Search Results

Search found 990 results on 40 pages for 'readline'.

Page 34/40 | < Previous Page | 30 31 32 33 34 35 36 37 38 39 40  | Next Page >

  • Delphi simple TCP server hangs. The form freezes but the server continues managing the clients.

    - by NeoNMD
    I'm using a form with an IdTCPServer on it managing strings from the client with a AThread.connection.readln/writeln system. The string handling works and that isn't the problem. The thing is, the form with the server on it hangs and will not load, but it still managed all the clients connected to it so it IS running but it just doesn't work as a form. I'll make a guess that its sitting on a readline or something... but I have NO idea how i can fix this at this moment in time. Please help. procedure TMonitorFrm.ServerExecute(AThread: TIdPeerThread); procedure post(PostMessage:string); begin try AThread.Connection.WriteLn(PostMessage); except showmessage('Cannot post'); end; end; var ActClient : PClient; sTemp, CommBlock, NewCommBlock, ReceiverName, sContent, sSQL, sCommand : String; iCount2, iCount : Integer; sldb : TSQLiteDatabase; sltb : TSQLiteTable; begin if not AThread.Terminated and AThread.Connection.Connected then begin CommBlock := AThread.Connection.ReadLn(); ActClient := PClient(AThread.Data); ActClient.LastAction := Now; sCommand := copy(CommBlock,0,pos(',',CommBlock)-1); {seperate command} sContent := copy(CommBlock,pos(',',CommBlock)+1,length(CommBlock)-(pos(',',CommBlock)+1)); {seperate data block} iCount:= 0 ; if sCommand = 'Announce' then //SPECIAL begin { Do stuff for this command...} end else if sCommand = 'CheckSect' then {Etcetera...} procedure TMonitorFrm.FormCreate(Sender: TObject); var sCompetitionID : string; sldb : TSQLiteDatabase; sltb : TSQLiteTable; begin Clients := TThreadList.Create; Server.Active := True; AreaPnlList := TComponentList.Create; SectionPnlList := TComponentList.Create; Repeat until InputQuery('Competition Select', 'Please type the ID of the competition', sCompetitionID); iCompetitionID:=StrToInt(sCompetitionID); OpenDatabase(slDb); sltb:=slDb.GetTable('SELECT * FROM SectionTable WHERE CompetitionID='+sCompetitionID); Frame31.CreateSections(sltb,Frame31); sltb.Free; CloseDatabase(slDb); { This section needs to check the SQLite databases for sections and list them in the display window and makes a drag n drop profile... } end;

    Read the article

  • Understanding WebRequest

    - by Nai
    I found this snippet of code here that allows you to log into a website and get the response from the logged in page. However, I'm having trouble understanding all the part of the code. I've tried my best to fill in whatever I understand so far. Hope you guys can fill in the blanks for me. Thanks string nick = "mrbean"; string password = "12345"; //this is the query data that is getting posted by the website. //the query parameters 'nick' and 'password' must match the //name of the form you're trying to log into. you can find the input names //by using firebug and inspecting the text field string postData = "nick=" + nick + "&password=" + password; // this puts the postData in a byte Array with a specific encoding //Why must the data be in a byte array? byte[] data = Encoding.ASCII.GetBytes(postData); // this basically creates the login page of the site you want to log into WebRequest request = WebRequest.Create("http://www.mrbeanandme.com/login/"); // im guessing these parameters need to be set but i dont why? request.Method = "POST"; request.ContentType = "application/x-www-form-urlencoded"; request.ContentLength = data.Length; // this opens a stream for writing the post variables. // im not sure what a stream class does. need to do some reading into this. Stream stream = request.GetRequestStream(); // you write the postData to the website and then close the connection? stream.Write(data, 0, data.Length); stream.Close(); // this receives the response after the log in WebResponse response = request.GetResponse(); stream = response.GetResponseStream(); // i guess you need a stream reader to read a stream? StreamReader sr = new StreamReader(stream); // this outputs the code to console and terminates the program Console.WriteLine(sr.ReadToEnd()); Console.ReadLine();

    Read the article

  • protobuf-net NOT faster than binary serialization?

    - by Ashish Gupta
    I wrote a program to serialize a 'Person' class using XMLSerializer, BinaryFormatter and ProtoBuf. I thought protobuf-net should be faster than the other two. Protobuf serialization was faster than XMLSerialization but much slower than the binary serialization. Is my understanding incorrect? Please make me understand this. Thank you for the help. Following is the output:- Person got created using protocol buffer in 347 milliseconds Person got created using XML in 1462 milliseconds Person got created using binary in 2 milliseconds Code below using System; using System.Collections.Generic; using System.Linq; using System.Text; using ProtoBuf; using System.IO; using System.Diagnostics; using System.Runtime.Serialization.Formatters.Binary; namespace ProtocolBuffers { class Program { static void Main(string[] args) { string XMLSerializedFileName = "PersonXMLSerialized.xml"; string ProtocolBufferFileName = "PersonProtocalBuffer.bin"; string BinarySerializedFileName = "PersonBinary.bin"; var person = new Person { Id = 12345, Name = "Fred", Address = new Address { Line1 = "Flat 1", Line2 = "The Meadows" } }; Stopwatch watch = Stopwatch.StartNew(); watch.Start(); using (var file = File.Create(ProtocolBufferFileName)) { Serializer.Serialize(file, person); } watch.Stop(); Console.WriteLine(watch.ElapsedMilliseconds.ToString()); Console.WriteLine("Person got created using protocol buffer in " + watch.ElapsedMilliseconds.ToString() + " milliseconds " ); watch.Reset(); watch.Start(); System.Xml.Serialization.XmlSerializer x = new System.Xml.Serialization.XmlSerializer(person.GetType()); using (TextWriter w = new StreamWriter(XMLSerializedFileName)) { x.Serialize(w, person); } watch.Stop(); Console.WriteLine(watch.ElapsedMilliseconds.ToString()); Console.WriteLine("Person got created using XML in " + watch.ElapsedMilliseconds.ToString() + " milliseconds"); watch.Reset(); watch.Start(); using (Stream stream = File.Open(BinarySerializedFileName, FileMode.Create)) { BinaryFormatter bformatter = new BinaryFormatter(); //Console.WriteLine("Writing Employee Information"); bformatter.Serialize(stream, person); } watch.Stop(); Console.WriteLine(watch.ElapsedMilliseconds.ToString()); Console.WriteLine("Person got created using binary in " + watch.ElapsedMilliseconds.ToString() + " milliseconds"); Console.ReadLine(); } } [ProtoContract] [Serializable] public class Person { [ProtoMember(1)] public int Id {get;set;} [ProtoMember(2)] public string Name { get; set; } [ProtoMember(3)] public Address Address {get;set;} } [ProtoContract] [Serializable] public class Address { [ProtoMember(1)] public string Line1 {get;set;} [ProtoMember(2)] public string Line2 {get;set;} } }

    Read the article

  • Reading POST data from html form sent to serversocket.

    - by user32167
    i try to write simplest possible server app in Java, displaying html form with textarea input, which after submitting gives me possibility to parse xml typed in that textarea. For now i build simple serversocket based server like that: import java.io.BufferedReader; import java.io.InputStreamReader; import java.io.PrintWriter; import java.net.ServerSocket; import java.net.Socket; public class WebServer { protected void start() { ServerSocket s; String gets = ""; System.out.println("Start on port 80"); try { // create the main server socket s = new ServerSocket(80); } catch (Exception e) { System.out.println("Error: " + e); return; } System.out.println("Waiting for connection"); for (;;) { try { // wait for a connection Socket remote = s.accept(); // remote is now the connected socket System.out.println("Connection, sending data."); BufferedReader in = new BufferedReader(new InputStreamReader( remote.getInputStream())); PrintWriter out = new PrintWriter(remote.getOutputStream()); String str = "."; while (!str.equals("")) { str = in.readLine(); if (str.contains("GET")){ gets = str; break; } } out.println("HTTP/1.0 200 OK"); out.println("Content-Type: text/html"); out.println(""); // Send the HTML page String method = "get"; out.print("<html><form method="+method+">"); out.print("<textarea name=we></textarea></br>"); out.print("<input type=text name=a><input type=submit></form></html>"); out.println(gets); out.flush(); remote.close(); } catch (Exception e) { System.out.println("Error: " + e); } } } public static void main(String args[]) { WebServer ws = new WebServer(); ws.start(); } } After form (textarea with xml and one additional text input) is submitted in 'gets' String-type variable I have Urlencoded values of my variables (also displayed on the screen, it looks like that: gets = GET /?we=%3Cnetwork+ip_addr%3D%2210.0.0.0%2F8%22+save_ip%3D%22true%22%3E%0D%0A%3Csubnet+interf_used%3D%22200%22+name%3D%22lan1%22+%2F%3E%0D%0A%3Csubnet+interf_used%3D%22254%22+name%3D%22lan2%22+%2F%3E%0D%0A%3C%2Fnetwork%3E&a=fooBar HTTP/1.1 What can i do to change GET to POST method (if i simply change it in form and than put " if (str.contains("POST")){" it gives me string like gets = POST / HTTP/1.1 with no variables. And after that, how i can use xml from my textarea field (called 'we')?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Getting rid of "static" references in C#

    - by DevEight
    Hello. I've recently begun learning C# but have encountered an annoying problem. Every variable I want available to all functions in my program I have to put a "static" in front of and also every function. What I'd like to know is how to avoid this, if possible? Also, small side question: creating public variables inside functions? This is what my program looks like right now, and I want to basically keep it like that, without having to add "static" everywhere: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Net; using System.Threading; using System.Net.Sockets; namespace NetworkExercise { class Client { public IPAddress addr; public int port; public string name; public Thread thread; public TcpClient tcp; public NetworkStream stream; public Client(IPAddress addr, int port, string name, NetworkStream stream) { } } class Program { //NETWORK TcpListener tcpListener; Thread listenThread; ASCIIEncoding encoder = new ASCIIEncoding(); //DATA byte[] buffer = new byte[4096]; string servIp; int servPort; //CLIENT MANAGEMENT int clientNum; static void Main(string[] args) { beginConnect(); } public void beginConnect() { Console.Write("Server IP (leave blank if you're the host): "); servIp = Console.ReadLine(); Console.Write("Port: "); servPort = Console.Read(); tcpListener = new TcpListener(IPAddress.Any, servPort); listenThread = new Thread(new ThreadStart(listenForClients)); listenThread.Start(); } public void listenForClients() { tcpListener.Start(); Console.WriteLine("Listening for clients..."); while (true) { Client cl = new Client(null, servPort, null, null); cl.tcp = tcpListener.AcceptTcpClient(); ThreadStart pts = delegate { handleClientCom(cl); }; cl.thread = new Thread(pts); cl.thread.Start(); } } public void handleClientCom(Client cl) { cl.stream = cl.tcp.GetStream(); } } }

    Read the article

  • How do I detect server status in a port scanner java implementation

    - by akz
    I am writing a port scanner in Java and I want to be able to distinct the following 4 use cases: port is open port is open and server banner was read port is closed server is not live I have the following code: InetAddress address = InetAddress.getByName("google.com"); int[] ports = new int[]{21, 22, 23, 80, 443}; for (int i = 0; i < ports.length; i++) { int port = ports[i]; Socket socket = null; try { socket = new Socket(address, port); socket.setSoTimeout(500); System.out.println("port " + port + " open"); BufferedReader reader = new BufferedReader( new InputStreamReader(socket.getInputStream())); String line = reader.readLine(); if (line != null) { System.out.println(line); } socket.close(); } catch (SocketTimeoutException ex) { // port was open but nothing was read from input stream ex.printStackTrace(); } catch (ConnectException ex) { // port is closed ex.printStackTrace(); } catch (IOException e) { e.printStackTrace(); } finally { if (socket != null && !socket.isClosed()) { try { socket.close(); } catch (Exception e) { e.printStackTrace(); } } } } The problem is that I get a ConnectionException both when the port is closed and the server cannot be reached but with a different exception message: java.net.ConnectException: Connection timed out: connect when the connection was never established and java.net.ConnectException: Connection refused: connect when the port was closed so I cannot make the distinction between the two use cases without digging into the actual exception message. Same thing happens when I try a different approach for the socket creation. If I use: socket = new Socket(); socket.setSoTimeout(500); socket.connect(new InetSocketAddress(address, port), 1000); I have the same problem but with the SocketTimeoutException instead. I get a java.net.SocketTimeoutException: Read timed out if port was open but there was no banner to be read and java.net.SocketTimeoutException: connect timed out if server is not live or port is closed. Any ideas? Thanks in advance!

    Read the article

  • How can I connect to MSMQ over a workgroup?

    - by cyclotis04
    I'm writing a simple console client-server app using MSMQ. I'm attempting to run it over the workgroup we have set up. They run just fine when run on the same computer, but I can't get them to connect over the network. I've tried adding Direct=, OS:, and a bunch of combinations of other prefaces, but I'm running out of ideas, and obviously don't know the right way to do it. My queue's don't have GUIDs, which is also slightly confusing. Whenever I attempt to connect to a remote machine, I get an invalid queue name message. What do I have to do to make this work? Server: class Program { static string _queue = @"\Private$\qim"; static MessageQueue _mq; static readonly object _mqLock = new object(); static void Main(string[] args) { _queue = Dns.GetHostName() + _queue; lock (_mqLock) { if (!MessageQueue.Exists(_queue)) _mq = MessageQueue.Create(_queue); else _mq = new MessageQueue(_queue); } Console.Write("Starting server at {0}:\n\n", _mq.Path); _mq.Formatter = new BinaryMessageFormatter(); _mq.BeginReceive(new TimeSpan(0, 1, 0), new object(), OnReceive); while (Console.ReadKey().Key != ConsoleKey.Escape) { } _mq.Close(); } static void OnReceive(IAsyncResult result) { Message msg; lock (_mqLock) { try { msg = _mq.EndReceive(result); Console.Write(msg.Body); } catch (Exception ex) { Console.Write("\n" + ex.Message + "\n"); } } _mq.BeginReceive(new TimeSpan(0, 1, 0), new object(), OnReceive); } } Client: class Program { static MessageQueue _mq; static void Main(string[] args) { string queue; while (_mq == null) { Console.Write("Enter the queue name:\n"); queue = Console.ReadLine(); //queue += @"\Private$\qim"; try { if (MessageQueue.Exists(queue)) _mq = new MessageQueue(queue); } catch (Exception ex) { Console.Write("\n" + ex.Message + "\n"); _mq = null; } } Console.Write("Connected. Begin typing.\n\n"); _mq.Formatter = new BinaryMessageFormatter(); ConsoleKeyInfo key = new ConsoleKeyInfo(); while (key.Key != ConsoleKey.Escape) { key = Console.ReadKey(); _mq.Send(key.KeyChar.ToString()); } } }

    Read the article

  • Parsing XML file using a for loop

    - by Johnny Spintel
    I have been working on this program which inserts an XML file into a MYSQL database. I'm new to the whole .jar idea by inserting packages. Im having an issue with parse(), select(), and children(). Can someone inform me how I could fix this issue? Here is my stack trace and my program below: Exception in thread "main" java.lang.Error: Unresolved compilation problems: The method select(String) is undefined for the type Document The method children() is undefined for the type Element The method children() is undefined for the type Element The method children() is undefined for the type Element The method children() is undefined for the type Element at jdbc.parseXML.main(parseXML.java:28) import java.io.*; import java.sql.*; import org.jsoup.Jsoup; import org.w3c.dom.*; import javax.xml.parsers.*; public class parseXML{ public static void main(String xml) { try{ BufferedReader br = new BufferedReader(new FileReader(new File("C:\\staff.xml"))); String line; StringBuilder sb = new StringBuilder(); while((line=br.readLine())!= null){ sb.append(line.trim()); } Document doc = Jsoup.parse(line); StringBuilder queryBuilder; StringBuilder columnNames; StringBuilder values; for (Element row : doc.select("row")) { // Start the query queryBuilder = new StringBuilder("insert into customer("); columnNames = new StringBuilder(); values = new StringBuilder(); for (int x = 0; x < row.children().size(); x++) { // Append the column name and it's value columnNames.append(row.children().get(x).tagName()); values.append(row.children().get(x).text()); if (x != row.children().size() - 1) { // If this is not the last item, append a comma columnNames.append(","); values.append(","); } else { // Otherwise, add the closing paranthesis columnNames.append(")"); values.append(")"); } } // Add the column names and values to the query queryBuilder.append(columnNames); queryBuilder.append(" values("); queryBuilder.append(values); // Print the query System.out.println(queryBuilder); } }catch (Exception err) { System.out.println(" " + err.getMessage ()); } } }

    Read the article

  • How to perform gui operation in doInBackground method?

    - by jM2.me
    My application reads a user selected file which contains addresses and then displays on mapview when done geocoding. To avoid hanging app the importing and geocoding is done in AsyncTask. public class LoadOverlayAsync extends AsyncTask<Uri, Integer, StopsOverlay> { Context context; MapView mapView; Drawable drawable; public LoadOverlayAsync(Context con, MapView mv, Drawable dw) { context = con; mapView = mv; drawable = dw; } protected StopsOverlay doInBackground(Uri... uris) { StringBuilder text = new StringBuilder(); StopsOverlay stopsOverlay = new StopsOverlay(drawable, context); Geocoder geo = new Geocoder(context, Locale.US); try { File file = new File(new URI(uris[0].toString())); BufferedReader br = new BufferedReader(new FileReader(file)); String line; while ((line = br.readLine()) != null) { StopOverlay stopOverlay = null; String[] tempLine = line.split("~"); List<Address> results = geo.getFromLocationName(tempLine[4] + " " + tempLine[5] + " " + tempLine[7] + " " + tempLine[8], 10); if (results.size() > 0) { Toast progressToast = Toast.makeText(context, "More than one yo", 1000); progressToast.show(); } else if (results.size() == 1) { Address addr = results.get(0); GeoPoint mPoint = new GeoPoint((int)(addr.getLatitude() * 1E6), (int)(addr.getLongitude() * 1E6)); stopOverlay = new StopOverlay(mPoint, tempLine); } if (stopOverlay != null) { stopsOverlay.addOverlay(stopOverlay); } //List<Address> results = geo.getFromLocationName(locationName, maxResults) } } catch (URISyntaxException e) { showErrorToast(e.toString()); //e.printStackTrace(); } catch (FileNotFoundException e) { showErrorToast(e.toString()); //e.printStackTrace(); } catch (IOException e) { showErrorToast(e.toString()); //e.printStackTrace(); } return stopsOverlay; } protected void onProgressUpdate(Integer... progress) { Toast progressToast = Toast.makeText(context, "Loaded " + progress.toString(), 1000); progressToast.show(); } protected void onPostExecute(StopsOverlay so) { //mapView.getOverlays().add(so); Toast progressToast = Toast.makeText(context, "Done geocoding", 1000); progressToast.show(); } protected void showErrorToast(String msg) { Toast Newtoast = Toast.makeText(context, msg, 10000); Newtoast.show(); } } But if geocode fails, I want a dialog popup to let user edit the address. That would require calling on gui method while in doInBackground. What would be a good workaround this?

    Read the article

  • What is the best way to return two values from a method?

    - by Edward Tanguay
    When I have to write methods which return two values, I usually go about it as in the following code which returns a List<string>. Or if I have to return e.g. a id and string, then I return a List<object> and then pick them out with index number and recast the values. This recasting and referencing by index seems inelegant so I want to develop a new habit for methods that return two values. What is the best pattern for this? using System; using System.Collections.Generic; using System.Linq; namespace MultipleReturns { class Program { static void Main(string[] args) { string extension = "txt"; { List<string> entries = GetIdCodeAndFileName("first.txt", extension); Console.WriteLine("{0}, {1}", entries[0], entries[1]); } { List<string> entries = GetIdCodeAndFileName("first", extension); Console.WriteLine("{0}, {1}", entries[0], entries[1]); } Console.ReadLine(); } /// <summary> /// gets "first.txt", "txt" and returns "first", "first.txt" /// gets "first", "txt" and returns "first", "first.txt" /// it is assumed that extensions will always match /// </summary> /// <param name="line"></param> public static List<string> GetIdCodeAndFileName(string line, string extension) { if (line.Contains(".")) { List<string> parts = line.BreakIntoParts("."); List<string> returnItems = new List<string>(); returnItems.Add(parts[0]); returnItems.Add(line); return returnItems; } else { List<string> returnItems = new List<string>(); returnItems.Add(line); returnItems.Add(line + "." + extension); return returnItems; } } } public static class StringHelpers { public static List<string> BreakIntoParts(this string line, string separator) { if (String.IsNullOrEmpty(line)) return null; else { return line.Split(new string[] { separator }, StringSplitOptions.None).Select(p => p.Trim()).ToList(); } } } }

    Read the article

  • Creating a binary file from an IntelHex in C#

    - by Allek
    I'm trying to create a binary file from a intelHex file. Iside the intelHex file I have data and address to which I should write the data inside the binary file. IntelHex file looks like that :10010000214601360121470136007EFE09D2190140 :100110002146017EB7C20001FF5F16002148011988 :10012000194E79234623965778239EDA3F01B2CAA7 :100130003F0156702B5E712B722B732146013421C7 :00000001FF So I have 4 lines here with data since the last one tells us thats the end of file. Here is what I'm doing to create the file while (!streamReader.EndOfStream) { string temp = String.Empty; int address = 0; line = streamReader.ReadLine(); // Get address for each data address = Convert.ToInt32(line.Substring(3, 4), 16); // Get data from each line temp = line.Substring(7, 2); if (temp == "01") break; else { temp = line.Substring(9, line.Length - 11); string[] array = new string[(temp.Length / 2)]; int j = 0; for (int i = 0; i < array.Length; ++i) { array[i] = temp[j].ToString() + temp[j + 1].ToString(); j = j + 2; } temp = String.Empty; for (int i = 0; i < array.Length; ++i) { temp = temp + Convert.ToChar(Convert.ToInt32(array[i], 16)); } } binaryWriter.Seek(address, SeekOrigin.Begin); binaryWriter.Write(temp); binaryWriter.Flush(); } Console.WriteLine("Done...\nPress any key to exit..."); The problem here is, that data in binary file in some places is not equal to data from the intelHex file. Looks like there is some random data added to the file and I do not know from where. First time I saw that there is an additional data before the data from the intelHex file. For instance first data line starts with 21, but in binary file I have a number 12 before the 21. I do not know what is wrong here. Hope someone can help me or guide me where I can find some usefull informations about creating binary files in C#

    Read the article

  • Fast response on first Socket I/O request but slow every other time when communicating with remote serial port

    - by GreenGodot
    I'm using sockets to pass Serial commands to a remote device. And the response to that request is sent back and printed out. However, I am having a problem in that the first time it is instant but the rest of the time it can take up to 20 seconds to receive a reply. I think the problem is with my attempt at threading but I am not entirely sure. new Thread() { @Override public void run() { System.out.println("opened"); try { isSocketRetrieving.setText("Opening Socket"); socket = new Socket(getAddress(), getRemotePort())); DataOutput = new DataOutputStream(socket .getOutputStream()); inFromServer = new BufferedReader( new InputStreamReader(socket .getInputStream())); String line = ""; isSocketRetrieving.setText("Reading Stream......"); while ((line = inFromServer.readLine()) != null) { System.out.println(line); if (line.contains(getHandshakeRequest())) { DataOutput.write((getHandshakeResponse()toString() + "\r").getBytes()); DataOutput.flush(); DataOutput .write((getCommand().toString() + "\r").getBytes()); DataOutput.flush(); int pause = (line.length()*8*1000)/getBaud(); sleep(pause); } else if (line.contains(readingObject .getExpected())) { System.out.println(line); textArea.append("value = " + line + "\n"); textAreaScroll.revalidate(); System.out.println("Got Value"); break; } } System.out.println("Ended"); try { inFromServer.close(); DataOutput.close(); socket.close(); isSocketRetrieving.setText("Socket is inactive..."); rs232Table.addMouseListener(listener); interrupt(); join(); } catch (IOException e) { e.printStackTrace(); } catch (InterruptedException e) { System.out.println("Thread exited"); } } catch (NumberFormatException e1) { e1.printStackTrace(); } catch (UnknownHostException e1) { e1.printStackTrace(); } catch (IOException e1) { e1.printStackTrace(); } catch (InterruptedException e) { // TODO Auto-generated catch block e.printStackTrace(); } } }.start();

    Read the article

  • Java: Multithreading & UDP Socket Programming

    - by Ravi
    I am new to multithreading & socket programming in Java. I would like to know what is the best way to implement 2 threads - one for receiving a socket and one for sending a socket. If what I am trying to do sounds absurd, pls let me know why! The code is largely inspired from Sun's tutorials online.I want to use Multicast sockets so that I can work with a multicast group. class server extends Thread { static protected MulticastSocket socket = null; protected BufferedReader in = null; public InetAddress group; private static class receive implements Runnable { public void run() { try { byte[] buf = new byte[256]; DatagramPacket pkt = new DatagramPacket(buf,buf.length); socket.receive(pkt); String received = new String(pkt.getData(),0,pkt.getLength()); System.out.println("From server@" + received); Thread.sleep(1000); } catch (IOException e) { System.out.println("Error:"+e); } catch (InterruptedException e) { System.out.println("Error:"+e); } } } public server() throws IOException { super("server"); socket = new MulticastSocket(4446); group = InetAddress.getByName("239.231.12.3"); socket.joinGroup(group); } public void run() { while(1>0) { try { byte[] buf = new byte[256]; DatagramPacket pkt = new DatagramPacket(buf,buf.length); //String msg = reader.readLine(); String pid = ManagementFactory.getRuntimeMXBean().getName(); buf = pid.getBytes(); pkt = new DatagramPacket(buf,buf.length,group,4446); socket.send(pkt); Thread t = new Thread(new receive()); t.start(); while(t.isAlive()) { t.join(1000); } sleep(1); } catch (IOException e) { System.out.println("Error:"+e); } catch (InterruptedException e) { System.out.println("Error:"+e); } } //socket.close(); } public static void main(String[] args) throws IOException { new server().start(); //System.out.println("Hello"); } }

    Read the article

  • when get pagecontent from URL the connect alway return nopermistion ?

    - by tiendv
    I have a methor to return pagecontent of link but when it run, alway return "Do not perrmisson ", plesea check it here is code to return string pagecontent public static String getPageContent(String targetURL) throws Exception { Hashtable contentHash = new Hashtable(); URL url; URLConnection conn; // The data streams used to read from and write to the URL connection. DataOutputStream out; DataInputStream in; // String returned as the result . String returnString = ""; // Create the URL object and make a connection to it. url = new URL(targetURL); conn = url.openConnection(); // check out permission of acess URL if (conn.getPermission() != null) { returnString = "Do not Permission access URL "; } else { // Set connection parameters. We need to perform input and output, // so set both as true. conn.setDoInput(true); conn.setDoOutput(true); // Disable use of caches. conn.setUseCaches(false); // Set the content type we are POSTing. We impersonate it as // encoded form data conn.setRequestProperty("Content-Type", "application/x-www-form-urlencoded"); // get the output stream . out = new DataOutputStream(conn.getOutputStream()); String content = ""; // Create a single String value pairs for all the keys // in the Hashtable passed to us. Enumeration e = contentHash.keys(); boolean first = true; while (e.hasMoreElements()) { // For each key and value pair in the hashtable Object key = e.nextElement(); Object value = contentHash.get(key); // If this is not the first key-value pair in the hashtable, // concantenate an "&" sign to the constructed String if (!first) content += "&"; // append to a single string. Encode the value portion content += (String) key + "=" + URLEncoder.encode((String) value); first = false; } // Write out the bytes of the content string to the stream. out.writeBytes(content); out.flush(); out.close(); // check if can't read from URL // Read input from the input stream. in = new DataInputStream(conn.getInputStream()); String str; while (null != ((str = in.readLine()))) { returnString += str + "\n"; } in.close(); } // return the string that was read. return returnString; }

    Read the article

  • Two collections and a for loop. (Urgent help needed) Checking an object variable against an inputted

    - by Elliott
    Hi there, I'm relatively new to java, I'm certain the error is trivial. But can't for the life of me spot it. I have an end of term exam on monday and currently trying to get to grips with past papers! Anyway heregoes, in another method (ALGO_1) I search over elements of and check the value H_NAME equals a value entered in the main. When I attempt to run the code I get a null pointer exception, also upon trying to print (with System.out.println etc) the H_NAME value after each for loop in the snippet I also get a null statement returned to me. I am fairly certain that the collection is simply not storing the data gathered up by the Scanner. But then again when I check the collection size with size() it is about the right size. Either way I'm pretty lost and would appreciate the help. Main questions I guess to ask are: from the readBackground method is the data.add in the wrong place? is the snippet simply structured wrongly? oh and another point when I use System.out.println to check the Background object values name, starttime, increment etc they print out fine. Thanks in advance.(PS im guessing the formatting is terrible, apologies.) snippet of code: for(Hydro hd: hydros){ System.out.println(hd.H_NAME); for(Background back : backgs){ System.out.println(back.H_NAME); if(back.H_NAME.equals(hydroName)){ //get error here public static Collection<Background> readBackground(String url) throws IOException { URL u = new URL(url); InputStream is = u.openStream(); InputStreamReader isr = new InputStreamReader(is); BufferedReader b = new BufferedReader(isr); String line =""; Vector<Background> data = new Vector<Background>(); while((line = b.readLine())!= null){ Scanner s = new Scanner(line); String name = s.next(); double starttime = Double.parseDouble(s.next()); double increment = Double.parseDouble(s.next()); double sum = 0; double p = 0; double nterms = 0; while((s.hasNextDouble())){ p = Double.parseDouble(s.next()); nterms++; sum += p; } double pbmean = sum/nterms; Background SAMP = new Background(name, starttime, increment, pbmean); data.add(SAMP); } return data; } Edit/Delete Message

    Read the article

  • Android , Read in binary data and write it to file

    - by Shpongle
    Hi all , Im trying to read in image file from a server , with the code below . It keeps going into the exception. I know the correct number of bytes are being sent as I print them out when received. Im sending the image file from python like so #open the image file and read it into an object imgfile = open (marked_image, 'rb') obj = imgfile.read() #get the no of bytes in the image and convert it to a string bytes = str(len(obj)) #send the number of bytes self.conn.send( bytes + '\n') if self.conn.sendall(obj) == None: imgfile.flush() imgfile.close() print 'Image Sent' else: print 'Error' Here is the android part , this is where I'm having the problem. Any suggestions on the best way to go about receiving the image and writing it to a file ? //read the number of bytes in the image String noOfBytes = in.readLine(); Toast.makeText(this, noOfBytes, 5).show(); byte bytes [] = new byte [Integer.parseInt(noOfBytes)]; //create a file to store the retrieved image File photo = new File(Environment.getExternalStorageDirectory(), "PostKey.jpg"); DataInputStream dis = new DataInputStream(link.getInputStream()); try{ os =new FileOutputStream(photo); byte buf[]=new byte[1024]; int len; while((len=dis.read(buf))>0) os.write(buf,0,len); Toast.makeText(this, "File recieved", 5).show(); os.close(); dis.close(); }catch(IOException e){ Toast.makeText(this, "An IO Error Occured", 5).show(); } EDIT: I still cant seem to get it working. I have been at it since and the result of all my efforts have either resulted in a file that is not the full size or else the app crashing. I know the file is not corrupt before sending server side. As far as I can tell its definitely sending too as the send all method in python sends all or throws an exception in the event of an error and so far it has never thrown an exception. So the client side is messed up . I have to send the file from the server so I cant use the suggestion suggested by Brian .

    Read the article

  • [java] reading POST data from html form sent to serversocket.

    - by user32167
    i try to write simplest possible server app in Java, displaying html form with textarea input, which after submitting gives me possibility to parse xml typed in thet textarea. For now i build simple serversocket based server like that: import java.io.BufferedReader; import java.io.InputStreamReader; import java.io.PrintWriter; import java.net.ServerSocket; import java.net.Socket; public class WebServer { protected void start() { ServerSocket s; String gets = ""; System.out.println("Start on port 80"); try { // create the main server socket s = new ServerSocket(80); } catch (Exception e) { System.out.println("Error: " + e); return; } System.out.println("Waiting for connection"); for (;;) { try { // wait for a connection Socket remote = s.accept(); // remote is now the connected socket System.out.println("Connection, sending data."); BufferedReader in = new BufferedReader(new InputStreamReader( remote.getInputStream())); PrintWriter out = new PrintWriter(remote.getOutputStream()); String str = "."; while (!str.equals("")) { str = in.readLine(); if (str.contains("GET")){ gets = str; break; } } out.println("HTTP/1.0 200 OK"); out.println("Content-Type: text/html"); out.println(""); // Send the HTML page String method = "get"; out.print("<html><form method="+method+">"); out.print("<textarea name=we></textarea></br>"); out.print("<input type=text name=a><input type=submit></form></html>"); out.println(gets); out.flush(); remote.close(); } catch (Exception e) { System.out.println("Error: " + e); } } } public static void main(String args[]) { WebServer ws = new WebServer(); ws.start(); } } After form (textarea with xml and one additional text input) is submitted in 'gets' String-type variable I have Urlencoded values of my variables (also displayed on the screen, it looks like that: gets = GET /?we=%3Cnetwork+ip_addr%3D%2210.0.0.0%2F8%22+save_ip%3D%22true%22%3E%0D%0A%3Csubnet+interf_used%3D%22200%22+name%3D%22lan1%22+%2F%3E%0D%0A%3Csubnet+interf_used%3D%22254%22+name%3D%22lan2%22+%2F%3E%0D%0A%3C%2Fnetwork%3E&a=fooBar HTTP/1.1 What can i do to change GET to POST method (if i simply change it in form and than put " if (str.contains("GET")){" it gives me string like gets = POST / HTTP/1.1 with no variables. And after that, how i can use xml from my textarea field (called 'we')?

    Read the article

  • I would like to run my Java program on System Startup on Mac OS/Windows. How can I do this?

    - by Misha Koshelev
    Here is what I came up with. It works but I was wondering if there is something more elegant. Thank you! Misha package com.mksoft.fbbday; import java.io.BufferedReader; import java.io.InputStreamReader; import java.io.IOException; import java.net.URI; import java.net.URISyntaxException; import java.io.File; import java.io.FileWriter; import java.io.PrintWriter; public class RunOnStartup { public static void install(String className,boolean doInstall) throws IOException,URISyntaxException { String osName=System.getProperty("os.name"); String fileSeparator=System.getProperty("file.separator"); String javaHome=System.getProperty("java.home"); String userHome=System.getProperty("user.home"); File jarFile=new File(RunOnStartup.class.getProtectionDomain().getCodeSource().getLocation().toURI()); if (osName.startsWith("Windows")) { Process process=Runtime.getRuntime().exec("reg query \"HKCU\\Software\\Microsoft\\Windows\\CurrentVersion\\Explorer\\Shell Folders\" /v Startup"); BufferedReader in=new BufferedReader(new InputStreamReader(process.getInputStream())); String result="",line; while ((line=in.readLine())!=null) { result+=line; } in.close(); result=result.replaceAll(".*REG_SZ[ ]*",""); File startupFile=new File(result+fileSeparator+jarFile.getName().replaceFirst(".jar",".bat")); if (doInstall) { PrintWriter out=new PrintWriter(new FileWriter(startupFile)); out.println("@echo off"); out.println("start /min \"\" \""+javaHome+fileSeparator+"bin"+fileSeparator+"java.exe -cp "+jarFile+" "+className+"\""); out.close(); } else { if (startupFile.exists()) { startupFile.delete(); } } } else if (osName.startsWith("Mac OS")) { File startupFile=new File(userHome+"/Library/LaunchAgents/com.mksoft."+jarFile.getName().replaceFirst(".jar",".plist")); if (doInstall) { PrintWriter out=new PrintWriter(new FileWriter(startupFile)); out.println(""); out.println(""); out.println(""); out.println(""); out.println(" Label"); out.println(" com.mksoft."+jarFile.getName().replaceFirst(".jar","")+""); out.println(" ProgramArguments"); out.println(" "); out.println(" "+javaHome+fileSeparator+"bin"+fileSeparator+"java"); out.println(" -cp"); out.println(" "+jarFile+""); out.println(" "+className+""); out.println(" "); out.println(" RunAtLoad"); out.println(" "); out.println(""); out.println(""); out.close(); } else { if (startupFile.exists()) { startupFile.delete(); } } } } }

    Read the article

  • Android: Unable to access a local website over HTTPS

    - by user1253789
    I am trying to access a locally hosted website and get its HTML source to parse. I have few questions: 1) Can I use "https://An IP ADDRESS HERE" as a valid URL to try and access. I do not want to make changes in the /etc/hosts file so I want to do it this way. 2) I cannot get the html, since it is giving me Handshake exceptions and Certificate issues. I have tried a lot of help available over the web , but am not successful. Here is the code I am using: public class MainActivity extends Activity { private TextView textView; String response = ""; String finalresponse=""; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.activity_main); textView = (TextView) findViewById(R.id.TextView01); System.setProperty("javax.net.ssl.trustStore","C:\\User\\*" ); System.setProperty("javax.net.ssl.trustStorePassword", "" ); } private class DownloadWebPageTask extends AsyncTask<String, Void, String> { @Override protected String doInBackground(String... urls) { TrustManager[] trustAllCerts = new TrustManager[] { new X509TrustManager() { public java.security.cert.X509Certificate[] getAcceptedIssuers() { return null; } public void checkClientTrusted(java.security.cert.X509Certificate[] certs, String authType) { } public void checkServerTrusted(java.security.cert.X509Certificate[] certs, String authType) { } } }; try { SSLContext sc = SSLContext.getInstance("SSL"); sc.init(null, trustAllCerts, new java.security.SecureRandom()); HttpsURLConnection.setDefaultSSLSocketFactory(sc.getSocketFactory()); } catch (Exception e) { } try { URL url = new URL("https://172.27.224.133"); HttpsURLConnection con =(HttpsURLConnection)url.openConnection(); con.setHostnameVerifier(new AllowAllHostnameVerifier()); finalresponse=readStream(con.getInputStream()); } catch (Exception e) { e.printStackTrace(); } return finalresponse; } private String readStream(InputStream in) { BufferedReader reader = null; try { reader = new BufferedReader(new InputStreamReader(in)); String line = ""; while ((line = reader.readLine()) != null) { response+=line; } } catch (IOException e) { e.printStackTrace(); } finally { if (reader != null) { try { reader.close(); } catch (IOException e) { e.printStackTrace(); } } } return response; } @Override protected void onPostExecute(String result) { textView.setText(finalresponse); } } public void readWebpage(View view) { DownloadWebPageTask task = new DownloadWebPageTask(); task.execute(new String[] { "https://172.27.224.133" }); } }

    Read the article

  • Socket connection to a telnet-based server hangs on read

    - by mixwhit
    I'm trying to write a simple socket-based client in Python that will connect to a telnet server. I can test the server by telnetting to its port (5007), and entering text. It responds with a NAK (error) or an AK (success), sometimes accompanied by other text. Seems very simple. I wrote a client to connect and communicate with the server, but it hangs on the first attempt to read the response. The connection is successful. Queries like getsockname and getpeername are successful. The send command returns a value that equals the number of characters I'm sending, so it seems to be sending correctly. But in the end, it always hangs when I try to read the response. I've tried using both file-based objects like readline and write (via socket.makefile), as well as using send and recv. With the file object I tried making it with "rw" and reading and writing via that object, and later tried one object for "r" and another for "w" to separate them. None of these worked. I used a packet sniffer to watch what's going on. I'm not versed in all that I'm seeing, but during a telnet session I can see my typed text and the server's text coming back. During my Python socket connection, I can see my text going to the server, but packets back don't seem to have any text in them. Any ideas on what I'm doing wrong, or any strategies to try? Here's the code I'm using (in this case, it's with send and recv): #!/usr/bin/python host = "localhost" port = 5007 msg = "HELLO EMC 1 1" msg2 = "HELLO" import socket import sys try: skt = socket.socket(socket.AF_INET, socket.SOCK_STREAM) except socket.error, e: print("Error creating socket: %s" % e) sys.exit(1) try: skt.connect((host,port)) except socket.gaierror, e: print("Address-related error connecting to server: %s" % e) sys.exit(1) except socket.error, e: print("Error connecting to socket: %s" % e) sys.exit(1) try: print(skt.send(msg)) print("SEND: %s" % msg) except socket.error, e: print("Error sending data: %s" % e) sys.exit(1) while 1: try: buf = skt.recv(1024) print("RECV: %s" % buf) except socket.error, e: print("Error receiving data: %s" % e) sys.exit(1) if not len(buf): break sys.stdout.write(buf)

    Read the article

  • Retrieve KEYWORDS from META tag in a HTML WebPage using JAVA.

    - by kooldave98
    Hello all, I want to retrieve all the content words from a HTML WebPage and all the keywords contained in the META TAG of the same HTML webpage using Java. For example, consider this html source code: <html> <head> <meta name = "keywords" content = "deception, intricacy, treachery"> </head> <body> My very short html document. <br> It has just 2 'lines'. </body> </html> The CONTENT WORDS here are: my, very, short, html, document, it, has, just, lines Note: The punctuation and the number '2' are ruled out. The KEYWORDS here are: deception, intricacy, treachery I have created a class for this purpose called WebDoc, this is as far as I have been able to get. import java.io.BufferedReader; import java.io.IOException; import java.io.InputStreamReader; import java.net.URL; import java.util.Set; import java.util.TreeSet; public class WebDoc { protected URL _url; protected Set<String> _contentWords; protected Set<String> _keyWords public WebDoc(URL paramURL) { _url = paramURL; } public Set<String> getContents() throws IOException { //URL url = new URL(url); Set<String> contentWords = new TreeSet<String>(); BufferedReader in = new BufferedReader(new InputStreamReader(_url.openStream())); String inputLine; while ((inputLine = in.readLine()) != null) { // Process each line. contentWords.add(RemoveTag(inputLine)); //System.out.println(RemoveTag(inputLine)); } in.close(); System.out.println(contentWords); _contentWords = contentWords; return contentWords; } public String RemoveTag(String html) { html = html.replaceAll("\\<.*?>",""); html = html.replaceAll("&",""); return html; } public Set<String> getKeywords() { //NO IDEA ! return null; } public URL getURL() { return _url; } @Override public String toString() { return null; } }

    Read the article

  • C# A simple Hangman game

    - by Radostin Angelov
    I'm trying to create a simple Hangman game and i have gotten so far, to make it read all words from a text file, but I don't know how to make the code work for every single word. I have another project, working with 3/4 words but with repeating nested if statements. I want to make it as shorter as possible. This is the code i have so far : using System; using System.Linq; class Program { static void Main() { string[] words = System.IO.File.ReadAllLines(@"C:\Users\ADMIN\Desktop\Letters\Letters.txt"); int LengthOfArray = words.Length; Random rnd = new Random(); int random = rnd.Next(1, 3); char[] letters = words[random].ToCharArray(); bool WordIsHidden = true; char hiddenChar = '_'; char GuessedLetter = hiddenChar; var retry = true; while (retry = true) { Console.WriteLine(letters); letters = GuessedLetter.ToString().ToCharArray(); for (int i = 1; i <= LengthOfArray; i++) { Console.Write("{0} ", GuessedLetter); } Console.WriteLine("Enter a letter!"); char letter = char.Parse(Console.ReadLine()); if (words[random].Contains<char>(letter)) { WordIsHidden = false; GuessedLetter = letter; Console.Write(letters); } else { if (WordIsHidden == true) { Console.Write("You guessed wrong!"); } } } } } Also I'm trying to make the game show each letter, the user has guessed on it's corresponding position, but now the letter is one line higher than the rest of the word and it's not in it's right position. Edited: Here is the result : cat ___Enter a letter! a __ aaaEnter a letter! t aa tttEnter a letter! IF anyone have a clue for where does this come from and how can I fix it, any help will be greatly appreciated.

    Read the article

  • How to write php code to input jsonstring and insert to sql server

    - by Romi
    i am trying to OUTPUT a Json String from the phone and to get it uploaded to the sql server i have. I Do not know how to get the output Json and write the php code... i tried many methods but couldnt find a solution. public void post(String string) { HttpClient httpclient = new DefaultHttpClient(); HttpPost httppost = new HttpPost( "http://www.hopscriber.com/xoxoxox/testphp.php"); try { List<NameValuePair> nameValuePairs = new ArrayList<NameValuePair>(); nameValuePairs.add(new BasicNameValuePair("myJson", string)); httppost.setEntity(new UrlEncodedFormEntity(nameValuePairs)); HttpResponse response = httpclient.execute(httppost); String str = inputStreamToString(response.getEntity().getContent()) .toString(); Log.w("SENCIDE", str); } catch (Exception e) { Toast.makeText(getBaseContext(), "notwork", Toast.LENGTH_LONG) .show(); } } private Object inputStreamToString(InputStream is) { // TODO Auto-generated method stub String line = ""; StringBuilder total = new StringBuilder(); // Wrap a BufferedReader around the InputStream BufferedReader rd = new BufferedReader(new InputStreamReader(is)); // Read response until the end try { while ((line = rd.readLine()) != null) { total.append(line); } } catch (IOException e) { e.printStackTrace(); } // Return full string return total; } it outputs a json string as [myJson=[{"name":"FriendTracker","user":"amjgp000000000000000","pack":"org.siislab.tutorial.friendtracker","perm":"org.siislab.tutorial.permission.READ_FRIENDS","level":"Normal"},{"name":"FriendTracker","user":"amjgp000000000000000","pack":"org.siislab.tutorial.friendtracker","perm":"org.siislab.tutorial.permission.WRITE_FRIENDS","level":"Normal"},{"name":"FriendTracker","user":"amjgp000000000000000","pack":"org.siislab.tutorial.friendtracker","perm":"org.siislab.tutorial.permission.FRIEND_SERVICE","level":"Normal"},{"name":"FriendTracker","user":"amjgp000000000000000","pack":"org.siislab.tutorial.friendtracker","perm":"org.siislab.tutorial.permission.FRIEND_NEAR","level":"Dangerous"},{"name":"FriendTracker","user":"amjgp000000000000000","pack":"org.siislab.tutorial.friendtracker","perm":"org.siislab.tutorial.permission.BROADCAST_FRIEND_NEAR","level":"Normal"},{"name":"FriendTracker","user":"amjgp000000000000000","pack":"org.siislab.tutorial.friendtracker","perm":"android.permission.RECEIVE_BOOT_COMPLETED","level":"Normal"},{"name":"FriendTracker","user":"amjgp000000000000000","pack":"org.siislab.tutorial.friendtracker","perm":"android.permission.READ_CONTACTS","level":"Dangerous"},{"name":"FriendTracker","user":"amjgp000000000000000","pack":"org.siislab.tutorial.friendtracker","perm":"android.permission.ACCESS_FINE_LOCATION","level":"Dangerous"},{"name":"FriendTracker","user":"amjgp000000000000000","pack":"org.siislab.tutorial.friendtracker","perm":"android.permission.WRITE_EXTERNAL_STORAGE","level":"Dangerous"},{"name":"FriendTracker","user":"amjgp000000000000000","pack":"org.siislab.tutorial.friendtracker","perm":"android.permission.READ_PHONE_STATE","level":"Dangerous"},{"name":"Tesing","user":"amjgp000000000000000","pack":"com.example.tesing","perm":"null","level":"null"},{"name":"Action Bar","user":"amjgp000000000000000","pack":"name.brucephillips.actionbarexample","perm":"null","level":"null"},.......

    Read the article

  • C# setting case constant expressions, do they have to follow a specific order?

    - by Umeed
    Say I'm making a simple program, and the user is in the menu. And the menu options are 1 3 5 7 (i wouldn't actually do that but lets just go with it). and I want to make my switch statement using System; using System.Collections.Generic; using System.Linq; using System.Text; namespace DecisionMaking2 { class Program { static void Main(string[] args) { Console.WriteLine("Please choose an option: "); string SelectedOpt = Console.ReadLine(); double Selection = Convert.ToDouble(SelectedOpt); double MenuOption = (Selection); switch (MenuOption) { case 1: Console.WriteLine("Selected option #1"); break; case 2: Console.WriteLine("Selected option #3"); break; case 3: Console.WriteLine("Selected option #5"); break; case 4: Console.WriteLine("Selected option #7"); break; default: Console.WriteLine("Please choose from the options List!"); break; } } } } would that work? or would I have to name each case constant expression the option number I am using? I went to the microsoft website and I didn't quite pick up on anything i was looking for. . Also while I have your attention, how would I make it so the user chooses from either option and because I don't know which option the user will select " double MenuOption = " could be anything, whatever the user inputs right? so would what I have even work? I am doing this all by hand, and don't get much lab time to work on this as I have tons of other courses to work on and then a boring job to go to, and my PC at home has a restarting issue lol. soo any and all help is greatly appreciated. p.s the computer I'm on right now posting this, doesn't have any compilers, coding programs, and it's not mine just to get that out of the way. Thanks again!

    Read the article

< Previous Page | 30 31 32 33 34 35 36 37 38 39 40  | Next Page >