Search Results

Search found 35387 results on 1416 pages for 'string substitution'.

Page 347/1416 | < Previous Page | 343 344 345 346 347 348 349 350 351 352 353 354  | Next Page >

  • In scala can I pass repeated parameters to other methods?

    - by Fred Haslam
    Here is something I can do in java, take the results of a repeated parameter and pass it to another method: public void foo(String ... args){bar(args);} public void bar(String ... args){System.out.println("count="+args.length);} In scala it would look like this: def foo(args:String*) = bar(args) def bar(args:String*) = println("count="+args.length) But this won't compile, the bar signature expects a series of individual strings, and the args passed in is some non-string structure. For now I'm just passing around arrays. It would be very nice to use starred parameters. Is there some way to do it?

    Read the article

  • spliiting code in java-don't know what's wrong [closed]

    - by ???? ?????
    I'm writing a code to split a file into many files with a size specified in the code, and then it will join these parts later. The problem is with the joining code, it doesn't work and I can't figure what is wrong! This is my code: import java.io.*; import java.util.*; public class StupidSplit { static final int Chunk_Size = 10; static int size =0; public static void main(String[] args) throws IOException { String file = "b.txt"; int chunks = DivideFile(file); System.out.print((new File(file)).delete()); System.out.print(JoinFile(file, chunks)); } static boolean JoinFile(String fname, int nChunks) { /* * Joins the chunks together. Chunks have been divided using DivideFile * function so the last part of filename will ".partxxxx" Checks if all * parts are together by matching number of chunks found against * "nChunks", then joins the file otherwise throws an error. */ boolean successful = false; File currentDirectory = new File(System.getProperty("user.dir")); // File[] fileList = currentDirectory.listFiles(); /* populate only the files having extension like "partxxxx" */ List<File> lst = new ArrayList<File>(); // Arrays.sort(fileList); for (File file : fileList) { if (file.isFile()) { String fnm = file.getName(); int lastDot = fnm.lastIndexOf('.'); // add to list which match the name given by "fname" and have //"partxxxx" as extension" if (fnm.substring(0, lastDot).equalsIgnoreCase(fname) && (fnm.substring(lastDot + 1)).substring(0, 4).equals("part")) { lst.add(file); } } } /* * sort the list - it will be sorted by extension only because we have * ensured that list only contains those files that have "fname" and * "part" */ File[] files = (File[]) lst.toArray(new File[0]); Arrays.sort(files); System.out.println("size ="+files.length); System.out.println("hello"); /* Ensure that number of chunks match the length of array */ if (files.length == nChunks-1) { File ofile = new File(fname); FileOutputStream fos; FileInputStream fis; byte[] fileBytes; int bytesRead = 0; try { fos = new FileOutputStream(ofile,true); for (File file : files) { fis = new FileInputStream(file); fileBytes = new byte[(int) file.length()]; bytesRead = fis.read(fileBytes, 0, (int) file.length()); assert(bytesRead == fileBytes.length); assert(bytesRead == (int) file.length()); fos.write(fileBytes); fos.flush(); fileBytes = null; fis.close(); fis = null; } fos.close(); fos = null; } catch (FileNotFoundException fnfe) { System.out.println("Could not find file"); successful = false; return successful; } catch (IOException ioe) { System.out.println("Cannot write to disk"); successful = false; return successful; } /* ensure size of file matches the size given by server */ successful = (ofile.length() == StupidSplit.size) ? true : false; } else { successful = false; } return successful; } static int DivideFile(String fname) { File ifile = new File(fname); FileInputStream fis; String newName; FileOutputStream chunk; //int fileSize = (int) ifile.length(); double fileSize = (double) ifile.length(); //int nChunks = 0, read = 0, readLength = Chunk_Size; int nChunks = 0, read = 0, readLength = Chunk_Size; byte[] byteChunk; try { fis = new FileInputStream(ifile); StupidSplit.size = (int)ifile.length(); while (fileSize > 0) { if (fileSize <= Chunk_Size) { readLength = (int) fileSize; } byteChunk = new byte[readLength]; read = fis.read(byteChunk, 0, readLength); fileSize -= read; assert(read==byteChunk.length); nChunks++; //newName = fname + ".part" + Integer.toString(nChunks - 1); newName = String.format("%s.part%09d", fname, nChunks - 1); chunk = new FileOutputStream(new File(newName)); chunk.write(byteChunk); chunk.flush(); chunk.close(); byteChunk = null; chunk = null; } fis.close(); System.out.println(nChunks); // fis = null; } catch (FileNotFoundException fnfe) { System.out.println("Could not find the given file"); System.exit(-1); } catch (IOException ioe) { System.out .println("Error while creating file chunks. Exiting program"); System.exit(-1); }System.out.println(nChunks); return nChunks; } } }

    Read the article

  • How do I guarantee row uniqueness in MySQL without the use of a UNIQUE constraint?

    - by MalcomTucker
    Hi I have some fairly simple requirements but I'm not sure how I implement them: I have multiple concurrent threads running the same query The query supplies a 'string' value - if it exists in the table, the query should return the id of the matching row, if not the query should insert the 'string' value and return the last inserted id The 'string' column is (and must be) a text column (it's bigger than varchar 255) so I cannot set it as unique - uniqueness must be enforced through the access mechanism The query needs to be in stored procedure format (which doesnt support table locks in MySQL) How can I guarantee that 'string' is unique? How can I prevent other threads writing to the table after another thread has read it and found no matching 'string' item? Thanks for any advice..

    Read the article

  • C# character counter when writing to new line

    - by Mike
    Basically i'm trying to read a really big text file and when the charecters of the line reach X amount write to a new line, but i can't seem to get the charecter count to work. Any help is appricated! using (FileStream fs = new FileStream(betaFilePath,FileMode.Open)) using (StreamReader rdr = new StreamReader(fs)) { while (!rdr.EndOfStream) { string betaFileLine = rdr.ReadLine(); int stringline = 0; if (betaFileLine.Contains("þTEMP")) { //sb.AppendLine(@"C:\chawkster\workfiles\New Folder\GEL_ALL_PRODUCTS_CONCORD2.DAT"); string checkline = betaFileLine.Length.ToString(); foreach (string cl in checkline) { stringline++; File.AppendAllText(@"C:\chawkster\workfiles\New Folder\GEL_ALL_PRODUCTS_CONCORD3.DAT", cl); if(stringline == 1200) { File.AppendAllText(@"C:\chawkster\workfiles\New Folder\GEL_ALL_PRODUCTS_CONCORD3.DAT","\n"); stringline = 0; } } } } foreach (string cl in checkline) Error 1 Cannot convert type 'char' to 'string'

    Read the article

  • Can you make an Extension Method Static/Shared?

    - by Matt Thrower
    OK, I've probably misunderstood something here but, as far as I can see ... An extension method has to be contained in a module, not a class You can't make methods in modules Static/Shared Therefore you can't use an extension method on a class without instantiating it. In other words you can't make an extension method on String called "MyExtensionMethod" and use: String.MyExtensionMethod("String") But instead .. Dim test As String test.MyExtensionMethod("string") Is this correct? Or is there a way I can get extension methods to work as static methods?

    Read the article

  • Full automatic application trace for .net v4

    - by JL
    I would like to implement a way to trace every line of code in an application that is written for .net v4.0. An example would be. If I had the following function. private bool hasValue(string value) { if(string.isnullorempty(value) { return false; } else { return true; }} Then when the function is called I want detailed trace logs to contain something like this: Function called |Line 10 |Signature private bool hasValue(string value)|ValuesPassed hasValue("") Line Evaluated | Line 11 | if(string.isnullorempty(value) |ValuesPassed if(string.isnullorempty("") - evaluation returned true entered line 13 |signature return false|return action taken. This tracing can be done manually, but its a lot of work, and would dirty the code. Isn't there a way to get this level of tracing automatically with .net or 3rd party plugin? Thank you

    Read the article

  • Why is the output like this?

    - by javatechi
    class another { public void method(Object o) { System.out.println("This is in method which takes object"); } public void method(String s) { System.out.println("This is method which takes string"); } } public class NewClass { public static void main(String args[]) { another an = new another(); an.method(null); } } When I try to execute this, I get This is method which takes string as the output. Why not "This is in method which takes object"? Object can also be null and string can also be null, why doesn't it invoke first method?

    Read the article

  • Perl: Greedy nature refuses to work

    - by faezshingeri
    I am trying to replace a string with another string, but the greedy nature doesn't seem to be working for me. Below is my code where "PERFORM GET-APLCY" is identified and replaced properly, but string "PERFORM GET-APLCY-SOI-CVG-WVR" and many other such strings are being replaced by the the replacement string for "PERFORM GET-APLCY". s/PERFORM $func[$i]\.?/# PERFORM $func[$i]\.\n $hash{$func[$i]}/g; where the full stop is optional during string match and replacement. Please help me understand what the issue could be. Thanks in advance, Faez

    Read the article

  • Why is the Dependency Property not returning its value?

    - by B-Rad
    I have a MyUserControl with the following Xaml: <TextBox Text="{Binding InputValueProperty}" /> In the MyUserControl.xaml.cs I have: public string InputValue { get { return (string)GetValue(InputValueProperty); } set { SetValue(InputValueProperty, value); } } public static readonly DependencyProperty InputValueProperty = DependencyProperty.Register("InputValueProperty", typeof(string), typeof(MyUserControl)); In my MainWindow.xaml I create a user control: <local:MyUserControl InputValue="My Input" /> Later on in my MainWindow.xaml.cs I am trying to access this string. All instances of MyUserControl are contained in a List and I access them with a foreach. string temp = userControl.InputValue; This is always null. In my MainWindow.xaml I can see the "My Input" in the text box of the user control but I can't ever seem to get it out of there.

    Read the article

  • Casting complex class into a dataset?

    - by iTayb
    This is the class I'm trying to turn into a dataset: public class BookStore { private List<Book> booksList; } public class Book { private string name; private string imageurl; private string subject; private string author; private int level; private int year; private int rating; private List<string> booksellers; private List<decimal> bookprices; } There are proprieties, of course. How can I turn it into a dataset? Thank you very much.

    Read the article

  • suppose there is a class which contains 4 data fields.i have to read these value from xml file and s

    - by SunilRai86
    suppose there is a class which contains 4 fields.i have to read these value from xml file and set that value to fields the xml file is like that <Root> <Application > <AppName>somevalue</AppName> <IdMark>somevalue</IdMark> <ClassName>ABC</ClassName> <ExecName>XYZ</ExecName> </Application> <Application> <AppName>somevalue</AppName> <IdMark>somevalue</IdMark> <ClassName>abc</ClassName> <ExecName>xyz</ExecName> </Application> </Root> now i have to read all the values from xml file and set each value to particular fields. i hav done reading of the xml file and i saved the retrieved value in arraylist. the code is like that public class CXmlFileHook { string appname; string classname; string idmark; string execname; string ctor; public CXmlFileHook() { this.appname = "Not Set"; this.idmark = "Not Set"; this.classname = "Not Set"; this.execname = "Not Set"; this.ctor = "CXmlFileHook()"; } public void readFromXmlFile(string path) { XmlTextReader oRreader = new XmlTextReader(@"D:\\Documents and Settings\\sunilr\\Desktop\\MLPACK.xml"); //string[] strNodeValues = new string[4] { "?","?","?","?"}; ArrayList oArrayList = new ArrayList(); while (oRreader.Read()) { if (oRreader.NodeType == XmlNodeType.Element) { switch (oRreader.Name) { case "AppName": oRreader.Read(); //strNodeValues[0] =oRreader.Value; oArrayList.Add(oRreader.Value); break; case "IdMark": oRreader.Read(); //strNodeValues[1] = oRreader.Value; oArrayList.Add(oRreader.Value); break; case "ClassName": oRreader.Read(); //strNodeValues[2] = oRreader.Value; oArrayList.Add(oRreader.Value); break; case "ExecName": oRreader.Read(); //strNodeValues[3] = oRreader.Value; oArrayList.Add(oRreader.Value); break; } } } Console.WriteLine("Reading from arraylist"); Console.WriteLine("-------------------------"); for (int i = 0; i < oArrayList.Count; i++) { //Console.WriteLine("Reading from Sting[]"+ strNodeValues[i]); Console.WriteLine(oArrayList[i]); } //this.appname = strNodeValues[0]; //this.idmark = strNodeValues[1]; //this.classname = strNodeValues[2]; //this.execname = strNodeValues[3]; this.appname = oArrayList[0].ToString(); this.idmark = oArrayList[1].ToString(); this.classname = oArrayList[2].ToString(); this.execname = oArrayList[3].ToString(); } static string vInformation; public void showCurrentState(string path) { FileStream oFileStream = new FileStream(path, FileMode.Append, FileAccess.Write); StreamWriter oStreamWriter = new StreamWriter(oFileStream); oStreamWriter.WriteLine("****************************************************************"); oStreamWriter.WriteLine(" Log File "); oStreamWriter.WriteLine("****************************************************************"); CXmlFileHook oFilehook = new CXmlFileHook(); //Type t = Type.GetType(this._classname); //Type t = typeof(CConfigFileHook); DateTime oToday = DateTime.Now; vInformation += "Logfile created on : "; vInformation += oToday + Environment.NewLine; vInformation += "Public " + Environment.NewLine; vInformation += "----------------------------------------------" + Environment.NewLine; vInformation += "Private " + Environment.NewLine; vInformation += "-----------------------------------------------" + Environment.NewLine; vInformation += "ctor = " + this.ctor + Environment.NewLine; vInformation += "appname = " + this.appname + Environment.NewLine; vInformation += "idmark = " + this.idmark + Environment.NewLine; vInformation += "classname = " + this.classname + Environment.NewLine; vInformation += "execname = " + this.execname + Environment.NewLine; vInformation += "------------------------------------------------" + Environment.NewLine; vInformation += "Protected" + Environment.NewLine; vInformation += "------------------------------------------------" + Environment.NewLine; oStreamWriter.WriteLine(vInformation); oStreamWriter.Flush(); oStreamWriter.Close(); oFileStream.Close(); } } here i set set the fields according to arraylist index but i dont want is there any another solution for this....

    Read the article

  • loop for Cursor1.moveToPosition() in android

    - by Edward Sullen
    I want to get data in the first column of all row from my database and convert to String[] ... List<String> item1 = new ArrayList<String>(); // c is a cursor which pointed from a database for(int i=0;i<=nombre_row;i++) { c.moveToPosition(i); item1.add(c.getString(0)); } String[] strarray = new String[item1.size()]; item1.toArray(strarray ); I've tried to command step by step, and found that the problem is in the Loop for.... Please help... thanks in advance for all answer.

    Read the article

  • case insensitive highlighting in php

    - by fusion
    i'm using this function to highlight the results from mysql query: function highlightWords($string, $word) { $string = str_replace($word, "<span class='highlight'>".$word."</span>", $string); /*** return the highlighted string ***/ return $string; } .... $cQuote = highlightWords(htmlspecialchars($row['cQuotes']), $search_result); the problem is, if i type in 'good', it will only show my search results with a lower-case 'g'ood and not 'Good'. how do i rectify this?

    Read the article

  • call method from main class, gives error

    - by user557039
    try to call method ss from class from it return me error, Blockquote Exception in thread "main" java.lang.NullPointerException at teste1.exp.ss(exp.java:16) at teste1.Main.main(Main.java:64) Java Result: 1 Blockquote <pre> public class Main { public static void main(String[] arguments) { ................... private static String[] ff; exp mega = new exp(); mega.ss(ff); } class exp { public void ss (String gvanswer[]){ String answer[] = new String[3]; answer[0] = "pacific "; answer[1] = "everest"; answer[2] = "amazon "; if (gvnswer[0].equals("pacific")) {System.out.println("eeeeeeeeeeeeee ");} if (gvanswer[1].equals(answer[1])){System.out.println("l ");} }

    Read the article

  • JPA Native Query (SQL View)

    - by Uchenna
    I have two Entities Customer and Account. @Entity @Table(name="customer") public class Customer { private Long id; private String name; private String accountType; private String accountName; ... } @Entity @Table(name="account") public class Account { private Long id; private String accountName; private String accountType; ... } i have a an sql query select a.id as account_id, a.account_name, a.account_type, d.id, d.name from account a, customer d Assumption account and customer tables are created during application startup. accountType and accountName fields of Customer entity should not be created. That is, only id and name columns will be created. Question How do i run the above sql query and return a Customer Entity Object with the accountType and accountName properties populated with sql query's account_name and account_type values. Thanks

    Read the article

  • Why does this MSDN example for Func<> delegate have a superfluous Select() call?

    - by Dan
    The MSDN gives this code example in the article on the Func Generic Delegate: Func<String, int, bool> predicate = ( str, index) => str.Length == index; String[] words = { "orange", "apple", "Article", "elephant", "star", "and" }; IEnumerable<String> aWords = words.Where(predicate).Select(str => str); foreach (String word in aWords) Console.WriteLine(word); I understand what all this is doing. What I don't understand is the Select(str => str) bit. Surely that's not needed? If you leave it out and just have IEnumerable<String> aWords = words.Where(predicate); then you still get an IEnumerable back that contains the same results, and the code prints the same thing. Am I missing something, or is the example misleading?

    Read the article

  • Passing parameters among views in a navigation frame INSIDE a custom control

    - by NetWriter
    I created a silverlight 3 application with a navigation frame and 3 views: search, add and edit. I used the app file to pass parameters among the 3 pages, eg: ((App)Application.Current).SNIPSELECTED = currentSnip; Then in the receiving page: currentSnip = ((App)Application.Current).SNIPSELECTED; currentSnip is a SnipItem object: public class SnipItem { public string itemID {get;set;} public string category {get;set;} public string itemDescription {get;set;} public string codeSnip {get;set;} } This worked fine until I decided to make this entire application into a user control and put that inside a second silverlight application with its own navigation frame and app file. The app files are getting confused. The first app file with all my parameter passing is not being read. I know how to pass a simple parameter between views in the first application without the app file (in a query string), but how about these custom types like my currentSnip above?

    Read the article

  • Is it bad practice to initialize a variable to a dummy value?

    - by froadie
    This question is a result of the answers to this question that I just asked. It was claimed that this code is "ugly" because it initializes a variable to a value that will never be read: String tempName = null; try{ tempName = buildFileName(); } catch(Exception e){ ... System.exit(1); } FILE_NAME = tempName; Is this indeed bad practice? Should one avoid initializing variables to dummy values that will never actually be used? (EDIT - And what about initializing a String variable to "" before a loop that will concatenate values to the String...? Or is this in a separate category? e.g. String whatever = ""; for(String str : someCollection){ whatever += str; } )

    Read the article

  • Methods specific only to an instance? What are they called in Ruby?

    - by daremarkovic
    I know there are "instance methods", "class methods" but what are these types of methods called, for eg: s1 = "This is my STRING!" def s1.m1 downcase end p s1 # => "This is my STRING!" p s1.m1 # => "this is my string!" What type of method is the "m1" method called on the s1 "instance" of the "string" class? It's really weird because I didn't know this was possible at all if I try: s2 = "This is ANOTHER string" s2.m1 # => Won't work! Which kind of makes sense, but not sure why defining methods like m1 on instances on a class are useful at all.

    Read the article

  • Generic Dictionary - Getting Conversion Error

    - by pm_2
    The following code is giving me an error: // GetDirectoryList() returns Dictionary<string, DirectoryInfo> Dictionary<string, DirectoryInfo> myDirectoryList = GetDirectoryList(); // The following line gives a compile error foreach (Dictionary<string, DirectoryInfo> eachItem in myDirectoryList) The error it gives is as follows: Cannot convert type 'System.Collections.Generic.KeyValuePair<string,System.IO.DirectoryInfo>' to 'System.Collections.Generic.Dictionary<string,System.IO.DirectoryInfo>’ My question is: why is it trying to perform this conversion? Can I not use a foreach loop on this type of object?

    Read the article

  • replace \n and \r\n with <br /> in java

    - by Bala R
    This has been asked several times for several languages but I can't get it to work. I have a string like this String str = "This is a string.\nThis is a long string."; And I'm trying to replace the \n with <br /> using str = str.replaceAll("(\r\n|\n)", "<br />"); but the \n is not getting replaced. I tried to use this RegEx Tool to verify and I see the same result. The input string does not have a match for "(\r\n|\n)". What am i doing wrong ?

    Read the article

  • USB device Set Attribute in C#

    - by p19lord
    I have this bit of code: DriveInfo[] myDrives = DriveInfo.GetDrives(); foreach (DriveInfo myDrive in myDrives) { if (myDrive.DriveType == DriveType.Removable) { string path = Convert.ToString(myDrive.RootDirectory); DirectoryInfo mydir = new DirectoryInfo(path); String[] dirs = new string[] {Convert.ToString(mydir.GetDirectories())}; String[] files = new string[] {Convert.ToString(mydir.GetFiles())}; foreach (var file in files) { File.SetAttributes(file, ~FileAttributes.Hidden); File.SetAttributes(file, ~FileAttributes.ReadOnly); } foreach (var dir in dirs) { File.SetAttributes(dir, ~FileAttributes.Hidden); File.SetAttributes(dir, ~FileAttributes.ReadOnly); } } } I have a problem. It is trying the code for Floppy Disk drive first which and because no Floppy disk in it, it threw the error The device is not ready. How can I prevent that?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Problem in populating a dictionary object using Enumerable.Range() (C#3.0)

    - by Newbie
    If I do for (int i = 0; i < appSettings.Count; i++) { string key = appSettings.Keys[i]; euFileDictionary.Add(key, appSettings[i]); } It is working fine. When I am trying the same thing using Enumerable.Range(0, appSettings.Count).Select(i => { string Key = appSettings.Keys[i]; string Value = appSettings[i]; euFileDictionary.Add(Key, Value); }).ToDictionary<string,string>(); I am getting a compile time error The type arguments for method 'System.Linq.Enumerable.Select(System.Collections.Generic.IEnumerable, System.Func)' cannot be inferred from the usage. Try specifying the type arguments explicitly. Any idea? Using C#3.0 Thanks

    Read the article

  • error message fix

    - by user1722654
    for (int i = 0; i < dataGridView1.Rows.Count; i++) { //bool sleected = false; if (dataGridView1.Rows[i].Cells[3].Value != null) { selected.Add(i); } } //string donew = ""; // line off error textBox1.Text = ((String)dataGridView1.Rows[1].Cells[2].Value); /* for (int i = 0; i < selected.Count; i++) { textAdded.Add((String)dataGridView1.Rows[0].Cells[2].Value); // donew += (String)dataGridView1.Rows[selected[i]].Cells[2].Value; }*/ I keep getting the error Unable to cast object of type 'System.Double' to type 'System.String' What can I do to overcome this?

    Read the article

< Previous Page | 343 344 345 346 347 348 349 350 351 352 353 354  | Next Page >