turned on, and in Word the document looks fine but when I print the document, the line numbers appear in Hindi script. See screenshots here: http://www.lessanvaezi.com/context-is-hindi-when-printing-line-numbers-in-word-2007/ I tried deleting my Normal template and allowing Word to create a new one, and testing using that, with no change. I also tried using different printers. The problem goes away if I choose Arabic instead of Context under Word Options - Advanced - Show Document Content / Numeral. However, I would like to keep this setting as Context. The question is, why is the default context of my document Hindi script? Is there a way to change this context?

    Read the article

  • Numbering equations based on chapter numbers in MS-Word

    - by Isaac
    I am seeking for a way to number each equation based on the chapter numbers. The number should be placed at the right side of the equation and the equation should be center-aligned. Something like this: (The bounding box around 2.3 is not necessary). I found this article that do this in a tricky way. Sadly it has some problems when I use multilevel numbering for Headings. To conclude, I am looking for a way to numbers equations that: The numbering is formatted as N-M that N is chapter number and M is equation number. equation is placed in center-aligned number is placed in the right side of equation There should be a way to cross-reference each numbered equation. Thanks!

    Read the article

  • Automation for filling in sets of numbers in each row

    - by Brad
    I need to populate the same number 10 times in a row, then the next number up on the next row. starting at 0, ending at 1000 for example: 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 .... 1000 1000 1000 1000 1000 and to 1000 I need to print out these numbers to cut up and put each row of numbers in each envelope to be sold for a Chinese auction at a benefit. How do I do this dynamically without entering in all of the rows by hand?

    Read the article

  • Multiple cable adapter setup not working - VGA to smartphone. All cables tested and work

    - by Christopher Rucinski
    Issue Pictured overhead projector setup does not work. #1 - #2 - #3 - Phone. All cables are tested and work! The issue is the HDMI connection between cable #2 and #3. With all other cables, the screen will automatically be displayed onto the projector screen. No extra work needed. With the pictured setup, the smartphone screen is not displayed onto the projector screen. What is the issue with the HDMI connection?? Background We recently had to do presentations at work (school), but the administration only provided VGA means of hooking up to it. Mostly likely reason probably dealt with cost. Anyways, there are several teachers that have brand new Samsung Series 9 ultrabooks (or similar). You know, the ones without VGA support. So I bought an adapter for those ultrabooks. Cable #5 in the picture below. However, both my coworker and I have been wanting to just display our phone screens on the projector. This I knew would require some extra work. What I have VGA cable to projector (cables go through the wall) For laptops HDMI to VGA cable For laptops MHL adapter For 11-pin microUSB phones microHDMI to VGA cable For ultrabooks 11-pin to 5-pin microUSB adapter For older 5-pin microUSB phones) Equipment Projectors 1 projector with VGA and HDMI input (issue is coworkers forget to switch sources) 1 projector with VGA only input Laptops 2 new Samsung ultrabooks w/o VGA or HDMI support 1 ultrabook with VGA and HDMI support several other laptops with at least VGA support 1 tablet with 11-pin microUSB at least 1 new phone with 11-pin microUSB at least 1 old phone with 5-pin microUSB Tested VGA cable (#1) to laptop Good VGA cable (#1) to HDMI adapter (#2) to laptop Good VGA cable (#1) to microHDMI adapter (#5) to laptop Good Projector to HDMI cable (not shown) to MHL adapter (#3) to Galaxy Note 3 smartphone Good VGA cable (#1) to HDMI adapter (#2) to MHL adapter (#3) to Galaxy Note 3 smartphone Does not work!! Extra Notes The 11-pin MHL adapter will not fit inside the 11-pin to 5-pin microUSB adapter so older phones can be displayed on the screen.

    Read the article

  • I need a js function that can sort state from Dropbox and gave me a phone number to call [on hold]

    - by User584
    AL West AR West CT EAST DC EAST Il West MN East player one groupe A player tow Groupe B player zero Groupe D if the Group is A and the State is AL then Phone = 0762154852 if the Group is B and the State is AR then phone = 2145632541 if the group is D and the state is MN then phone = 2589632541 if i player from a dropbox and then i select State from a dropbox I want the Field phone Show the right number

    Read the article

  • Microsoft souhaiterait vendre 100 millions de Windows Phone en 2012, les raisons de la non-prise en charge du dual-core par l'OS divulguées

    Microsoft a pour objectif de vendre 100 millions de Windows Phone en 2012 Les raisons de la non-prise en charge des processeurs dual-core par l'OS divulguées Microsoft aurait pour objectif interne de commercialiser plus de 100 millions de terminaux Windows Phone en 2012 d'après WMPowerUser, d'une source non divulguée. L'éditeur pourrait atteindre cet objectif ambitieux, si le constructeur Nokia amplifie sa production de terminaux Windows Phone à travers le monde avec des modèles différents. Selon WMPowerUser, les opérateurs s'attendraient à voir Windows Phone prendre 30% de parts de marché de smartphones en 2012. Une estimation qui rejoint celle

    Read the article

  • nokia cell phone not accepting IP from dnsmasq dhcp server

    - by samix
    Hello, I having problem connecting a NOkia cell phone to my home wifi network. The wifi network is provided by a wireless card in a machine running Debian Testing and 2.6.26-2-686 kernel. The cars is D-Link DWL-G520 working in ap mode and has WPA encryption enabled. The wireless network is provided by hostapd using madwifi driver. Windows and Mac machines work properly with this wifi network. When I try to get the Nokia phone to connect to the wifi network, I get these lines in my dnsmasq log (to see lines without wrapping, here is the pastebin link for convenience - http://pastebin.com/m466c8fd2): Oct 27 13:25:21 red hostapd: ath0: STA 11:22:33:44:55:66 IEEE 802.11: disassociated Oct 27 13:25:21 red hostapd: ath0: STA 11:22:33:44:55:66 IEEE 802.11: associated Oct 27 13:25:21 red hostapd: ath0: STA 11:22:33:44:55:66 RADIUS: starting accounting session 4AE664FA-00000036 Oct 27 13:25:21 red hostapd: ath0: STA 11:22:33:44:55:66 WPA: pairwise key handshake completed (WPA) Oct 27 13:25:21 red hostapd: ath0: STA 11:22:33:44:55:66 WPA: group key handshake completed (WPA) Oct 27 13:25:21 red dnsmasq-dhcp[11451]: 3875439214 Available DHCP range: 192.168.5.150 -- 192.168.5.199 Oct 27 13:25:21 red dnsmasq-dhcp[11451]: 3875439214 DHCPDISCOVER(ath0) 0.0.0.0 11:22:33:44:55:66 Oct 27 13:25:21 red dnsmasq-dhcp[11451]: 3875439214 DHCPOFFER(ath0) 192.168.5.21 11:22:33:44:55:66 Oct 27 13:25:21 red dnsmasq-dhcp[11451]: 3875439214 requested options: 12:hostname, 6:dns-server, 15:domain-name, Oct 27 13:25:21 red dnsmasq-dhcp[11451]: 3875439214 requested options: 1:netmask, 3:router, 28:broadcast, 120:sip-server Oct 27 13:25:21 red dnsmasq-dhcp[11451]: 3875439214 tags: known, ath0 Oct 27 13:25:21 red dnsmasq-dhcp[11451]: 3875439214 next server: 192.168.5.1 Oct 27 13:25:21 red dnsmasq-dhcp[11451]: 3875439214 sent size: 1 option: 53:message-type 02 Oct 27 13:25:21 red dnsmasq-dhcp[11451]: 3875439214 sent size: 4 option: 54:server-identifier 192.168.5.1 Oct 27 13:25:21 red dnsmasq-dhcp[11451]: 3875439214 sent size: 4 option: 51:lease-time 00:00:46:50 Oct 27 13:25:21 red dnsmasq-dhcp[11451]: 3875439214 sent size: 4 option: 58:T1 00:00:23:28 Oct 27 13:25:21 red dnsmasq-dhcp[11451]: 3875439214 sent size: 4 option: 59:T2 00:00:3d:86 Oct 27 13:25:21 red dnsmasq-dhcp[11451]: 3875439214 sent size: 4 option: 1:netmask 255.255.255.0 Oct 27 13:25:21 red dnsmasq-dhcp[11451]: 3875439214 sent size: 4 option: 28:broadcast 192.168.5.255 Oct 27 13:25:21 red dnsmasq-dhcp[11451]: 3875439214 sent size: 4 option: 3:router 192.168.5.1 Oct 27 13:25:21 red dnsmasq-dhcp[11451]: 3875439214 sent size: 4 option: 6:dns-server 192.168.5.1 Oct 27 13:25:21 red dnsmasq-dhcp[11451]: 3875439214 sent size: 8 option: 15:domain-name home.pvt Oct 27 13:25:21 red dnsmasq-dhcp[11451]: 3875439214 sent size: 3 option: 12:hostname NokiaCellPhone Anybody know the problem might be? If I switch off dnsmasq dhcp queries logging, i.e. if I decrease the verbosity of the log, all I see are two lines of DHCPDISCOVER(ath0) and DHCPOFFER(ath0) repeatedly in the log with no acceptance by the cell phone. It appears as though the phone is not accepting the dhcp offer. However, if I give the phone a static IP address in its configuration, it works properly on the wifi network. So it appears as though the problem is dhcp related. Hints? Suggestions? Installed stuff: $ dpkg -l dnsmasq hostap* | grep ^i ii dnsmasq 2.50-1 A small caching DNS proxy and DHCP/TFTP server ii dnsmasq-base 2.50-1 A small caching DNS proxy and DHCP/TFTP server ii hostapd 1:0.6.9-3 user space IEEE 802.11 AP and IEEE 802.1X/WPA/ Thanks. PS: Here is the DHCP tcp dump for more information (with mac addresses changed): $ sudo dhcpdump -i ath0 -h ^11:22:33:44:55:66 TIME: 2009-10-30 12:15:32.916 IP: 0.0.0.0 (1:22:33:44:55:66) 255.255.255.255 (ff:ff:ff:ff:ff:ff) OP: 1 (BOOTPREQUEST) HTYPE: 1 (Ethernet) HLEN: 6 HOPS: 0 XID: c3f93d53 SECS: 0 FLAGS: 7f80 CIADDR: 0.0.0.0 YIADDR: 0.0.0.0 SIADDR: 0.0.0.0 GIADDR: 0.0.0.0 CHADDR: 11:22:33:44:55:66:00:00:00:00:00:00:00:00:00:00 SNAME: . FNAME: . OPTION: 53 ( 1) DHCP message type 1 (DHCPDISCOVER) OPTION: 50 ( 4) Request IP address 0.0.0.0 OPTION: 61 ( 7) Client-identifier 01:11:22:33:44:55:66 OPTION: 55 ( 7) Parameter Request List 12 (Host name) 6 (DNS server) 15 (Domainname) 1 (Subnet mask) 3 (Routers) 28 (Broadcast address) 120 (SIP Servers DHCP Option) OPTION: 57 ( 2) Maximum DHCP message size 576 TIME: 2009-10-30 12:15:32.918 IP: 0.0.0.0 (1:22:33:44:55:66) 255.255.255.255 (ff:ff:ff:ff:ff:ff) OP: 1 (BOOTPREQUEST) HTYPE: 1 (Ethernet) HLEN: 6 HOPS: 0 XID: c3f93d53 SECS: 0 FLAGS: 7f80 CIADDR: 0.0.0.0 YIADDR: 0.0.0.0 SIADDR: 0.0.0.0 GIADDR: 0.0.0.0 CHADDR: 11:22:33:44:55:66:00:00:00:00:00:00:00:00:00:00 SNAME: . FNAME: . OPTION: 53 ( 1) DHCP message type 1 (DHCPDISCOVER) OPTION: 50 ( 4) Request IP address 0.0.0.0 OPTION: 61 ( 7) Client-identifier 01:11:22:33:44:55:66 OPTION: 55 ( 7) Parameter Request List 12 (Host name) 6 (DNS server) 15 (Domainname) 1 (Subnet mask) 3 (Routers) 28 (Broadcast address) 120 (SIP Servers DHCP Option) OPTION: 57 ( 2) Maximum DHCP message size 576 TIME: 2009-10-30 12:15:32.918 IP: 192.168.5.1 (a:bb:cc:dd:ee:ff) 255.255.255.255 (ff:ff:ff:ff:ff:ff) OP: 2 (BOOTPREPLY) HTYPE: 1 (Ethernet) HLEN: 6 HOPS: 0 XID: c3f93d53 SECS: 0 FLAGS: 7f80 CIADDR: 0.0.0.0 YIADDR: 192.168.5.21 SIADDR: 192.168.5.1 GIADDR: 0.0.0.0 CHADDR: 11:22:33:44:55:66:00:00:00:00:00:00:00:00:00:00 SNAME: . FNAME: . OPTION: 53 ( 1) DHCP message type 2 (DHCPOFFER) OPTION: 54 ( 4) Server identifier 192.168.5.1 OPTION: 51 ( 4) IP address leasetime 18000 (5h) OPTION: 58 ( 4) T1 9000 (2h30m) OPTION: 59 ( 4) T2 15750 (4h22m30s) OPTION: 1 ( 4) Subnet mask 255.255.255.0 OPTION: 28 ( 4) Broadcast address 192.168.5.255 OPTION: 3 ( 4) Routers 192.168.5.1 OPTION: 6 ( 4) DNS server 192.168.5.1 OPTION: 15 ( 8) Domainname home.pvt OPTION: 12 ( 3) Host name Nokia_E63 TIME: 2009-10-30 12:15:34.922 IP: 0.0.0.0 (1:22:33:44:55:66) 255.255.255.255 (ff:ff:ff:ff:ff:ff) OP: 1 (BOOTPREQUEST) HTYPE: 1 (Ethernet) HLEN: 6 HOPS: 0 XID: c3f93d53 SECS: 2 FLAGS: 7f80 CIADDR: 0.0.0.0 YIADDR: 0.0.0.0 SIADDR: 0.0.0.0 GIADDR: 0.0.0.0 CHADDR: 11:22:33:44:55:66:00:00:00:00:00:00:00:00:00:00 SNAME: . FNAME: . OPTION: 53 ( 1) DHCP message type 1 (DHCPDISCOVER) OPTION: 50 ( 4) Request IP address 0.0.0.0 OPTION: 61 ( 7) Client-identifier 01:11:22:33:44:55:66 OPTION: 55 ( 7) Parameter Request List 12 (Host name) 6 (DNS server) 15 (Domainname) 1 (Subnet mask) 3 (Routers) 28 (Broadcast address) 120 (SIP Servers DHCP Option) OPTION: 57 ( 2) Maximum DHCP message size 576 TIME: 2009-10-30 12:15:34.922 IP: 0.0.0.0 (1:22:33:44:55:66) 255.255.255.255 (ff:ff:ff:ff:ff:ff) OP: 1 (BOOTPREQUEST) HTYPE: 1 (Ethernet) HLEN: 6 HOPS: 0 XID: c3f93d53 SECS: 2 FLAGS: 7f80 CIADDR: 0.0.0.0 YIADDR: 0.0.0.0 SIADDR: 0.0.0.0 GIADDR: 0.0.0.0 CHADDR: 11:22:33:44:55:66:00:00:00:00:00:00:00:00:00:00 SNAME: . FNAME: . OPTION: 53 ( 1) DHCP message type 1 (DHCPDISCOVER) OPTION: 50 ( 4) Request IP address 0.0.0.0 OPTION: 61 ( 7) Client-identifier 01:11:22:33:44:55:66 OPTION: 55 ( 7) Parameter Request List 12 (Host name) 6 (DNS server) 15 (Domainname) 1 (Subnet mask) 3 (Routers) 28 (Broadcast address) 120 (SIP Servers DHCP Option) OPTION: 57 ( 2) Maximum DHCP message size 576 TIME: 2009-10-30 12:15:34.923 IP: 192.168.5.1 (a:bb:cc:dd:ee:ff) 255.255.255.255 (ff:ff:ff:ff:ff:ff) OP: 2 (BOOTPREPLY) HTYPE: 1 (Ethernet) HLEN: 6 HOPS: 0 XID: c3f93d53 SECS: 2 FLAGS: 7f80 CIADDR: 0.0.0.0 YIADDR: 192.168.5.21 SIADDR: 192.168.5.1 GIADDR: 0.0.0.0 CHADDR: 11:22:33:44:55:66:00:00:00:00:00:00:00:00:00:00 SNAME: . FNAME: . OPTION: 53 ( 1) DHCP message type 2 (DHCPOFFER) OPTION: 54 ( 4) Server identifier 192.168.5.1 OPTION: 51 ( 4) IP address leasetime 18000 (5h) OPTION: 58 ( 4) T1 9000 (2h30m) OPTION: 59 ( 4) T2 15750 (4h22m30s) OPTION: 1 ( 4) Subnet mask 255.255.255.0 OPTION: 28 ( 4) Broadcast address 192.168.5.255 OPTION: 3 ( 4) Routers 192.168.5.1 OPTION: 6 ( 4) DNS server 192.168.5.1 OPTION: 15 ( 8) Domainname home.pvt OPTION: 12 ( 3) Host name Nokia_E63 TIME: 2009-10-30 12:15:38.919 IP: 0.0.0.0 (1:22:33:44:55:66) 255.255.255.255 (ff:ff:ff:ff:ff:ff) OP: 1 (BOOTPREQUEST) HTYPE: 1 (Ethernet) HLEN: 6 HOPS: 0 XID: c3f93d53 SECS: 6 FLAGS: 7f80 CIADDR: 0.0.0.0 YIADDR: 0.0.0.0 SIADDR: 0.0.0.0 GIADDR: 0.0.0.0 CHADDR: 11:22:33:44:55:66:00:00:00:00:00:00:00:00:00:00 SNAME: . FNAME: . OPTION: 53 ( 1) DHCP message type 1 (DHCPDISCOVER) OPTION: 50 ( 4) Request IP address 0.0.0.0 OPTION: 61 ( 7) Client-identifier 01:11:22:33:44:55:66 OPTION: 55 ( 7) Parameter Request List 12 (Host name) 6 (DNS server) 15 (Domainname) 1 (Subnet mask) 3 (Routers) 28 (Broadcast address) 120 (SIP Servers DHCP Option) OPTION: 57 ( 2) Maximum DHCP message size 576 TIME: 2009-10-30 12:15:38.920 IP: 0.0.0.0 (1:22:33:44:55:66) 255.255.255.255 (ff:ff:ff:ff:ff:ff) OP: 1 (BOOTPREQUEST) HTYPE: 1 (Ethernet) HLEN: 6 HOPS: 0 XID: c3f93d53 SECS: 6 FLAGS: 7f80 CIADDR: 0.0.0.0 YIADDR: 0.0.0.0 SIADDR: 0.0.0.0 GIADDR: 0.0.0.0 CHADDR: 11:22:33:44:55:66:00:00:00:00:00:00:00:00:00:00 SNAME: . FNAME: . OPTION: 53 ( 1) DHCP message type 1 (DHCPDISCOVER) OPTION: 50 ( 4) Request IP address 0.0.0.0 OPTION: 61 ( 7) Client-identifier 01:11:22:33:44:55:66 OPTION: 55 ( 7) Parameter Request List 12 (Host name) 6 (DNS server) 15 (Domainname) 1 (Subnet mask) 3 (Routers) 28 (Broadcast address) 120 (SIP Servers DHCP Option) OPTION: 57 ( 2) Maximum DHCP message size 576 TIME: 2009-10-30 12:15:38.921 IP: 192.168.5.1 (a:bb:cc:dd:ee:ff) 255.255.255.255 (ff:ff:ff:ff:ff:ff) OP: 2 (BOOTPREPLY) HTYPE: 1 (Ethernet) HLEN: 6 HOPS: 0 XID: c3f93d53 SECS: 6 FLAGS: 7f80 CIADDR: 0.0.0.0 YIADDR: 192.168.5.21 SIADDR: 192.168.5.1 GIADDR: 0.0.0.0 CHADDR: 11:22:33:44:55:66:00:00:00:00:00:00:00:00:00:00 SNAME: . FNAME: . OPTION: 53 ( 1) DHCP message type 2 (DHCPOFFER) OPTION: 54 ( 4) Server identifier 192.168.5.1 OPTION: 51 ( 4) IP address leasetime 18000 (5h) OPTION: 58 ( 4) T1 9000 (2h30m) OPTION: 59 ( 4) T2 15750 (4h22m30s) OPTION: 1 ( 4) Subnet mask 255.255.255.0 OPTION: 28 ( 4) Broadcast address 192.168.5.255 OPTION: 3 ( 4) Routers 192.168.5.1 OPTION: 6 ( 4) DNS server 192.168.5.1 OPTION: 15 ( 8) Domainname home.pvt OPTION: 12 ( 3) Host name Nokia_E63 TIME: 2009-10-30 12:15:46.944 IP: 0.0.0.0 (1:22:33:44:55:66) 255.255.255.255 (ff:ff:ff:ff:ff:ff) OP: 1 (BOOTPREQUEST) HTYPE: 1 (Ethernet) HLEN: 6 HOPS: 0 XID: ccafe769 SECS: 14 FLAGS: 7f80 CIADDR: 0.0.0.0 YIADDR: 0.0.0.0 SIADDR: 0.0.0.0 GIADDR: 0.0.0.0 CHADDR: 11:22:33:44:55:66:00:00:00:00:00:00:00:00:00:00 SNAME: . FNAME: . OPTION: 53 ( 1) DHCP message type 1 (DHCPDISCOVER) OPTION: 50 ( 4) Request IP address 0.0.0.0 OPTION: 61 ( 7) Client-identifier 01:11:22:33:44:55:66 OPTION: 55 ( 7) Parameter Request List 12 (Host name) 6 (DNS server) 15 (Domainname) 1 (Subnet mask) 3 (Routers) 28 (Broadcast address) 120 (SIP Servers DHCP Option) OPTION: 57 ( 2) Maximum DHCP message size 576 TIME: 2009-10-30 12:15:46.944 IP: 0.0.0.0 (1:22:33:44:55:66) 255.255.255.255 (ff:ff:ff:ff:ff:ff) OP: 1 (BOOTPREQUEST) HTYPE: 1 (Ethernet) HLEN: 6 HOPS: 0 XID: ccafe769 SECS: 14 FLAGS: 7f80 CIADDR: 0.0.0.0 YIADDR: 0.0.0.0 SIADDR: 0.0.0.0 GIADDR: 0.0.0.0 CHADDR: 11:22:33:44:55:66:00:00:00:00:00:00:00:00:00:00 SNAME: . FNAME: . OPTION: 53 ( 1) DHCP message type 1 (DHCPDISCOVER) OPTION: 50 ( 4) Request IP address 0.0.0.0 OPTION: 61 ( 7) Client-identifier 01:11:22:33:44:55:66 OPTION: 55 ( 7) Parameter Request List 12 (Host name) 6 (DNS server) 15 (Domainname) 1 (Subnet mask) 3 (Routers) 28 (Broadcast address) 120 (SIP Servers DHCP Option) OPTION: 57 ( 2) Maximum DHCP message size 576 TIME: 2009-10-30 12:15:46.945 IP: 192.168.5.1 (a:bb:cc:dd:ee:ff) 255.255.255.255 (ff:ff:ff:ff:ff:ff) OP: 2 (BOOTPREPLY) HTYPE: 1 (Ethernet) HLEN: 6 HOPS: 0 XID: ccafe769 SECS: 14 FLAGS: 7f80 CIADDR: 0.0.0.0 YIADDR: 192.168.5.21 SIADDR: 192.168.5.1 GIADDR: 0.0.0.0 CHADDR: 11:22:33:44:55:66:00:00:00:00:00:00:00:00:00:00 SNAME: . FNAME: . OPTION: 53 ( 1) DHCP message type 2 (DHCPOFFER) OPTION: 54 ( 4) Server identifier 192.168.5.1 OPTION: 51 ( 4) IP address leasetime 18000 (5h) OPTION: 58 ( 4) T1 9000 (2h30m) OPTION: 59 ( 4) T2 15750 (4h22m30s) OPTION: 1 ( 4) Subnet mask 255.255.255.0 OPTION: 28 ( 4) Broadcast address 192.168.5.255 OPTION: 3 ( 4) Routers 192.168.5.1 OPTION: 6 ( 4) DNS server 192.168.5.1 OPTION: 15 ( 8) Domainname home.pvt OPTION: 12 ( 3) Host name Nokia_E63 TIME: 2009-10-30 12:15:48.952 IP: 0.0.0.0 (1:22:33:44:55:66) 255.255.255.255 (ff:ff:ff:ff:ff:ff) OP: 1 (BOOTPREQUEST) HTYPE: 1 (Ethernet) HLEN: 6 ... and so on ...

    Read the article

  • Disable "mobile phone" and "fax" from joomla contact information

    - by Mala
    Hi I have a joomla installation with a contacts form. Specifically, there are two contacts with position, email, name, phone. However, joomla seems to insist on having two empty columns "Mobile phone" and "Fax" that I can't seem to get rid of. Neither contact has a mobile phone or fax, and they are disabled in both sets of contact parameters? what am I doing wrong? Thanks! Mala

    Read the article

< Previous Page | 30 31 32 33 34 35 36 37 38 39 40 41  | Next Page >