Search Results

Search found 9730 results on 390 pages for 'restart programs'.

Page 340/390 | < Previous Page | 336 337 338 339 340 341 342 343 344 345 346 347  | Next Page >

  • Upgrade to Delphi 2010, or stick with Delphi 7 "forever"?

    - by tim11g
    I am an individual user of Delphi, starting back in the early Turbo Pascal days. I have quite a bit of code developed over the years, but I have never sold software commercially or used it for business. Historically, Borland supported the non-professional users with lower cost versions, but Embarcadero does not. As I consider upgrading to Delphi 2010, I am put off by the high price. Embarcadero is also trying to "encourage" upgrading by threatening to charge "new user" prices for upgrades after Dec 31st. I have several questions for the community to help me decide whether to upgrade. 1) I have read about difficulties updating existing code to support the unicode string types. I have no need for unicode strings, and I am happy with the string support in D7. Will I have to modify existing code and components just to re-compile under D2010? Or are there compiler options to allow backward compatibility if new string types are not required? 2) The main reason I'm considering upgrading is for IDE improvements, and to get access to new APIs added to Windows since 2002. Are there any Windows 7 APIs or capabilities that would be impossible to support from my programs compiled using using Delphi 7 (assuming appropriate JEDI API libraries, for example)? 3) Is there anything else about Delphi 2010 that is really compelling for someone who is primarily interested in Win32 apps, and not working with databases? I have read that D2010 is slow to load, and other versions between D7 and D2010 have had stability issues, and the help system was "broken". What is the biggest benefit to D2010?

    Read the article

  • Java: How do you really force a GC using JVMTI's ForceGargabeCollection?

    - by WizardOfOdds
    I'm not looking for the usual "you can only hint the GC in Java using System.gc()" answers, this is not at all what this question is about. My questions is not subjective and is based on a reality: GC can be forced in Java for a fact. A lot of programs that we use daily do it: IntelliJ IDEA, NetBeans, VisualVM. They all can force GC to happen. How is it done? I take it they're all using JVMTI and more specifically the ForceGarbabeCollection (notice the "Force") but how can I try it for myself? http://java.sun.com/javase/6/docs/platform/jvmti/jvmti.html#ForceGarbageCollection Also note that this question is not about "why" I'd want to do this: the "why" may be "curiosity" or "we're writing a program similar to VisualVM", etc. The question is really "how do you force a GC using JVMTI's ForceGarbageCollection"? Does the JVM needs to be launched with any special parameters? Is any JNI required? If so, what code exactly? Does it only work on Sun VMs? Any complete and compilable example would be most welcome.

    Read the article

  • VB.NET - Object reference not set to an instance of an object

    - by Daniel
    I need some help with my program. I get this error when I run my VB.NET program with a custom DayView control. ***** Exception Text ******* System.NullReferenceException: Object reference not set to an instance of an object. at SeaCow.Main.DayView1_ResolveAppointments(Object sender, ResolveAppointmentsEventArgs args) in C:\Users\Daniel\My Programs\Visual Basic\SeaCow\SeaCow\SeaCow\Main.vb:line 120 at Calendar.DayView.OnResolveAppointments(ResolveAppointmentsEventArgs args) at Calendar.DayView.OnPaint(PaintEventArgs e) at System.Windows.Forms.Control.PaintWithErrorHandling(PaintEventArgs e, Int16 layer) at System.Windows.Forms.Control.WmPaint(Message& m) at System.Windows.Forms.Control.WndProc(Message& m) at System.Windows.Forms.NativeWindow.Callback(IntPtr hWnd, Int32 msg, IntPtr wparam, IntPtr lparam) According to the error code, the 'for each' loop below is causing the NullReferenceException error. At default, the 'appointments' list is assigned to nothing and I can't find where the ResolveAppointments function is being called at. Private Sub DayView1_ResolveAppointments(ByVal sender As Object, ByVal args As Calendar.ResolveAppointmentsEventArgs) Handles DayView1.ResolveAppointments Dim m_Apps As New List(Of Calendar.Appointment) For Each m_App As Calendar.Appointment In appointments If (m_App.StartDate >= args.StartDate) AndAlso (m_App.StartDate <= args.EndDate) Then m_Apps.Add(m_App) End If Next args.Appointments = m_Apps End Sub Anyone have any suggestions?

    Read the article

  • Problem with copying local data onto HDFS on a Hadoop cluster using Amazon EC2/ S3.

    - by Deepak Konidena
    Hi, I have setup a Hadoop cluster containing 5 nodes on Amazon EC2. Now, when i login into the Master node and submit the following command bin/hadoop jar <program>.jar <arg1> <arg2> <path/to/input/file/on/S3> It throws the following errors (not at the same time.) The first error is thrown when i don't replace the slashes with '%2F' and the second is thrown when i replace them with '%2F': 1) Java.lang.IllegalArgumentException: Invalid hostname in URI S3://<ID>:<SECRETKEY>@<BUCKET>/<path-to-inputfile> 2) org.apache.hadoop.fs.S3.S3Exception: org.jets3t.service.S3ServiceException: S3 PUT failed for '/' XML Error Message: The request signature we calculated does not match the signature you provided. check your key and signing method. Note: 1)when i submitted jps to see what tasks were running on the Master, it just showed 1116 NameNode 1699 Jps 1180 JobTracker leaving DataNode and TaskTracker. 2)My Secret key contains two '/' (forward slashes). And i replace them with '%2F' in the S3 URI. PS: The program runs fine on EC2 when run on a single node. Its only when i launch a cluster, i run into issues related to copying data to/from S3 from/to HDFS. And, what does distcp do? Do i need to distribute the data even after i copy the data from S3 to HDFS?(I thought, HDFS took care of that internally) IF you could direct me to a link that explains running Map/reduce programs on a hadoop cluster using Amazon EC2/S3. That would be great. Regards, Deepak.

    Read the article

  • How to create an SaaS Application?

    - by Andrew
    I don't know how else to say it so I'm just going to explain my ideal scenario and hopefully you can explain to me how to implement it... I'm creating an application with the Zend Framework that will be hosted with DreamHost. The application will be hosted on its own domain (i.e. example-app.com). Basically, a user should be able to sign up, get their own domain sampleuser.example-app.com or example-app.com/sampleuser which points to, what looks like their own instance of the app, which is really a single instance serving up different content based on the url. Eventually, I want my users to be able to create their own domain (like foobar.com) that points to sampleuser.example-app.com, such that visitors to foobar.com don't notice that the site is really being served up from example-app.com. I don't know how to do most of that stuff. How does this process work? Do I need to do some funky stuff with Apache or can this be done with a third party host, like DreamHost? Update: Thanks for the advice! I've decided to bite the bullet and upgrade my hosting plan to utilize wildcard subdomains. It's cheaper than I was expecting! I also found out about domain reseller programs, like opensrs.com, that have their own API. I think using one of these APIs will be the solution to my domain registration issue.

    Read the article

  • Asymptotic complexity of a compiler

    - by Meinersbur
    What is the maximal acceptable asymptotic runtime of a general-purpose compiler? For clarification: The complexity of compilation process itself, not of the compiled program. Depending on the program size, for instance, the number of source code characters, statements, variables, procedures, basic blocks, intermediate language instructions, assembler instructions, or whatever. This is highly depending on your point of view, so this is a community wiki. See this from the view of someone who writes a compiler. Will the optimisation level -O4 ever be used for larger programs when one of its optimisations takes O(n^6)? Related questions: When is superoptimisation (exponential complexity or even incomputable) acceptable? What is acceptable for JITs? Does it have to be linear? What is the complexity of established compilers? GCC? VC? Intel? Java? C#? Turbo Pascal? LCC? LLVM? (Reference?) If you do not know what asymptotic complexity is: How long are you willing to wait until the compiler compiled your project? (scripting languages excluded)

    Read the article

  • How to launch multiple Internet Explorer windows/tabs from batch file?

    - by TheZenker
    I would like a batch file to launch two separate programs then have the command line window close. Actually, to clarify, I am launching Internet Explorer with two different URLs. So far I have something like this: start "~\iexplore.exe" "url1" start "~\iexplore.exe" "url2" What I get is one instance of Internet Explorer with only the second URL loaded. Seems the second is replacing the second. I seem to remember a syntax where I would load a new command line window and pass the command to execute on load, but can't find the reference. As a second part of the question: what is a good reference URL to keep for the times you need to write a quick batch file? Edit: I have marked an answer, because it does work. I now have two windows open, one for each URL. (thanks!) The funny thing is that without the /d approach using my original syntax I get different results based on whether I have a pre-existing Internet Explorer instance open. If I do I get two new tabs added for my two URLs (sweet!) If not I get only one final tab for the second URL I passed in.

    Read the article

  • call/cc in Lua - Possible?

    - by Pessimist
    The Wikipedia article on Continuation says: "In any language which supports closures, it is possible to write programs in continuation passing style and manually implement call/cc." Either that is true and I need to know how to do it or it is not true and that statement needs to be corrected. If this is true, please show me how to implement call/cc in Lua because I can't see how. I think I'd be able to implement call/cc manually if Lua had the coroutine.clone function as explained here. If closures are not enough to implement call/cc then what else is needed? The text below is optional reading. P.S.: Lua has one-shot continuations with its coroutine table. A coroutine.clone function would allow me to clone it to call it multiple times, thus effectively making call/cc possible (unless I misunderstand call/cc). However that cloning function doesn't exist in Lua. Someone on the Lua IRC channel suggested that I use the Pluto library (it implements serialization) to marshal a coroutine, copy it and then unmarshal it and use it again. While that would probably work, I am more interested in the theoretical implementation of call/cc and in finding what is the actual minimum set of features that a language needs to have in order to allow for its manual implementation.

    Read the article

  • What is the relationship between Turing Machine & Modern Computer ? [closed]

    - by smwikipedia
    I heard a lot that modern computers are based on Turing machine. I just cannot build a bridge between a conceptual Turing Machine and a modern computer. Could someone help me build this bridge? Below is my current understanding. I think the computer is a big general-purpose Turing machine. Each program we write is a small specific-purpose Turing machine. The classical Turing machine do its job based on the input and its current state inside and so do our programs. Let's take a running program (a process) as an example. We know that in the process's address space, there's areas for stack, heap, and code. A classical Turing machine doesn't have the ability to remember many things, so we borrow the concept of stack from the push-down automaton. The heap and stack areas contains the state of our specific-purpose Turing machine (our program). The code area represents the logic of this small Turing machine. And various I/O devices supply input to this Turing machine.

    Read the article

  • Create a VPN with Python

    - by user213060
    I want to make a device "tunnel box" that you plug an input ethernet line, and an output ethernet line, and all the traffic that goes through it gets modified in a special way. This is similar to how a firewall, IDS, VPN, or similar boxes are connected inline in a network. I think you can just assume that I am writing a custom VPN in Python for the purpose of this question: LAN computer <--\ LAN computer <---> [LAN switch] <--> ["tunnel box"] <--> [internet modem] <--> LAN computer <--/ My question is, what is a good way to program this "tunnel box" from python? My application needs to see TCP flows at the network layer, not as individual ethernet frames. Non-TCP/IP traffic such as ICPM and other types should just be passed through. Example Twisted-like Code for my "tunnel box" tunnel appliance: from my_code import special_data_conversion_function class StreamInterceptor(twisted.Protocol): def dataReceived(self,data): data=special_data_conversion_function(data) self.outbound_connection.send(data) My initial guesses: TUN/TAP with twisted.pair.tuntap.py - Problem: This seems to only work at the ethernet frame level, not like my example? Socks proxy - Problem: Not transparent as in my diagram. Programs have to be specifically setup for it. Thanks!

    Read the article

  • What programming languages do the top tier Universities teach?

    - by Simucal
    I'm constantly being inundated with articles and people talking about how most of today's Universities are nothing more than Java vocational schools churning out mediocre programmer after mediocre programmer. Our very own Joel Spolsky has his famous article, "The Perils of Java Schools." Similarly, Alan Kay, a famous Computer Scientist (and SO member) has said this in the past: "I fear — as far as I can tell — that most undergraduate degrees in computer science these days are basically Java vocational training." - Alan Kay (link) If the languages being taught by the schools are considered such a contributing factor to the quality of the school's program then I'm curious what languages do the "top-tier" computer science schools teach (MIT, Carnegie Mellon, Stanford, etc)? If the average school is performing so poorly due in large part the languages (or lack of) that they teach then what languages do the supposed "good" cs programs teach that differentiate them? If you can, provide the name of the school you attended, followed by a list of the languages they use throughout their coursework. Edit: Shog-9 asks why I don't get this information directly from the schools websites themselves. I would, but many schools websites don't discuss the languages they use in their class descriptions. Quite a few will say, "using high-level languages we will...", without elaborating on which languages they use. So, we should be able to get a pretty accurate list of languages taught at various well known institutions from the various SO members who have attended at them.

    Read the article

  • Why do people have to use multiple versions of jQuery in the same page?

    - by reprogrammer
    I have noticed that sometimes people have to use multiple versions of jQuery in the same page (See question 1 and question 2). I assume people have to carry old versions of jQuery because some pieces of their code is based on an older version of jQuery. Obviously, this approach causes inefficiency. The ideal solution is to refactor the old code to use the newer jQuery API. I wonder if there are tools that automate the process of upgrading a piece of code to use a newer version of jQuery. I've never written programs in in either Javascript or jQuery. So, I'd like to hear from programmers experienced in these language about their opinion on this issue. In particular, I'd like to know the following. How much of problem it is to have to load multiple versions of jQuery? Have you ever had to load multiple versions of any other library in the same page? Do you know of any refactoring tools that helps you migrate your code to use the updated API? Do you think such a refactoring tool is useful? Are you willing to use it?

    Read the article

  • Adding a guideline to the editor in Visual Studio

    - by xsl
    Introduction I've always been searching for a way to make Visual Studio draw a line after a certain amount of characters: Below is a guide to enable these so called guidelines for various versions of Visual Studio. Visual Studio 2010 Install Paul Harrington's Editor Guidelines extension. Open the registry at HKEY_CURRENT_USER\Software\Microsoft\VisualStudio\10.0\Text Editor and add a new string called Guides with the value RGB(100,100,100), 80. The first part specifies the color, while the other one (80) is the column the line will be displayed. Or install the Guidelines UI extension, which will add entries to the editor's context menu for adding/removing the entries without needing to edit the registry directly. The current disadvantage of this method is that you can't specify the column directly. Visual Studio 2008 and Other Versions If you are using Visual Studio 2008 open the registry at HKEY_CURRENT_USER\Software\Microsoft\VisualStudio\9.0\Text Editor and add a new string called Guides with the value RGB(100,100,100), 80. The first part specifies the color, while the other one (80) is the column the line will be displayed. The vertical line will appear, when you restart Visual Studio. This trick also works for various other version of Visual Studio, as long as you use the correct path: 2003: HKEY_CURRENT_USER\Software\Microsoft\VisualStudio\7.1\Text Editor 2005: HKEY_CURRENT_USER\Software\Microsoft\VisualStudio\8.0\Text Editor 2008: HKEY_CURRENT_USER\Software\Microsoft\VisualStudio\9.0\Text Editor 2008 Express: HKEY_CURRENT_USER\Software\Microsoft\VCExpress\9.0\Text Editor This also works in SQL Server 2005 and probably other versions.

    Read the article

  • simple Java "service provider frameworks"?

    - by Jason S
    I refer to "service provider framework" as discussed in Chapter 2 of Effective Java, which seems like exactly the right way to handle a problem I am having, where I need to instantiate one of several classes at runtime, based on a String to select which service, and an Configuration object (essentially an XML snippet): But how do I get the individual service providers (e.g. a bunch of default providers + some custom providers) to register themselves? interface FooAlgorithm { /* methods particular to this class of algorithms */ } interface FooAlgorithmProvider { public FooAlgorithm getAlgorithm(Configuration c); } class FooAlgorithmRegistry { private FooAlgorithmRegistry() {} static private final Map<String, FooAlgorithmProvider> directory = new HashMap<String, FooAlgorithmProvider>(); static public FooAlgorithmProvider getProvider(String name) { return directory.get(serviceName); } static public boolean registerProvider(String name, FooAlgorithmProvider provider) { if (directory.containsKey(name)) return false; directory.put(name, provider); return true; } } e.g. if I write custom classes MyFooAlgorithm and MyFooAlgorithmProvider to implement FooAlgorithm, and I distribute them in a jar, is there any way to get registerProvider to be called automatically, or will my client programs that use the algorithm have to explicitly call FooAlgorithmRegistry.registerProvider() for each class they want to use?

    Read the article

  • Creative ways to punish (or just curb) laziness in coworkers

    - by FerretallicA
    Like the subject suggests, what are some creative ways to curb laziness in co-workers? By laziness I'm talking about things like using variable names like "inttheemplrcd" instead of "intEmployerCode" or not keeping their projects synced with SVN, not just people who use the last of the sugar in the coffee room and don't refill the jar. So far the two most effective things I've done both involve the core library my company uses. Since most of our programs are in VB.net the lack of case sensitivity is abused a lot. I've got certain features of the library using Reflection to access data in the client apps, which has a negligible performance hit and introduces case sensitivity in a lot places where it is used. In instances where we have an agreed standard which is compromised by blatant laziness I take it a step further, like the DatabaseController class which will blatantly reject any DataTable passed to it which isn't named dtSomething (ie- must begin with dt and third letter must be capitalised). It's frustrating to have to resort to things like this but it has also gradually helped drill more attention to detail into their heads. Another is adding some code to the library's initialisation function to display a big and potentially embarrassing (only if seen by a client) message advising that the program is running in debug mode. We have had many instances where projects are sent to clients built in debug mode which has a lot of implications for us (especially with regard to error recovery) and doing that has made sure they always build to release before distributing. Any other creative (ie- not StyleCop etc) approaches like this?

    Read the article

  • How do I set the default selection for NSTreeController at startup?

    - by John Gallagher
    The Background I've built a source list (similar to iTunes et al.) in my Cocoa app. I've got an NSOutlineView, with Value column bound to arrangedObjects.name key path of an NSTreeController. The NSTreeController accesses JGSourceListNode entities in a Core Data store. I have three subclasses of JGSourceListNode - JGProjectNode, JGGroupNode and JGFolderNode. I have selectedIndexPaths on NSTreeController bound to an NSArray called selectedIndexPaths in my App Delegate. On startup, I search for group nodes and if they're not found in the core data store I create them: if ([allGroupNodes count] == 0) { JGGroupNode *rootTrainingNode = [JGGroupNode insertInManagedObjectContext:context]; [rootTrainingNode setNodeName:@"TRAIN"]; JGProjectNode *childUntrainedNode = [JGProjectNode insertInManagedObjectContext:context]; [childUntrainedNode setParent:rootTrainingNode]; [childUntrainedNode setNodeName:@"Untrained"]; JGGroupNode *rootBrowsingNode = [JGGroupNode insertInManagedObjectContext:context]; [rootBrowsingNode setNodeName:@"BROWSE"]; JGFolderNode *childFolder = [JGFolderNode insertInManagedObjectContext:context]; [childFolder setNodeName:@"Folder"]; [childFolder setParent:rootBrowsingNode]; [context save:nil]; } What I Want When I start the app, I want both top level groups to be expanded and "Untrained" to be highlighted as shown: The Problem I put the following code in the applicationDidFinishLaunching: method of the app delegate: [sourceListOutlineView expandItem:[sourceListOutlineView itemAtRow:0]]; [sourceListOutlineView expandItem:[sourceListOutlineView itemAtRow:2]]; NSIndexPath *rootIndexPath = [NSIndexPath indexPathWithIndex:0]; NSIndexPath *childIndexPath = [rootIndexPath indexPathByAddingIndex:0]; [self setSelectedIndexPaths:[NSArray arrayWithObject:childIndexPath]]; but the outline view seems to not have been prepared yet, so this code does nothing. Ideally, eventually I want to save the last selection the user had made and restore this on a restart. The Question I'm sure it's possible using some crazy KVO to observe when the NSTreeController or NSOutlineView gets populated then expand the items and change the selection, but that feels clumsy and too much like a work around. How would I do this elegantly?

    Read the article

  • Download, pause and resume an download using Indy components

    - by Salvador
    Actually i'm using the TIdHTTP component for download a file from internet. i'm wondering if is possible pause and resume the download using this component o maybe another indy component. this is my current code, this works ok for download a file (without resume), but . now i want pause the download close my app ,and when my app restart then resume the download from the last position saved. var Http: TIdHTTP; MS : TMemoryStream; begin Result:= True; Http := TIdHTTP.Create(nil); MS := TMemoryStream.Create; try try Http.OnWork:= HttpWork;//this event give me the actual progress of the download process Http.Head(Url); FSize := Http.Response.ContentLength; AddLog('Downloading File '+GetURLFilename(Url)+' - '+FormatFloat('#,',FSize)+' Bytes'); Http.Get(Url, MS); MS.SaveToFile(LocalFile); except on E : Exception do Begin Result:=False; AddLog(E.Message); end; end; finally Http.Free; MS.Free; end; end;

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Force creation of query execution plan

    - by Marc
    I have the following situation: .net 3.5 WinForm client app accessing SQL Server 2008 Some queries returning relatively big amount of data are used quite often by a form Users are using local SQL Express and restarting their machines at least daily Other users are working remotely over slow network connections The problem is that after a restart, the first time users open this form the queries are extremely slow and take more or less 15s on a fast machine to execute. Afterwards the same queries take only 3s. Of course this comes from the fact that no data is cached and must be loaded from disk first. My question: Would it be possible to force the loading of the required data in advance into SQL Server cache? Note My first idea was to execute the queries in a background worker when the application starts, so that when the user starts the form the queries will already be cached and execute fast directly. I however don't want to load the result of the queries over to the client as some users are working remotely or have otherwise slow networks. So I thought just executing the queries from a stored procedure and putting the results into temporary tables so that nothing would be returned. Turned out that some of the result sets are using dynamic columns so I couldn't create the corresponding temp tables and thus this isn't a solution. Do you happen to have any other idea?

    Read the article

  • How can I build something like Amazon S3 in Perl?

    - by Joel G
    I am looking to code a file storage application in perl similar to amazon s3. I already have a amazon s3 clone that I found online called parkplace but its in ruby and is old also isn't built for high loads. I am not really sure what modules and programs I should use so id like some help picking them out. My requirements are listed below (yes I know there are lots but I could start simple then add more once I get it going): Easy API implementation for client side apps. (maybe REST (?) Centralized database server for the USERDB (maybe PostgreSQL (?). Logging of all connections, bandwidth used, well pretty much everything to a centralized server (maybe PostgreSQL again (?). Easy server side configuration (config file(s) stored on the servers). Web based control panel for admin(s) and user(s) to show logs. (could work just running queries from the databases) Fast High Uptime Low memory usage Some sort of load distribution/load balancer (maybe a dns based or pound or perlbal or something else (?). Maybe a cache of some sort (memcached or parlbal or something else (?). Thanks in advance

    Read the article

  • Socket errors of 10048 on the client? Possible causes?

    - by Earlz
    Hello, I'm writing a custom TCP server and client and on doing a ton of requests (60,000 to be exact) I begin to get this socket error of 10048, which should mean "the address is already in use." The error keeps happening unless I pause the process for like 2 or 3 minutes and then begin it again, and then it begins to bring up the same error a short while after restarting it. If I pause the client process and restart the server process, I still get the same error on the client. So it is a complete client side problem. This does not make sense though, this error only usually occurs when binding and this error happens on the client and not the server. What could be the possible reasons for it? A small excerpt of my initialization: TcpClient client = new TcpClient(); client.Connect("XXXXX -- some ip", 25000); client.NoDelay = true; NetworkStream clientStream = client.GetStream(); Also, everything else seems to be working fine(including the amount of time it takes to send back and forth) and this works perfectly when using 127.0.0.1 but when putting it on another LAN computer I begin to get the 10048 error. Is there something wrong with how I initialize it? What else could cause this error on the client side?

    Read the article

  • Cocoa Core data: cannot save Created Items in NSTableview

    - by Paul Rostorp
    Hello, I'm am a beginner in mac os x development and am trying to get started with all this. Here is my problem : I've create a non-document based cocoa app using core data as storage. I've added an entity and attributes to the xdatamodel. In IB i've created an NSArrayController and linked it properly. I've created an nstableview binded to the nsarraycontroller. Next I added a button linked to nsarraycontroller with the " add: " method. When I try it out, I can add and edit the items in the table. Here comes the problem: Core data is supposed to save everything automatically, but to make sure i linked the "save" button in the menu to the appdelegate and to the " file's owner" , first responder, application... everything possible ( with both " save :" and " saveaction:" methods ). And still it doesn't save when clicking save: when I restart the cell created ( and renamed ) are gone. And also, I didn't even edit the source code yet; core data for such simple tasks is supposed to only need Interface builder. Please help me for this, I haven't found any threads resolving this problem. Thank you in advance.

    Read the article

  • WSO2 ESB on Carbon 4.2 - Did not find the desired phase 'Transport' while deploying handler 'POXSecurityHandler'

    - by user3385500
    I'm new to WSO2 ESB and would like to try it out for some external integrations. I've installed the WSO2 Carbon 4.2 server and installed the ESB feature 4.8.1. After a restart, I'm getting some errors as below. Any tips or suggestions would be gratefully accepted. Thanks. [2014-03-06 10:01:08,521] INFO {org.wso2.carbon.mediation.initializer.ServiceBusInitializer} - Initializing Apache Synapse... [2014-03-06 10:01:08,525] FATAL {org.wso2.carbon.mediation.initializer.ServiceBusInitializer} - Couldn't initialize the ESB... org.apache.synapse.SynapseException: The synapse.xml location ././ ./repository/deployment/server/synapse-configs /default doesn't exist at org.apache.synapse.SynapseControllerFactory.handleFatal(SynapseControllerFactory.java:121) at org.apache.synapse.SynapseControllerFactory.validatePath(SynapseControllerFactory.java:113) at org.apache.synapse.SynapseControllerFactory.validate(SynapseControllerFactory.java:88) at org.apache.synapse.SynapseControllerFactory.createSynapseController(SynapseControllerFactory.java:44) at org.apache.synapse.ServerManager.init(ServerManager.java:102) at org.wso2.carbon.mediation.initializer.ServiceBusInitializer.initESB(ServiceBusInitializer.java:423) at org.wso2.carbon.mediation.initializer.ServiceBusInitializer.activate(ServiceBusInitializer.java:182) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) ... ... ... [2014-03-06 10:01:08,531] INFO {org.wso2.carbon.rule.kernel.internal.ds.RuleEngineConfigDS} - Successfully registered the Rule Config service [2014-03-06 10:01:08,553] ERROR {org.wso2.carbon.security.internal.SecurityMgtServiceComponent} - Failed to activate SecurityMgtServiceComponent org.apache.axis2.phaseresolver.PhaseException: Did not find the desired phase 'Transport' while deploying handler 'POXSecurityHandler'. at org.apache.axis2.phaseresolver.PhaseHolder.addHandler(PhaseHolder.java:75) at org.apache.axis2.phaseresolver.PhaseResolver.engageModuleToFlow(PhaseResolver.java:68) at org.apache.axis2.phaseresolver.PhaseResolver.engageModuleToOperation(PhaseResolver.java:104) at org.apache.axis2.phaseresolver.PhaseResolver.engageModuleToOperation(PhaseResolver.java:110) at org.apache.axis2.description.AxisOperation.onEngage(AxisOperation.java:152) at org.apache.axis2.description.AxisDescription.engageModule(AxisDescription.java:478) at org.apache.axis2.description.AxisService.onEngage(AxisService.java:827) at org.apache.axis2.description.AxisDescription.engageModule(AxisDescription.java:478) at org.apache.axis2.description.AxisServiceGroup.onEngage(AxisServiceGroup.java:134)

    Read the article

  • Executing bat file and returning the prompt

    - by Lieven Cardoen
    I have a problem with cruisecontrol where an ant scripts executes a bat file that doesn't give me the prompt back. As a result, the project in cruisecontrol keeps on bulding forever until I restart cruisecontrol. How can I resolve this? It's a startup.bat from wowza (Streaming Server) that I'm executing: @echo off call setenv.bat if not %WMSENVOK% == "true" goto end set _WINDOWNAME="Wowza Media Server 2" set _EXESERVER= if "%1"=="newwindow" ( set _EXESERVER=start %_WINDOWNAME% shift ) set CLASSPATH="%WMSAPP_HOME%\bin\wms-bootstrap.jar" rem cacls jmxremote.password /P username:R rem cacls jmxremote.access /P username:R rem NOTE: Here you can configure the JVM's built in JMX interface. rem See the "Server Management Console and Monitoring" chapter rem of the "User's Guide" for more information on how to configure the rem remote JMX interface in the [install-dir]/conf/Server.xml file. set JMXOPTIONS=-Dcom.sun.management.jmxremote=true rem set JMXOPTIONS=%JMXOPTIONS% -Djava.rmi.server.hostname=192.168.1.7 rem set JMXOPTIONS=%JMXOPTIONS% -Dcom.sun.management.jmxremote.port=1099 rem set JMXOPTIONS=%JMXOPTIONS% -Dcom.sun.management.jmxremote.authenticate=false rem set JMXOPTIONS=%JMXOPTIONS% -Dcom.sun.management.jmxremote.ssl=false rem set JMXOPTIONS=%JMXOPTIONS% -Dcom.sun.management.jmxremote.password.file= "%WMSCONFIG_HOME%/conf/jmxremote.password" rem set JMXOPTIONS=%JMXOPTIONS% -Dcom.sun.management.jmxremote.access.file= "%WMSCONFIG_HOME%/conf/jmxremote.access" rem log interceptor com.wowza.wms.logging.LogNotify - see Javadocs for ILogNotify %_EXESERVER% "%_EXECJAVA%" %JAVA_OPTS% %JMXOPTIONS% -Dcom.wowza.wms.AppHome="%WMSAPP_HOME%" -Dcom.wowza.wms.ConfigURL="%WMSCONFIG_URL%" -Dcom.wowza.wms.ConfigHome="%WMSCONFIG_HOME%" -cp %CLASSPATH% com.wowza.wms.bootstrap.Bootstrap start :end

    Read the article

  • What file format can represent an uncompressed raster image at 48 or 64 bits per pixel?

    - by finnw
    I am creating screenshots under Windows and using the LockBits function from GDI+ to extract the pixel data, which will then be written to a file. To maximise performance I am also: Using the same PixelFormat as the source bitmap, to avoid format conversion Using the ImageLockModeUserInputBuf flag to extract the pixel data into a pre-allocated buffer This pre-allocated buffer (pointed to by BitmapData::Scan0) is part of a memory-mapped file (to avoid copying the pixel data again.) I will also be writing the code that reads the file, so I can use (or invent) any format I wish. However I would prefer to use a well-known format that existing programs (ideally web browsers) are able to read, because that means I can visually confirm that the images are correct before writing the code for the other program (that reads the image.) I have implemented this successfully for the PixelFormat32bppRGB format, which matches the format of a 32bpp BMP file, so if I extract the pixel data directly into the memory-mapped BMP file and prefix it with a BMP header I get a valid BMP image file that can be opened in Paint and most browsers. Unfortunately one of the machines I am testing on returns pixels in PixelFormat64bppPARGB format (presumably this is influenced by the video adapter driver) and there is no corresponding BMP pixel format for this. Converting to a 16, 24 or 32bpp BMP format slows the program down considerably (as well as being lossy) so I am looking for a file format that can use this pixel format without conversion, so I can extract directly into the memory-mapped file as I have done with the 32bpp format. What raster image file formats support 48bpp and/or 64bpp?

    Read the article

< Previous Page | 336 337 338 339 340 341 342 343 344 345 346 347  | Next Page >