Search Results

Search found 9730 results on 390 pages for 'restart programs'.

Page 340/390 | < Previous Page | 336 337 338 339 340 341 342 343 344 345 346 347  | Next Page >

  • Boost.MultiIndex: Are there way to share object between two processes?

    - by Arman
    Hello, I have a Boost.MultiIndex big array about 10Gb. In order to reduce the reading I thought there should be a way to keep the data in the memory and another client programs will be able to read and analyse it. What is the proper way to organize it? The array looks like: struct particleID { int ID;// real ID for particle from Gadget2 file "ID" block unsigned int IDf;// postition in the file particleID(int id,const unsigned int idf):ID(id),IDf(idf){} bool operator<(const particleID& p)const { return ID<p.ID;} unsigned int getByGID()const {return (ID&0x0FFF);}; }; struct ID{}; struct IDf{}; struct IDg{}; typedef multi_index_container< particleID, indexed_by< ordered_unique< tag<IDf>, BOOST_MULTI_INDEX_MEMBER(particleID,unsigned int,IDf)>, ordered_non_unique< tag<ID>,BOOST_MULTI_INDEX_MEMBER(particleID,int,ID)>, ordered_non_unique< tag<IDg>,BOOST_MULTI_INDEX_CONST_MEM_FUN(particleID,unsigned int,getByGID)> > > particlesID_set; Any ideas are welcome. kind regards Arman.

    Read the article

  • Hadoop streaming with Python and python subprocess

    - by Ganesh
    I have established a basic hadoop master slave cluster setup and able to run mapreduce programs (including python) on the cluster. Now I am trying to run a python code which accesses a C binary and so I am using the subprocess module. I am able to use the hadoop streaming for a normal python code but when I include the subprocess module to access a binary, the job is getting failed. As you can see in the below logs, the hello executable is recognised to be used for the packaging, but still not able to run the code. . . packageJobJar: [/tmp/hello/hello, /app/hadoop/tmp/hadoop-unjar5030080067721998885/] [] /tmp/streamjob7446402517274720868.jar tmpDir=null JarBuilder.addNamedStream hello . . 12/03/07 22:31:32 INFO mapred.FileInputFormat: Total input paths to process : 1 12/03/07 22:31:32 INFO streaming.StreamJob: getLocalDirs(): [/app/hadoop/tmp/mapred/local] 12/03/07 22:31:32 INFO streaming.StreamJob: Running job: job_201203062329_0057 12/03/07 22:31:32 INFO streaming.StreamJob: To kill this job, run: 12/03/07 22:31:32 INFO streaming.StreamJob: /usr/local/hadoop/bin/../bin/hadoop job -Dmapred.job.tracker=master:54311 -kill job_201203062329_0057 12/03/07 22:31:32 INFO streaming.StreamJob: Tracking URL: http://master:50030/jobdetails.jsp?jobid=job_201203062329_0057 12/03/07 22:31:33 INFO streaming.StreamJob: map 0% reduce 0% 12/03/07 22:32:05 INFO streaming.StreamJob: map 100% reduce 100% 12/03/07 22:32:05 INFO streaming.StreamJob: To kill this job, run: 12/03/07 22:32:05 INFO streaming.StreamJob: /usr/local/hadoop/bin/../bin/hadoop job -Dmapred.job.tracker=master:54311 -kill job_201203062329_0057 12/03/07 22:32:05 INFO streaming.StreamJob: Tracking URL: http://master:50030/jobdetails.jsp?jobid=job_201203062329_0057 12/03/07 22:32:05 ERROR streaming.StreamJob: Job not Successful! 12/03/07 22:32:05 INFO streaming.StreamJob: killJob... Streaming Job Failed! Command I am trying is : hadoop jar contrib/streaming/hadoop-*streaming*.jar -mapper /home/hduser/MARS.py -reducer /home/hduser/MARS_red.py -input /user/hduser/mars_inputt -output /user/hduser/mars-output -file /tmp/hello/hello -verbose where hello is the C executable. It is a simple helloworld program which I am using to check the basic functioning. My Python code is : #!/usr/bin/env python import subprocess subprocess.call(["./hello"]) Any help with how to get the executable run with Python in hadoop streaming or help with debugging this will get me forward in this. Thanks, Ganesh

    Read the article

  • What are the best open-source software non-profits for making financial contributions and/or facilitating useful work?

    - by Jason S
    I'm not a great programmer myself (my main job is more electrical engineering) and have never really helped out with any open source projects, but I've benefited greatly from free and/or open-source software (MySQL, OpenOffice, Firefox, Apache, PHP, Java, etc.) and at some point would like to make some modest financial contributions to help keep this stuff going. I'm wondering, what are the best non-profits to make financial contributions? I'm aware of: Open Source Initiative (founded 10 years ago by several prominent figures including programmer and "The Cathedral and the Bazaar" author Eric S. Raymond) Free Software Foundation Mozilla Foundation Apache Foundation Anyone have a particular favorite? Ideally I'd like to give money to a non-profit that would foster some of the smaller but promising open-source and/or free software projects. The big projects like Firefox and Apache are already well-established. There are a few small individual shareware programs I've already paid for directly. But it's those middle-ground projects that I would really like my contributions to support. (one that comes to mind is a good GUI for Subversion or Mercurial.) It's one thing for a single person to donate a little $$ to a small project. It's another for a foundation or something to give larger grants to projects that give a good bang for the buck. Conservation organizations like The Nature Conservancy, or the Trust for Public Lands, have really honed this approach, but I'm not really sure if there's an equivalent model in software-land.

    Read the article

  • Create a VPN with Python

    - by user213060
    I want to make a device "tunnel box" that you plug an input ethernet line, and an output ethernet line, and all the traffic that goes through it gets modified in a special way. This is similar to how a firewall, IDS, VPN, or similar boxes are connected inline in a network. I think you can just assume that I am writing a custom VPN in Python for the purpose of this question: LAN computer <--\ LAN computer <---> [LAN switch] <--> ["tunnel box"] <--> [internet modem] <--> LAN computer <--/ My question is, what is a good way to program this "tunnel box" from python? My application needs to see TCP flows at the network layer, not as individual ethernet frames. Non-TCP/IP traffic such as ICPM and other types should just be passed through. Example Twisted-like Code for my "tunnel box" tunnel appliance: from my_code import special_data_conversion_function class StreamInterceptor(twisted.Protocol): def dataReceived(self,data): data=special_data_conversion_function(data) self.outbound_connection.send(data) My initial guesses: TUN/TAP with twisted.pair.tuntap.py - Problem: This seems to only work at the ethernet frame level, not like my example? Socks proxy - Problem: Not transparent as in my diagram. Programs have to be specifically setup for it. Thanks!

    Read the article

  • What is the relationship between Turing Machine & Modern Computer ? [closed]

    - by smwikipedia
    I heard a lot that modern computers are based on Turing machine. I just cannot build a bridge between a conceptual Turing Machine and a modern computer. Could someone help me build this bridge? Below is my current understanding. I think the computer is a big general-purpose Turing machine. Each program we write is a small specific-purpose Turing machine. The classical Turing machine do its job based on the input and its current state inside and so do our programs. Let's take a running program (a process) as an example. We know that in the process's address space, there's areas for stack, heap, and code. A classical Turing machine doesn't have the ability to remember many things, so we borrow the concept of stack from the push-down automaton. The heap and stack areas contains the state of our specific-purpose Turing machine (our program). The code area represents the logic of this small Turing machine. And various I/O devices supply input to this Turing machine.

    Read the article

  • VB.NET - Object reference not set to an instance of an object

    - by Daniel
    I need some help with my program. I get this error when I run my VB.NET program with a custom DayView control. ***** Exception Text ******* System.NullReferenceException: Object reference not set to an instance of an object. at SeaCow.Main.DayView1_ResolveAppointments(Object sender, ResolveAppointmentsEventArgs args) in C:\Users\Daniel\My Programs\Visual Basic\SeaCow\SeaCow\SeaCow\Main.vb:line 120 at Calendar.DayView.OnResolveAppointments(ResolveAppointmentsEventArgs args) at Calendar.DayView.OnPaint(PaintEventArgs e) at System.Windows.Forms.Control.PaintWithErrorHandling(PaintEventArgs e, Int16 layer) at System.Windows.Forms.Control.WmPaint(Message& m) at System.Windows.Forms.Control.WndProc(Message& m) at System.Windows.Forms.NativeWindow.Callback(IntPtr hWnd, Int32 msg, IntPtr wparam, IntPtr lparam) According to the error code, the 'for each' loop below is causing the NullReferenceException error. At default, the 'appointments' list is assigned to nothing and I can't find where the ResolveAppointments function is being called at. Private Sub DayView1_ResolveAppointments(ByVal sender As Object, ByVal args As Calendar.ResolveAppointmentsEventArgs) Handles DayView1.ResolveAppointments Dim m_Apps As New List(Of Calendar.Appointment) For Each m_App As Calendar.Appointment In appointments If (m_App.StartDate >= args.StartDate) AndAlso (m_App.StartDate <= args.EndDate) Then m_Apps.Add(m_App) End If Next args.Appointments = m_Apps End Sub Anyone have any suggestions?

    Read the article

  • Creative ways to punish (or just curb) laziness in coworkers

    - by FerretallicA
    Like the subject suggests, what are some creative ways to curb laziness in co-workers? By laziness I'm talking about things like using variable names like "inttheemplrcd" instead of "intEmployerCode" or not keeping their projects synced with SVN, not just people who use the last of the sugar in the coffee room and don't refill the jar. So far the two most effective things I've done both involve the core library my company uses. Since most of our programs are in VB.net the lack of case sensitivity is abused a lot. I've got certain features of the library using Reflection to access data in the client apps, which has a negligible performance hit and introduces case sensitivity in a lot places where it is used. In instances where we have an agreed standard which is compromised by blatant laziness I take it a step further, like the DatabaseController class which will blatantly reject any DataTable passed to it which isn't named dtSomething (ie- must begin with dt and third letter must be capitalised). It's frustrating to have to resort to things like this but it has also gradually helped drill more attention to detail into their heads. Another is adding some code to the library's initialisation function to display a big and potentially embarrassing (only if seen by a client) message advising that the program is running in debug mode. We have had many instances where projects are sent to clients built in debug mode which has a lot of implications for us (especially with regard to error recovery) and doing that has made sure they always build to release before distributing. Any other creative (ie- not StyleCop etc) approaches like this?

    Read the article

  • How to launch multiple Internet Explorer windows/tabs from batch file?

    - by TheZenker
    I would like a batch file to launch two separate programs then have the command line window close. Actually, to clarify, I am launching Internet Explorer with two different URLs. So far I have something like this: start "~\iexplore.exe" "url1" start "~\iexplore.exe" "url2" What I get is one instance of Internet Explorer with only the second URL loaded. Seems the second is replacing the second. I seem to remember a syntax where I would load a new command line window and pass the command to execute on load, but can't find the reference. As a second part of the question: what is a good reference URL to keep for the times you need to write a quick batch file? Edit: I have marked an answer, because it does work. I now have two windows open, one for each URL. (thanks!) The funny thing is that without the /d approach using my original syntax I get different results based on whether I have a pre-existing Internet Explorer instance open. If I do I get two new tabs added for my two URLs (sweet!) If not I get only one final tab for the second URL I passed in.

    Read the article

  • Problem with copying local data onto HDFS on a Hadoop cluster using Amazon EC2/ S3.

    - by Deepak Konidena
    Hi, I have setup a Hadoop cluster containing 5 nodes on Amazon EC2. Now, when i login into the Master node and submit the following command bin/hadoop jar <program>.jar <arg1> <arg2> <path/to/input/file/on/S3> It throws the following errors (not at the same time.) The first error is thrown when i don't replace the slashes with '%2F' and the second is thrown when i replace them with '%2F': 1) Java.lang.IllegalArgumentException: Invalid hostname in URI S3://<ID>:<SECRETKEY>@<BUCKET>/<path-to-inputfile> 2) org.apache.hadoop.fs.S3.S3Exception: org.jets3t.service.S3ServiceException: S3 PUT failed for '/' XML Error Message: The request signature we calculated does not match the signature you provided. check your key and signing method. Note: 1)when i submitted jps to see what tasks were running on the Master, it just showed 1116 NameNode 1699 Jps 1180 JobTracker leaving DataNode and TaskTracker. 2)My Secret key contains two '/' (forward slashes). And i replace them with '%2F' in the S3 URI. PS: The program runs fine on EC2 when run on a single node. Its only when i launch a cluster, i run into issues related to copying data to/from S3 from/to HDFS. And, what does distcp do? Do i need to distribute the data even after i copy the data from S3 to HDFS?(I thought, HDFS took care of that internally) IF you could direct me to a link that explains running Map/reduce programs on a hadoop cluster using Amazon EC2/S3. That would be great. Regards, Deepak.

    Read the article

  • What programming languages do the top tier Universities teach?

    - by Simucal
    I'm constantly being inundated with articles and people talking about how most of today's Universities are nothing more than Java vocational schools churning out mediocre programmer after mediocre programmer. Our very own Joel Spolsky has his famous article, "The Perils of Java Schools." Similarly, Alan Kay, a famous Computer Scientist (and SO member) has said this in the past: "I fear — as far as I can tell — that most undergraduate degrees in computer science these days are basically Java vocational training." - Alan Kay (link) If the languages being taught by the schools are considered such a contributing factor to the quality of the school's program then I'm curious what languages do the "top-tier" computer science schools teach (MIT, Carnegie Mellon, Stanford, etc)? If the average school is performing so poorly due in large part the languages (or lack of) that they teach then what languages do the supposed "good" cs programs teach that differentiate them? If you can, provide the name of the school you attended, followed by a list of the languages they use throughout their coursework. Edit: Shog-9 asks why I don't get this information directly from the schools websites themselves. I would, but many schools websites don't discuss the languages they use in their class descriptions. Quite a few will say, "using high-level languages we will...", without elaborating on which languages they use. So, we should be able to get a pretty accurate list of languages taught at various well known institutions from the various SO members who have attended at them.

    Read the article

  • Force creation of query execution plan

    - by Marc
    I have the following situation: .net 3.5 WinForm client app accessing SQL Server 2008 Some queries returning relatively big amount of data are used quite often by a form Users are using local SQL Express and restarting their machines at least daily Other users are working remotely over slow network connections The problem is that after a restart, the first time users open this form the queries are extremely slow and take more or less 15s on a fast machine to execute. Afterwards the same queries take only 3s. Of course this comes from the fact that no data is cached and must be loaded from disk first. My question: Would it be possible to force the loading of the required data in advance into SQL Server cache? Note My first idea was to execute the queries in a background worker when the application starts, so that when the user starts the form the queries will already be cached and execute fast directly. I however don't want to load the result of the queries over to the client as some users are working remotely or have otherwise slow networks. So I thought just executing the queries from a stored procedure and putting the results into temporary tables so that nothing would be returned. Turned out that some of the result sets are using dynamic columns so I couldn't create the corresponding temp tables and thus this isn't a solution. Do you happen to have any other idea?

    Read the article

  • Download, pause and resume an download using Indy components

    - by Salvador
    Actually i'm using the TIdHTTP component for download a file from internet. i'm wondering if is possible pause and resume the download using this component o maybe another indy component. this is my current code, this works ok for download a file (without resume), but . now i want pause the download close my app ,and when my app restart then resume the download from the last position saved. var Http: TIdHTTP; MS : TMemoryStream; begin Result:= True; Http := TIdHTTP.Create(nil); MS := TMemoryStream.Create; try try Http.OnWork:= HttpWork;//this event give me the actual progress of the download process Http.Head(Url); FSize := Http.Response.ContentLength; AddLog('Downloading File '+GetURLFilename(Url)+' - '+FormatFloat('#,',FSize)+' Bytes'); Http.Get(Url, MS); MS.SaveToFile(LocalFile); except on E : Exception do Begin Result:=False; AddLog(E.Message); end; end; finally Http.Free; MS.Free; end; end;

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Socket errors of 10048 on the client? Possible causes?

    - by Earlz
    Hello, I'm writing a custom TCP server and client and on doing a ton of requests (60,000 to be exact) I begin to get this socket error of 10048, which should mean "the address is already in use." The error keeps happening unless I pause the process for like 2 or 3 minutes and then begin it again, and then it begins to bring up the same error a short while after restarting it. If I pause the client process and restart the server process, I still get the same error on the client. So it is a complete client side problem. This does not make sense though, this error only usually occurs when binding and this error happens on the client and not the server. What could be the possible reasons for it? A small excerpt of my initialization: TcpClient client = new TcpClient(); client.Connect("XXXXX -- some ip", 25000); client.NoDelay = true; NetworkStream clientStream = client.GetStream(); Also, everything else seems to be working fine(including the amount of time it takes to send back and forth) and this works perfectly when using 127.0.0.1 but when putting it on another LAN computer I begin to get the 10048 error. Is there something wrong with how I initialize it? What else could cause this error on the client side?

    Read the article

  • Asymptotic complexity of a compiler

    - by Meinersbur
    What is the maximal acceptable asymptotic runtime of a general-purpose compiler? For clarification: The complexity of compilation process itself, not of the compiled program. Depending on the program size, for instance, the number of source code characters, statements, variables, procedures, basic blocks, intermediate language instructions, assembler instructions, or whatever. This is highly depending on your point of view, so this is a community wiki. See this from the view of someone who writes a compiler. Will the optimisation level -O4 ever be used for larger programs when one of its optimisations takes O(n^6)? Related questions: When is superoptimisation (exponential complexity or even incomputable) acceptable? What is acceptable for JITs? Does it have to be linear? What is the complexity of established compilers? GCC? VC? Intel? Java? C#? Turbo Pascal? LCC? LLVM? (Reference?) If you do not know what asymptotic complexity is: How long are you willing to wait until the compiler compiled your project? (scripting languages excluded)

    Read the article

  • How do I set the default selection for NSTreeController at startup?

    - by John Gallagher
    The Background I've built a source list (similar to iTunes et al.) in my Cocoa app. I've got an NSOutlineView, with Value column bound to arrangedObjects.name key path of an NSTreeController. The NSTreeController accesses JGSourceListNode entities in a Core Data store. I have three subclasses of JGSourceListNode - JGProjectNode, JGGroupNode and JGFolderNode. I have selectedIndexPaths on NSTreeController bound to an NSArray called selectedIndexPaths in my App Delegate. On startup, I search for group nodes and if they're not found in the core data store I create them: if ([allGroupNodes count] == 0) { JGGroupNode *rootTrainingNode = [JGGroupNode insertInManagedObjectContext:context]; [rootTrainingNode setNodeName:@"TRAIN"]; JGProjectNode *childUntrainedNode = [JGProjectNode insertInManagedObjectContext:context]; [childUntrainedNode setParent:rootTrainingNode]; [childUntrainedNode setNodeName:@"Untrained"]; JGGroupNode *rootBrowsingNode = [JGGroupNode insertInManagedObjectContext:context]; [rootBrowsingNode setNodeName:@"BROWSE"]; JGFolderNode *childFolder = [JGFolderNode insertInManagedObjectContext:context]; [childFolder setNodeName:@"Folder"]; [childFolder setParent:rootBrowsingNode]; [context save:nil]; } What I Want When I start the app, I want both top level groups to be expanded and "Untrained" to be highlighted as shown: The Problem I put the following code in the applicationDidFinishLaunching: method of the app delegate: [sourceListOutlineView expandItem:[sourceListOutlineView itemAtRow:0]]; [sourceListOutlineView expandItem:[sourceListOutlineView itemAtRow:2]]; NSIndexPath *rootIndexPath = [NSIndexPath indexPathWithIndex:0]; NSIndexPath *childIndexPath = [rootIndexPath indexPathByAddingIndex:0]; [self setSelectedIndexPaths:[NSArray arrayWithObject:childIndexPath]]; but the outline view seems to not have been prepared yet, so this code does nothing. Ideally, eventually I want to save the last selection the user had made and restore this on a restart. The Question I'm sure it's possible using some crazy KVO to observe when the NSTreeController or NSOutlineView gets populated then expand the items and change the selection, but that feels clumsy and too much like a work around. How would I do this elegantly?

    Read the article

  • call/cc in Lua - Possible?

    - by Pessimist
    The Wikipedia article on Continuation says: "In any language which supports closures, it is possible to write programs in continuation passing style and manually implement call/cc." Either that is true and I need to know how to do it or it is not true and that statement needs to be corrected. If this is true, please show me how to implement call/cc in Lua because I can't see how. I think I'd be able to implement call/cc manually if Lua had the coroutine.clone function as explained here. If closures are not enough to implement call/cc then what else is needed? The text below is optional reading. P.S.: Lua has one-shot continuations with its coroutine table. A coroutine.clone function would allow me to clone it to call it multiple times, thus effectively making call/cc possible (unless I misunderstand call/cc). However that cloning function doesn't exist in Lua. Someone on the Lua IRC channel suggested that I use the Pluto library (it implements serialization) to marshal a coroutine, copy it and then unmarshal it and use it again. While that would probably work, I am more interested in the theoretical implementation of call/cc and in finding what is the actual minimum set of features that a language needs to have in order to allow for its manual implementation.

    Read the article

  • What file format can represent an uncompressed raster image at 48 or 64 bits per pixel?

    - by finnw
    I am creating screenshots under Windows and using the LockBits function from GDI+ to extract the pixel data, which will then be written to a file. To maximise performance I am also: Using the same PixelFormat as the source bitmap, to avoid format conversion Using the ImageLockModeUserInputBuf flag to extract the pixel data into a pre-allocated buffer This pre-allocated buffer (pointed to by BitmapData::Scan0) is part of a memory-mapped file (to avoid copying the pixel data again.) I will also be writing the code that reads the file, so I can use (or invent) any format I wish. However I would prefer to use a well-known format that existing programs (ideally web browsers) are able to read, because that means I can visually confirm that the images are correct before writing the code for the other program (that reads the image.) I have implemented this successfully for the PixelFormat32bppRGB format, which matches the format of a 32bpp BMP file, so if I extract the pixel data directly into the memory-mapped BMP file and prefix it with a BMP header I get a valid BMP image file that can be opened in Paint and most browsers. Unfortunately one of the machines I am testing on returns pixels in PixelFormat64bppPARGB format (presumably this is influenced by the video adapter driver) and there is no corresponding BMP pixel format for this. Converting to a 16, 24 or 32bpp BMP format slows the program down considerably (as well as being lossy) so I am looking for a file format that can use this pixel format without conversion, so I can extract directly into the memory-mapped file as I have done with the 32bpp format. What raster image file formats support 48bpp and/or 64bpp?

    Read the article

  • How can I build something like Amazon S3 in Perl?

    - by Joel G
    I am looking to code a file storage application in perl similar to amazon s3. I already have a amazon s3 clone that I found online called parkplace but its in ruby and is old also isn't built for high loads. I am not really sure what modules and programs I should use so id like some help picking them out. My requirements are listed below (yes I know there are lots but I could start simple then add more once I get it going): Easy API implementation for client side apps. (maybe REST (?) Centralized database server for the USERDB (maybe PostgreSQL (?). Logging of all connections, bandwidth used, well pretty much everything to a centralized server (maybe PostgreSQL again (?). Easy server side configuration (config file(s) stored on the servers). Web based control panel for admin(s) and user(s) to show logs. (could work just running queries from the databases) Fast High Uptime Low memory usage Some sort of load distribution/load balancer (maybe a dns based or pound or perlbal or something else (?). Maybe a cache of some sort (memcached or parlbal or something else (?). Thanks in advance

    Read the article

  • Executing bat file and returning the prompt

    - by Lieven Cardoen
    I have a problem with cruisecontrol where an ant scripts executes a bat file that doesn't give me the prompt back. As a result, the project in cruisecontrol keeps on bulding forever until I restart cruisecontrol. How can I resolve this? It's a startup.bat from wowza (Streaming Server) that I'm executing: @echo off call setenv.bat if not %WMSENVOK% == "true" goto end set _WINDOWNAME="Wowza Media Server 2" set _EXESERVER= if "%1"=="newwindow" ( set _EXESERVER=start %_WINDOWNAME% shift ) set CLASSPATH="%WMSAPP_HOME%\bin\wms-bootstrap.jar" rem cacls jmxremote.password /P username:R rem cacls jmxremote.access /P username:R rem NOTE: Here you can configure the JVM's built in JMX interface. rem See the "Server Management Console and Monitoring" chapter rem of the "User's Guide" for more information on how to configure the rem remote JMX interface in the [install-dir]/conf/Server.xml file. set JMXOPTIONS=-Dcom.sun.management.jmxremote=true rem set JMXOPTIONS=%JMXOPTIONS% -Djava.rmi.server.hostname=192.168.1.7 rem set JMXOPTIONS=%JMXOPTIONS% -Dcom.sun.management.jmxremote.port=1099 rem set JMXOPTIONS=%JMXOPTIONS% -Dcom.sun.management.jmxremote.authenticate=false rem set JMXOPTIONS=%JMXOPTIONS% -Dcom.sun.management.jmxremote.ssl=false rem set JMXOPTIONS=%JMXOPTIONS% -Dcom.sun.management.jmxremote.password.file= "%WMSCONFIG_HOME%/conf/jmxremote.password" rem set JMXOPTIONS=%JMXOPTIONS% -Dcom.sun.management.jmxremote.access.file= "%WMSCONFIG_HOME%/conf/jmxremote.access" rem log interceptor com.wowza.wms.logging.LogNotify - see Javadocs for ILogNotify %_EXESERVER% "%_EXECJAVA%" %JAVA_OPTS% %JMXOPTIONS% -Dcom.wowza.wms.AppHome="%WMSAPP_HOME%" -Dcom.wowza.wms.ConfigURL="%WMSCONFIG_URL%" -Dcom.wowza.wms.ConfigHome="%WMSCONFIG_HOME%" -cp %CLASSPATH% com.wowza.wms.bootstrap.Bootstrap start :end

    Read the article

  • Monotouch or Titanium for rapid application development on IPhone?

    - by Ronnie
    As a .Net developer I always dreamed for the possibility to develop with my existing skills (c#) applications for the Iphone. Both programs require a Mac and the Iphone Sdk installed. Appcelerator Titanium was the first app I tried and it is based on exposing some Iphone native api to javascript so that they can be called using that language. Monotouch starts at $399 for beeing able to deploy on the Iphone and not on the Iphone simulator while Titanium is free. Monotouch (Monodevelop) has an Ide that is currently missing in Titanium (but you can use any editor like Textmate, Aptana...) I think both program generate at the end a native precompiled app (also if I am not sure about the size of the final app on the Iphone as I think the .Net framework calls are prelilnked at compilation time in Monotouch). I am also not sure about the full coverage of all the Iphone api and features. Titanium has also the advantage to enable Android app development but as a c# developer I still find Monotouch experience more like the Visual Studio one. Witch one would you choose and what are your experiences on Monotouch and Titanium?

    Read the article

  • Cocoa Core data: cannot save Created Items in NSTableview

    - by Paul Rostorp
    Hello, I'm am a beginner in mac os x development and am trying to get started with all this. Here is my problem : I've create a non-document based cocoa app using core data as storage. I've added an entity and attributes to the xdatamodel. In IB i've created an NSArrayController and linked it properly. I've created an nstableview binded to the nsarraycontroller. Next I added a button linked to nsarraycontroller with the " add: " method. When I try it out, I can add and edit the items in the table. Here comes the problem: Core data is supposed to save everything automatically, but to make sure i linked the "save" button in the menu to the appdelegate and to the " file's owner" , first responder, application... everything possible ( with both " save :" and " saveaction:" methods ). And still it doesn't save when clicking save: when I restart the cell created ( and renamed ) are gone. And also, I didn't even edit the source code yet; core data for such simple tasks is supposed to only need Interface builder. Please help me for this, I haven't found any threads resolving this problem. Thank you in advance.

    Read the article

  • Why do people have to use multiple versions of jQuery in the same page?

    - by reprogrammer
    I have noticed that sometimes people have to use multiple versions of jQuery in the same page (See question 1 and question 2). I assume people have to carry old versions of jQuery because some pieces of their code is based on an older version of jQuery. Obviously, this approach causes inefficiency. The ideal solution is to refactor the old code to use the newer jQuery API. I wonder if there are tools that automate the process of upgrading a piece of code to use a newer version of jQuery. I've never written programs in in either Javascript or jQuery. So, I'd like to hear from programmers experienced in these language about their opinion on this issue. In particular, I'd like to know the following. How much of problem it is to have to load multiple versions of jQuery? Have you ever had to load multiple versions of any other library in the same page? Do you know of any refactoring tools that helps you migrate your code to use the updated API? Do you think such a refactoring tool is useful? Are you willing to use it?

    Read the article

  • Perl program - Dynamic Bootstrapping code

    - by mgj
    Hi.. I need to understand the working of this particular program, It seems to be quite complicated, could you please see if you could help me understanding what this program in Perl does, I am a beginner so I hardly can understand whats happening in the code given on the following link below, Any kind of guidance or insights wrt this program is highly appreciated. Thank you...:) This program is called premove.pl.c Its associated with one more program premove.pl, Its code looks like this: #!perl open (newdata,">newdata.txt") || die("cant create new file\n");#create passwd file $linedata = ""; while($line=<>){ chomp($line); #chop($line); print newdata $line."\n"; } close(newdata); close(olddata); __END__ I am even not sure how to run the two programs mentioned here. I wonder also what does the extension of the first program signify as it has "pl.c" extension, please let me know if you know what it could mean. I need to understand it asap thats why I am posting this question, I am kind of short of time else I would try to figure it out myself, This seems to be a complex program for a beginner like me, hope you understand. Thank you again for your time.

    Read the article

  • What are the most interesting equivalences arising from the Curry-Howard Isomorphism?

    - by Tom
    I came upon the Curry-Howard Isomorphism relatively late in my programming life, and perhaps this contributes to my being utterly fascinated by it. It implies that for every programming concept there exists a precise analogue in formal logic, and vice versa. Here's an "obvious" list of such analogies, off the top of my head: program/definition | proof type/declaration | proposition inhabited type | theorem function | implication function argument | hypothesis/antecedent function result | conclusion/consequent function application | modus ponens recursion | induction identity function | tautology non-terminating function | absurdity tuple | conjunction (and) disjoint union | exclusive disjunction (xor) parametric polymorphism | universal quantification So, to my question: what are some of the more interesting/obscure implications of this isomorphism? I'm no logician so I'm sure I've only scratched the surface with this list. For example, here are some programming notions for which I'm unaware of pithy names in logic: currying | "((a & b) => c) iff (a => (b => c))" scope | "known theory + hypotheses" And here are some logical concepts which I haven't quite pinned down in programming terms: primitive type? | axiom set of valid programs? | theory ? | disjunction (or)

    Read the article

< Previous Page | 336 337 338 339 340 341 342 343 344 345 346 347  | Next Page >