Search Results

Search found 26908 results on 1077 pages for 'asynchronous wcf call'.

Page 344/1077 | < Previous Page | 340 341 342 343 344 345 346 347 348 349 350 351  | Next Page >

  • Public static variables and Android activity life cycle management

    - by jsstp24n5
    According to the documentation the Android OS can kill the activity at the rear of the backstack. So, say for example I have an app and open the Main Activity (let's call it Activity A). In this public activity class I declare and initialize a public static variable (let's call it "foo"). In Activity A's onCreate() method I then change the value of "foo." From Activity A the user starts another activity within my app called Activity B. Variable "foo" is used in Activity B. Activity B is then paused after the user navigates to some other activities in other apps. Eventually, after a memory shortage occurs, Activity A then Activity B can be killed. After the user navigates back to my app it restarts (actually "recreates") activity B. What happens: 1) Will variable "foo" at this point have the value that was set to it when Activity A's onCreate() method ran? 2) Variable "foo" does not exist? 3) Variable "foo" exists and but is now the initialized value and not the value set in Activity A's onCreate() method?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Is this implementation truely tail-recursive?

    - by CFP
    Hello everyone! I've come up with the following code to compute in a tail-recursive way the result of an expression such as 3 4 * 1 + cos 8 * (aka 8*cos(1+(3*4))) The code is in OCaml. I'm using a list refto emulate a stack. type token = Num of float | Fun of (float->float) | Op of (float->float->float);; let pop l = let top = (List.hd !l) in l := List.tl (!l); top;; let push x l = l := (x::!l);; let empty l = (l = []);; let pile = ref [];; let eval data = let stack = ref data in let rec _eval cont = match (pop stack) with | Num(n) -> cont n; | Fun(f) -> _eval (fun x -> cont (f x)); | Op(op) -> _eval (fun x -> cont (op x (_eval (fun y->y)))); in _eval (fun x->x) ;; eval [Fun(fun x -> x**2.); Op(fun x y -> x+.y); Num(1.); Num(3.)];; I've used continuations to ensure tail-recursion, but since my stack implements some sort of a tree, and therefore provides quite a bad interface to what should be handled as a disjoint union type, the call to my function to evaluate the left branch with an identity continuation somehow irks a little. Yet it's working perfectly, but I have the feeling than in calling the _eval (fun y->y) bit, there must be something wrong happening, since it doesn't seem that this call can replace the previous one in the stack structure... Am I misunderstanding something here? I mean, I understand that with only the first call to _eval there wouldn't be any problem optimizing the calls, but here it seems to me that evaluation the _eval (fun y->y) will require to be stacked up, and therefore will fill the stack, possibly leading to an overflow... Thanks!

    Read the article

  • Is this casting safe?

    - by Itsik
    I need to write a Util function (in my c++cli app) that converts a String to a Double or Float or Int. template<typename T> static T MyConvert(String^ str) { return static_cast<T>(System::Convert::ToDouble(str)); } Is this safe? Can it somehow convert 2 to 1.999 and then to 1 if I call MyConvert<int>("2") ? I was wondering why the Convert class isn't templated in the first place? (That would let me call Convert<T> instead of Convert.ToDouble() for all types) This is C++/Cli so I can use any convert methods in c++ or .net, but I only know Convert.ToDouble()|ToString()|ToInt32()) Thanks

    Read the article

  • Windows Phone 7 HttpRequest Unable to see true Error Code and response details

    - by Bob
    I have to call a somewhat broken API from a Windows Phone 7 application. The API returns a 302 error and a cookie to the authentication request. I've tried every way I've been able to find in the MSDN documentation for using ClientHTTP instead of BrowserHTTP (registering the prefix, using the call to explicitly create a ClientHTTP using Request), but the 302 is getting translated to a 404 and I'm not seeing the cookies on the response. I've tried a WebClient, I've tried an HttpRequest and it is always the translated error message. If I allocate a CookieContainer for the HttpRequest, I get a null argument exception when the client stack is parsing the returned message. I can see that the response is coming back as expected via Fiddler.

    Read the article

  • How can I consolidate deferred/delayed calls in Objective-C ?

    - by thrusty
    I'd like to ensure that certain maintenance tasks are executed "eventually". For example, after I detect that some resources might no longer be used in a cache, I might call: [self performSelector:@selector(cleanupCache) withObject:nil afterDelay:0.5]; However, there might be numerous places where I detect this, and I don't want to be calling cleanupCache continuously. I'd like to consolidate multiple calls to cleanupCache so that we only periodically get ONE call to cleanupCache. Here's what I've come up with do to this-- is this the best way? [NSObject cancelPreviousPerformRequestsWithTarget:self selector:@selector(cleanupCache) object:nil]; [self performSelector:@selector(cleanupCache) withObject:nil afterDelay:0.5];

    Read the article

  • Singletons and other design issues

    - by Ahmed Saleh
    I have worked using different languages like C++/Java and currently AS3. Most applications were computer vision, and small 2D computer games. Most companies that I have worked for, they use Singletons in a language like AS3, to retrieve elements or classes in an easy way. Their problem is basically they needs some variables or to call other functions from other classes. In a language like AS3, there is no private constructor, and they write a hacky code to prevent new instances. In Java and C++ I also faced the situation that I need to use other classe's members or to call their functions in different classes. The question is, is there a better or another design, to let other classes interact with each others without using singletons? I feel that composition is the answer, but I need more detailed solutions or design suggestions.

    Read the article

  • How to manage db connections on server?

    - by simpatico
    I have a severe problem with my database connection in my web application. Since I use a single database connection for the whole application from singleton Database class, if i try concurrent db operations (two users) the database rollsback the transactions. This is my static method used: All threads/servlets call static Database.doSomething(...) methods, which in turn call the the below method. private static /* synchronized*/ Connection getConnection(final boolean autoCommit) throws SQLException { if (con == null) { con = new MyRegistrationBean().getConnection(); } con.setAutoCommit(true); //TODO return con; } What's the recommended way to manage this db connection/s I have, so that I don't incurr in the same problem.

    Read the article

  • how have defined connection within function for pdo communication with DB

    - by Scarface
    hey guys I just started trying to convert my query structure to PDO and I have come across a weird problem. When I call a pdo query connection within a function and the connection is included outside the function, the connection becomes undefined. Anyone know what I am doing wrong here? I was just playing with it, my example is below. include("includes/connection.php"); function query(){ $user='user'; $id='100'; $sql = 'SELECT * FROM users'; $stmt = $conn->prepare($sql); $result=$stmt->execute(array($user, $id)); echo $count=$stmt->rowCount(); if (!$result || $stmt->rowCount()>=1){ echo 'balls'; } // now iterate over the result as if we obtained // the $stmt in a call to PDO::query() while($r = $stmt->fetch(PDO::FETCH_ASSOC)) { echo "$r[username] $r[id] \n"; } } query();

    Read the article

  • Can I destroy a class instance even if there are still references?

    - by DR
    For debugging reasons I want to destroy a class instance which still as references. Is that possible? It doesn't have to be elegant or stable, because this'll never end up in production code. To clarify: Public Sub Main Dim o as MyClass Set o = New MyClass //o is created, one reference DestroyObject o //Class_Terminate is called and the object destroyed //Further code, not using o End Sub //Possible runtime error here (don't care) Is that possible? One way would be to call IUnknown::Release to manually decrease the reference count, but how do I now how often I must call it?

    Read the article

  • How to "serialize" and "deserialize" command line arguments to string in bash?

    - by Vi
    I call my script: $ ./script 'a!#*`*& ^$' "sdf sdf\"qw sdsdf" 1 -- 2 3 It gets arguments: 1: a!#*`*& ^$ 2: sdf sdf"qw sdsdf 3: 1 4: -- 5: 2 6: 3 If I need to call something with the same arguments locally, I do this: someprogram "$@" But how can I put all that array to a string (to store in file or in environment variable or pass over TCP eaisly) and then turn it back to command line arguments somewhere? I want it to be simple, short and secure. export CMDLINE="$@" # What is in CMDLINE now? Escaped or not? sh -c "someprogram $CMDLINE" # Will it do what I mean? Ideally I want two bash subroutines: the first turns turns any Bash array into a [a-zA-Z0-9_]* string, the other turns it back to Bash array I can use.

    Read the article

  • user notification while waiting

    - by user315445
    I am writing a simple win forms app in C#. There is a method call in my method which loads files but is taking a while to respond. Below is the method call Directory.GetFiles(selectedFolder, "*.xml", SearchOption.AllDirectories); I want to notify this to users. Is there a way to show them that file loading is in progress? I want a simplest way. I suppose Splash screen is too costly for my app.

    Read the article

  • How should I generate HTML to represent class and its properties?

    - by Mike
    Currently I have a class that represents a document. This document needs to be displayed as HTML. I would like to have a method to call such as GetHTML() that would then call GetHTML() on any properties/sections of the document that needed to be rendered. I was initially thinking about using linq and XElement but am wondering if that may cause issues with certain tags in HTML. Would I better off using an HtmlTextWriter? I am open to any suggestions or best practives for this situation. Thanks!

    Read the article

  • RAII: Initializing data member in const method

    - by Thomas Matthews
    In RAII, resources are not initialized until they are accessed. However, many access methods are declared constant. I need to call a mutable (non-const) function to initialize a data member. Example: Loading from a data base struct MyClass { int get_value(void) const; private: void load_from_database(void); // Loads the data member from database. int m_value; }; int MyClass :: get_value(void) const { static bool value_initialized(false); if (!value_initialized) { // The compiler complains about this call because // the method is non-const and called from a const // method. load_from_database(); } return m_value; } My primitive solution is to declare the data member as mutable. I would rather not do this, because it suggests that other methods can change the member. How would I cast the load_from_database() statement to get rid of the compiler errors?

    Read the article

  • [R] multiple functions in one R script

    - by Philipp
    Hi, I guess it's a stupid question, but I don't get it :-( I wrote an R script, which creates heatmaps out of xls files. I am calling this R script with a Perl system call and pass over all the arguments. This all works fine. Now I wanted to make the R script less confusing by writing different functions in the R script, for example: args <- commandArgs(TRUE) parsexls <- function(filepath) { data <- read.xls(...) assign("data", data, globalenv()) } reorder <- function(var) { data <- data[order...] assign("data", data, globalenv()) } When I want to call the functions with parsexls(args[1]) reorder(args[2]) nothing happens. But when I place the parsexls(args[1]) in the script between the two functions shown above, the file is parsed correctly! The reorder(args[2]) seems never to be read. Any ideas what I am doing wrong? Phil

    Read the article

  • jQuery get value from checked element with a given name

    - by Travis Leleu
    I've got an input like so: I'd like to use jQuery to grab that element, and add the function call foo() to the change event. Currently I can get it done, but there are two hacks involved. My (working) code: $(":input[name*=myfield]").change( function( $(":input[name*=myfield]") ) { foo(); }); )}; There are two hacks in there I'd like to eliminate. Keeping in mind that the input names are multidimensional arrays, how can I use the :input[name=somename], versus [name*=someone]? I'd imagine it's faster using an exact name rather than *=, but I can't get the escape sequence correct for the brackets on the multidimensional arrays. Can I chain the call together so that I don't have to select the element twice? Is the standard practice for that to select the HTML element into a var, then use that var? Or can I chain it together? Thanks for the help. Still working on getting my footing in JS/JQ.

    Read the article

  • How to programatically set cell.textLabel.text from a different view?

    - by Andy
    I've got a view controller, call it VC1, that's a table view. When I tap a cell in the table view, I am presented with a new view controller, call it VC2, which is a short list of choices. After making a choice, I want to dismiss VC2 and set the cell.textLabel.text property of the VC1 cell I originally tapped to the value I selected in VC2. Conceptually speaking, what is the proper way to do this? I've tried a handful of different approaches, but all of them seem wonky at best, and only one of them actually worked - although it was the most cumbersome of all, passing references to both view controllers and table view cells and all kinds of things. It just feels like I'm making a mountain out of what is probably a mole hill. This is such a common paradigm that I find it hard to believe there's not a simple method for doing it. Thanks in advance for any input you can offer.

    Read the article

  • Why first arg to execve() must be path to executable

    - by EBM
    I understand that execve() and family require the first argument of its argument array to be the same as the executable that is also pointed to by its first argument. That is, in this: execve(prog, args, env); args[0] will usually be the same as prog. But I can't seem to find information as to why this is. I also understand that executables (er, at least shell scripts) always have their calling path as the first argument when running, but I would think that the shell would do the work to put it there, and execve() would just call the executable using the path given in its first argument ("prog" from above), then passing the argument array ("args" from above) as one would on the command line.... i.e., I don't call scripts on the command line with a duplicate executable path in the args list.... /bin/ls /bin/ls /home/john Can someone explain?

    Read the article

  • Autorelease for CGMutablePathRef?

    - by huggie
    Hi, I am developing for iphone. I want to creating a mutable path via CGPathCreateMutable(), and I want to return it out of the function which creates it. I'm suppose to call a CGPathRelease() when I'm done with it. But since I'm returning it I wish to autorelease it. Since Quartz path is a C code (and doesn't look like an objective C object), is it correct that I cannot call autorelease on it? Edit: For others who stumble upon this question, the below advise is for C functions returning Core foundation objects only. For objective C methods returning Core foundation objects, see http://stackoverflow.com/questions/2901942/ownership-regarding-to-returned-quartz-objects

    Read the article

  • How to store and access ajax data in javascript without using global variables ?

    - by mike_t2e
    I may be missing something obvious here, but how could I rewrite this code so that it doesn't need the theVariable to be a global variable ? <script language="javascript"> theVariable = ""; function setValue() /* called on page load */ { /* make ajax call to the server here */ theVariable = "a string of json data waiting to be eval()'d"; } function getValue() { alert(theVariable); } </script> <input type="button" onClick="javascript:getValue()" value="Get the value"> In my actual situation, the setValue function makes an ajax call to the server, receives a json string and the data from that is accessed when you mouseover various parts of the page. I end up using several global variables which works fine, but is messy and I'd like to know if there's a better and more elegant way of doing it ?

    Read the article

  • Client-side session timeout redirect in ASP.Net

    - by Mercury821
    I want to build a way to automatically redirect users to Timeout.aspx when their session expires due to inactivity. My application uses forms authentication and relies heavily on update panels within the same aspx page for user interaction, so I don't want to simply redirect after a page-level timer expires. For the same reason, I can't use '<meta http-equiv="refresh"/>' What I want to do is create a simple ajax web service with a method called IsSessionTimedOut(), that simply returns a boolean. I will use a javascript timer to periodically call the method, and if it returns true, then redirect to Timeout.aspx. However, I don't want calling this method to reset the session timeout timer, or the session would never time out because of the service call. Is there a clean way to avoid this catch-22? Hopefully there is an easy solution that has so far eluded me.

    Read the article

  • Remove items from SWT tables

    - by Dima
    This is more of an answer I'd like to share for the problem I was chasing for some time in RCP application using large SWT tables. The problem is the performance of SWT Table.remove(int start, int end) method. It gives really bad performance - about 50msec per 100 items on my Windows XP. But the real show stopper was on Vista and Windows 7, where deleting 100 items would take up to 5 seconds! Looking into the source code of the Table shows that there are huge amount of windowing events flying around in this call.. That brings the windowing system to its knees. The solution was to hide the damn thing during this call: table.setVisible(false); table.remove(from, to); table.setVisible(true); That does wonders - deleting 500 items on both XP & Windows7 takes ~15msec, which is just an overhead for printing out time stamps I used. nice :)

    Read the article

< Previous Page | 340 341 342 343 344 345 346 347 348 349 350 351  | Next Page >