Search Results

Search found 26908 results on 1077 pages for 'asynchronous wcf call'.

Page 344/1077 | < Previous Page | 340 341 342 343 344 345 346 347 348 349 350 351  | Next Page >

  • How to store and access ajax data in javascript without using global variables ?

    - by mike_t2e
    I may be missing something obvious here, but how could I rewrite this code so that it doesn't need the theVariable to be a global variable ? <script language="javascript"> theVariable = ""; function setValue() /* called on page load */ { /* make ajax call to the server here */ theVariable = "a string of json data waiting to be eval()'d"; } function getValue() { alert(theVariable); } </script> <input type="button" onClick="javascript:getValue()" value="Get the value"> In my actual situation, the setValue function makes an ajax call to the server, receives a json string and the data from that is accessed when you mouseover various parts of the page. I end up using several global variables which works fine, but is messy and I'd like to know if there's a better and more elegant way of doing it ?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Windows Phone 7 HttpRequest Unable to see true Error Code and response details

    - by Bob
    I have to call a somewhat broken API from a Windows Phone 7 application. The API returns a 302 error and a cookie to the authentication request. I've tried every way I've been able to find in the MSDN documentation for using ClientHTTP instead of BrowserHTTP (registering the prefix, using the call to explicitly create a ClientHTTP using Request), but the 302 is getting translated to a 404 and I'm not seeing the cookies on the response. I've tried a WebClient, I've tried an HttpRequest and it is always the translated error message. If I allocate a CookieContainer for the HttpRequest, I get a null argument exception when the client stack is parsing the returned message. I can see that the response is coming back as expected via Fiddler.

    Read the article

  • How should I generate HTML to represent class and its properties?

    - by Mike
    Currently I have a class that represents a document. This document needs to be displayed as HTML. I would like to have a method to call such as GetHTML() that would then call GetHTML() on any properties/sections of the document that needed to be rendered. I was initially thinking about using linq and XElement but am wondering if that may cause issues with certain tags in HTML. Would I better off using an HtmlTextWriter? I am open to any suggestions or best practives for this situation. Thanks!

    Read the article

  • How can I receive messages over http without MSMQ

    - by pduncan
    I need a reliable messaging framework that runs over http/https (due to client security requirements) and that doesn't use MSMQ (because some clients will use Windows XP Home). The clients only need to be able to receive messages, not send them. We already have a message queue on the server for each user, and the receivers have been getting messages by connecting to an HttpHandler on the server and getting a Stream from WebResponse.GetResponseStream() We keep this stream open, and pull messages off of it using Stream.Read(). This MOSTLY works, but Stream.Read() is a blocking call, and we can't reliably interrupt it. We need to be able to stop and start the receiver without losing messages, but the old stream often hangs around, even after we call Thread.Abort on its thread. Any suggestions?

    Read the article

  • Is this implementation truely tail-recursive?

    - by CFP
    Hello everyone! I've come up with the following code to compute in a tail-recursive way the result of an expression such as 3 4 * 1 + cos 8 * (aka 8*cos(1+(3*4))) The code is in OCaml. I'm using a list refto emulate a stack. type token = Num of float | Fun of (float->float) | Op of (float->float->float);; let pop l = let top = (List.hd !l) in l := List.tl (!l); top;; let push x l = l := (x::!l);; let empty l = (l = []);; let pile = ref [];; let eval data = let stack = ref data in let rec _eval cont = match (pop stack) with | Num(n) -> cont n; | Fun(f) -> _eval (fun x -> cont (f x)); | Op(op) -> _eval (fun x -> cont (op x (_eval (fun y->y)))); in _eval (fun x->x) ;; eval [Fun(fun x -> x**2.); Op(fun x y -> x+.y); Num(1.); Num(3.)];; I've used continuations to ensure tail-recursion, but since my stack implements some sort of a tree, and therefore provides quite a bad interface to what should be handled as a disjoint union type, the call to my function to evaluate the left branch with an identity continuation somehow irks a little. Yet it's working perfectly, but I have the feeling than in calling the _eval (fun y->y) bit, there must be something wrong happening, since it doesn't seem that this call can replace the previous one in the stack structure... Am I misunderstanding something here? I mean, I understand that with only the first call to _eval there wouldn't be any problem optimizing the calls, but here it seems to me that evaluation the _eval (fun y->y) will require to be stacked up, and therefore will fill the stack, possibly leading to an overflow... Thanks!

    Read the article

  • Is this casting safe?

    - by Itsik
    I need to write a Util function (in my c++cli app) that converts a String to a Double or Float or Int. template<typename T> static T MyConvert(String^ str) { return static_cast<T>(System::Convert::ToDouble(str)); } Is this safe? Can it somehow convert 2 to 1.999 and then to 1 if I call MyConvert<int>("2") ? I was wondering why the Convert class isn't templated in the first place? (That would let me call Convert<T> instead of Convert.ToDouble() for all types) This is C++/Cli so I can use any convert methods in c++ or .net, but I only know Convert.ToDouble()|ToString()|ToInt32()) Thanks

    Read the article

  • LINQ Except operator and object equality

    - by Abhijeet Patel
    Here is an interesting issue I noticed when using the Except Operator: I have list of users from which I want to exclude some users: The list of users is coming from an XML file: The code goes like this: interface IUser { int ID { get; set; } string Name { get; set; } } class User: IUser { #region IUser Members public int ID { get; set; } public string Name { get; set; } #endregion public override string ToString() { return ID + ":" +Name; } public static IEnumerable<IUser> GetMatchingUsers(IEnumerable<IUser> users) { IEnumerable<IUser> localList = new List<User> { new User{ ID=4, Name="James"}, new User{ ID=5, Name="Tom"} }.OfType<IUser>(); var matches = from u in users join lu in localList on u.ID equals lu.ID select u; return matches; } } class Program { static void Main(string[] args) { XDocument doc = XDocument.Load("Users.xml"); IEnumerable<IUser> users = doc.Element("Users").Elements("User").Select (u => new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType<IUser>(); //still a query, objects have not been materialized var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes should contain 6 users but here it contains 8 users } } When I call User.GetMatchingUsers(users) I get 2 matches as expected. The issue is that when I call users.Except(matches) The matching users are not being excluded at all! I am expecting 6 users ut "excludes" contains all 8 users instead. Since all I'm doing in GetMatchingUsers(IEnumerable users) is taking the IEnumerable and just returning the IUsers whose ID's match( 2 IUsers in this case), my understanding is that by default "Except" will use reference equality for comparing the objects to be excluded. Is this not how "Except" behaves? What is even more interesting is that if I materialize the objects using .ToList() and then get the matching users, and call "Except", everything works as expected! Like so: IEnumerable users = doc.Element("Users").Elements("User").Select (u = new User { ID = (int)u.Attribute("id"), Name = (string)u.Attribute("name") } ).OfType().ToList(); //explicity materializing all objects by calling ToList() var matches = User.GetMatchingUsers(users); var excludes = users.Except(matches); // excludes now contains 6 users as expected I don't see why I should need to materialize objects for calling "Except" given that its defined on IEnumerable? Any suggesstions / insights would be much appreciated.

    Read the article

  • Passing variables from SQL proceedure to PHP

    - by Sam Corbet
    I am trying to create an sql proceedure that will return the results back to the php page. I want to be able to call the procedure as follows from the php call procedure_name($var1) which will run this script: -- --------------------------------------------------------------------------------- -- pUIGetCliStmtGenFlag -- -- This procedure returns the status of the Trading Period: -- -- --------------------------------------------------------------------------------- drop procedure if exists pUIGetCliStmtGenFlag; delimiter // create procedure pUIGetCliStmtGenFlag( IN pTradingPeriodMonth DATE ) MODIFIES SQL DATA COMMENT 'Checks if the TP has been closed' begin SELECT trading_period_month, dt_end, amt_traded_system_ccy FROM ca_trading_period WHERE trading_period_month=$var1 -- If amt_traded_system_ccy is NULL give the TP an open status otherwise mark as closed IF amt_traded_system_ccy is NULL $tpstatus='open' ELSE $tpstatus='closed' end; // delimiter ; I then want to be able to use $tpstatus in the rest of the php script. I know this is simple but this is completely new to me and I cant find the correct method

    Read the article

  • Client-side session timeout redirect in ASP.Net

    - by Mercury821
    I want to build a way to automatically redirect users to Timeout.aspx when their session expires due to inactivity. My application uses forms authentication and relies heavily on update panels within the same aspx page for user interaction, so I don't want to simply redirect after a page-level timer expires. For the same reason, I can't use '<meta http-equiv="refresh"/>' What I want to do is create a simple ajax web service with a method called IsSessionTimedOut(), that simply returns a boolean. I will use a javascript timer to periodically call the method, and if it returns true, then redirect to Timeout.aspx. However, I don't want calling this method to reset the session timeout timer, or the session would never time out because of the service call. Is there a clean way to avoid this catch-22? Hopefully there is an easy solution that has so far eluded me.

    Read the article

  • jquery and codeigniter

    - by rabidmachine9
    Hello people, and sorry if that question is stupid I'm trying to use javascript with codeigniter and I can't get it right what I'm actually doing is placing jQuery inside the views folder and call it from one of my view files like that: <script type="text/javascript" src="jquery.js"></script> I get no response no errors it just doesn't work, I could also display more code but my first assumption is that there something wrong with the way I call it... maybe something with the paths? any workarounds? thanks in advance

    Read the article

  • How to "serialize" and "deserialize" command line arguments to string in bash?

    - by Vi
    I call my script: $ ./script 'a!#*`*& ^$' "sdf sdf\"qw sdsdf" 1 -- 2 3 It gets arguments: 1: a!#*`*& ^$ 2: sdf sdf"qw sdsdf 3: 1 4: -- 5: 2 6: 3 If I need to call something with the same arguments locally, I do this: someprogram "$@" But how can I put all that array to a string (to store in file or in environment variable or pass over TCP eaisly) and then turn it back to command line arguments somewhere? I want it to be simple, short and secure. export CMDLINE="$@" # What is in CMDLINE now? Escaped or not? sh -c "someprogram $CMDLINE" # Will it do what I mean? Ideally I want two bash subroutines: the first turns turns any Bash array into a [a-zA-Z0-9_]* string, the other turns it back to Bash array I can use.

    Read the article

  • How can I consolidate deferred/delayed calls in Objective-C ?

    - by thrusty
    I'd like to ensure that certain maintenance tasks are executed "eventually". For example, after I detect that some resources might no longer be used in a cache, I might call: [self performSelector:@selector(cleanupCache) withObject:nil afterDelay:0.5]; However, there might be numerous places where I detect this, and I don't want to be calling cleanupCache continuously. I'd like to consolidate multiple calls to cleanupCache so that we only periodically get ONE call to cleanupCache. Here's what I've come up with do to this-- is this the best way? [NSObject cancelPreviousPerformRequestsWithTarget:self selector:@selector(cleanupCache) object:nil]; [self performSelector:@selector(cleanupCache) withObject:nil afterDelay:0.5];

    Read the article

  • jQuery get value from checked element with a given name

    - by Travis Leleu
    I've got an input like so: I'd like to use jQuery to grab that element, and add the function call foo() to the change event. Currently I can get it done, but there are two hacks involved. My (working) code: $(":input[name*=myfield]").change( function( $(":input[name*=myfield]") ) { foo(); }); )}; There are two hacks in there I'd like to eliminate. Keeping in mind that the input names are multidimensional arrays, how can I use the :input[name=somename], versus [name*=someone]? I'd imagine it's faster using an exact name rather than *=, but I can't get the escape sequence correct for the brackets on the multidimensional arrays. Can I chain the call together so that I don't have to select the element twice? Is the standard practice for that to select the HTML element into a var, then use that var? Or can I chain it together? Thanks for the help. Still working on getting my footing in JS/JQ.

    Read the article

  • VB.Net List.Find. Pass values to predicate

    - by Beta033
    Having a bit of trouble using the List.Find with a custom predicate i have a function that does this private function test () Dim test As Integer = keys.Find(AddressOf FindByOldKeyAndName).NewKey here's the function for the predicate Private Shared Function FindByOldKeyAndName(ByVal k As KeyObj) As Boolean If k.OldKey = currentKey.OldKey And k.KeyName = currentKey.KeyName Then Return True Else Return False End If End Function by doing it this way means i have to have a shared "currentKey" object in the class, and i know there has to be a way to pass in the values i'm interested in of CurrentKey (namely, keyname, and oldkey) ideally i'd like to call it by something like keys.Find(AddressOf FindByOldKeyAndName(Name,OldVal)) however when i do this i get compiler errors. How do i call this method and pass in the values?

    Read the article

  • Can I destroy a class instance even if there are still references?

    - by DR
    For debugging reasons I want to destroy a class instance which still as references. Is that possible? It doesn't have to be elegant or stable, because this'll never end up in production code. To clarify: Public Sub Main Dim o as MyClass Set o = New MyClass //o is created, one reference DestroyObject o //Class_Terminate is called and the object destroyed //Further code, not using o End Sub //Possible runtime error here (don't care) Is that possible? One way would be to call IUnknown::Release to manually decrease the reference count, but how do I now how often I must call it?

    Read the article

  • Why first arg to execve() must be path to executable

    - by EBM
    I understand that execve() and family require the first argument of its argument array to be the same as the executable that is also pointed to by its first argument. That is, in this: execve(prog, args, env); args[0] will usually be the same as prog. But I can't seem to find information as to why this is. I also understand that executables (er, at least shell scripts) always have their calling path as the first argument when running, but I would think that the shell would do the work to put it there, and execve() would just call the executable using the path given in its first argument ("prog" from above), then passing the argument array ("args" from above) as one would on the command line.... i.e., I don't call scripts on the command line with a duplicate executable path in the args list.... /bin/ls /bin/ls /home/john Can someone explain?

    Read the article

  • Is there a way to animate on a Home Widget?

    - by David
    Hi All, I want to use an animation on a Home page Widget, i.e. an AppWidgetProvider. I was hoping to use the "Frame Animation" technique: http://developer.android.com/guide/topics/graphics/2d-graphics.html#frame-animation which I've used successfully in an activity. But I can't translate that code to an AppWidgetProvider. Basically, in an AppWidgetProvider, I create and work with a RemoteViews object, which AFAIK doesn't provide me with a method to get a reference to an ImageView in the layout for me to call start() on the animation. There is also not a handler or a callback for when the widget displays so I can make the start() call. Is there another way this can be done? I suppose that I can probably do the animation on my own with very fast onUpdate() calls on the widget, but that seems awfully expensive.

    Read the article

  • how have defined connection within function for pdo communication with DB

    - by Scarface
    hey guys I just started trying to convert my query structure to PDO and I have come across a weird problem. When I call a pdo query connection within a function and the connection is included outside the function, the connection becomes undefined. Anyone know what I am doing wrong here? I was just playing with it, my example is below. include("includes/connection.php"); function query(){ $user='user'; $id='100'; $sql = 'SELECT * FROM users'; $stmt = $conn->prepare($sql); $result=$stmt->execute(array($user, $id)); echo $count=$stmt->rowCount(); if (!$result || $stmt->rowCount()>=1){ echo 'balls'; } // now iterate over the result as if we obtained // the $stmt in a call to PDO::query() while($r = $stmt->fetch(PDO::FETCH_ASSOC)) { echo "$r[username] $r[id] \n"; } } query();

    Read the article

  • Is it possible to change the pane locations in Chrome Developer Tools?

    - by T.J. Crowder
    When debugging browser-based apps using Google Chrome's Developer Tools, is there a way to change the locations of the various panes? E.g., the Watch Expressions, the Call Stack, the code pane, etc.? The defaults are okay (console at bottom, code pane upper left, a column of Watch Expressions, Call Stack, Scope Vars, etc. in the upper right), but I'd rather swap things around a bit of it's possible. There doesn't seem to be anything to grab (other than for sizing) and I haven't found a way in my searching so far, but there are (still) some things about Chrome's options that aren't ... well-advertised in the UI, shall we say :-), especially around developer tools.

    Read the article

  • How to manage db connections on server?

    - by simpatico
    I have a severe problem with my database connection in my web application. Since I use a single database connection for the whole application from singleton Database class, if i try concurrent db operations (two users) the database rollsback the transactions. This is my static method used: All threads/servlets call static Database.doSomething(...) methods, which in turn call the the below method. private static /* synchronized*/ Connection getConnection(final boolean autoCommit) throws SQLException { if (con == null) { con = new MyRegistrationBean().getConnection(); } con.setAutoCommit(true); //TODO return con; } What's the recommended way to manage this db connection/s I have, so that I don't incurr in the same problem.

    Read the article

  • Python json memory bloat

    - by Anoop
    import json import time from itertools import count def keygen(size): for i in count(1): s = str(i) yield '0' * (size - len(s)) + str(s) def jsontest(num): keys = keygen(20) kvjson = json.dumps(dict((keys.next(), '0' * 200) for i in range(num))) kvpairs = json.loads(kvjson) del kvpairs # Not required. Just to check if it makes any difference print 'load completed' jsontest(500000) while 1: time.sleep(1) Linux top indicates that the python process holds ~450Mb of RAM after completion of 'jsontest' function. If the call to 'json.loads' is omitted then this issue is not observed. A gc.collect after this function execution does releases the memory. Looks like the memory is not held in any caches or python's internal memory allocator as explicit call to gc.collect is releasing memory. Is this happening because the threshold for garbage collection (700, 10, 10) was never reached ? I did put some code after jsontest to simulate threshold. But it didn't help.

    Read the article

  • RAII: Initializing data member in const method

    - by Thomas Matthews
    In RAII, resources are not initialized until they are accessed. However, many access methods are declared constant. I need to call a mutable (non-const) function to initialize a data member. Example: Loading from a data base struct MyClass { int get_value(void) const; private: void load_from_database(void); // Loads the data member from database. int m_value; }; int MyClass :: get_value(void) const { static bool value_initialized(false); if (!value_initialized) { // The compiler complains about this call because // the method is non-const and called from a const // method. load_from_database(); } return m_value; } My primitive solution is to declare the data member as mutable. I would rather not do this, because it suggests that other methods can change the member. How would I cast the load_from_database() statement to get rid of the compiler errors?

    Read the article

  • Is there an optimal way to render images in cocoa? Im using setNeedsDisplay

    - by Edward An
    Currently, any time I manually move a UIImage (via handling the touchesMoved event) the last thing I call in that event is [self setNeedsDisplay], which effectively redraws the entire view. My images are also being animated, so every time a frame of animation changes, i have to call setNeedsDisplay. I find this to be horrific since I don't expect iphone/cocoa to be able to perform such frequent screen redraws very quickly. Is there an optimal, more efficient way that I could be doing this? Perhaps somehow telling cocoa to update only a particular region of the screen (the rect region of the image)?

    Read the article

< Previous Page | 340 341 342 343 344 345 346 347 348 349 350 351  | Next Page >