Search Results

Search found 29935 results on 1198 pages for 'open ldap'.

Page 349/1198 | < Previous Page | 345 346 347 348 349 350 351 352 353 354 355 356  | Next Page >

  • Bing Maps - how to link to a push pin from a link outside the map

    - by Rajah
    I have a Virtual Earth Maps (Bing Maps??) to which I have added a set of pushpins. Each pushpin is labelled 1 to n. In addition to adding pushpins to the map, I also add text to the web-page that contains the description to each pushpin. I would like to add a link to the text outside the map, that when clicked will open the balloon associated with the corresponding pushpin. How do I open the balloon associated with a pushpin, through a link that exists outside the map? To get a better understanding, look at my map: link. When you click load, PushPins are added to the map. I would like to have a link from the list on the right of the map, that opens the corresponding PushPin. Thanks in advance!

    Read the article

  • I keep getting a "System InvalidOperationException occurred in System Windows Forms dll" error in VB

    - by Heartrent
    I've just started learning VB.NET with VS 9.0; a small application I'm working on keeps returning an "A first chance exception of type System InvalidOperationException occurred in System Windows Forms dll" error from the Immediate Window. The application has almost zero functionality so far, it consists of a menu strip with: File About |Open |Save |Save As |Quit The only code I have written opens an Open File dialog, a Save As dialog, an About window with background sound and an OK button, and the Quit button which exits. Since there is almost no code for me to search through, I can't understand why there would be an error. The program runs just fine when I'm debugging it too.

    Read the article

  • known memory leaks in 3ds max?

    - by Denise
    I've set up a script in 3ds max to render a bunch of animations into frames. To do this, I open up a file with all of the materials, load an animation (as a bip) onto the figure, then render. We were seeing a problem where eventually the script would fail because it was unable to open the next file-- max had consumed all of the system memory. Closing max, of course, freed the memory, and we were able to continue with the script. I checked out the heapfree variable, hoping to see a memory leak within my script, hoping to see a memory leak within my own (maxscript) code-- but the amount of free space was the same after every animation. Then, it must be 3ds max which is consuming all of that memory. Nothing in max need be saved from animation to animation-- is there some way to get max to free that memory? (I've tried resetMaxFile() and manually deleting all of the objects in the scene). Is there any known sets of operations that cause max to grow out of control?

    Read the article

  • flex combobox hide and show down arrow

    - by crazy horse
    I am looking to implement a search text box as follows: When user starts typing in and there are non-zero results, the text box will open up and display the results below it. When the user selects a result, the text box closed, but this time with a down-arrow (like a combobox) so that the user can re-open the list. I suspect what I really need is a combobox with ability to hide/show the down arrow. How do I do this in Flex? Thanks in advance.

    Read the article

  • jquery boxy plugin: prevent multiple instances of the same dialog when clicking the link multiple ti

    - by Lyon
    Hi, I'm using the Boxy jQuery plugin to open dialog windows and populating it through ajax. http://onehackoranother.com/projects/jquery/boxy/ Here's my code so far: $("a.create").click(function (e) { url = $(e.target).attr('href'); Boxy.load(url, {title:'Test'}); }); This opens up a dialog alright. However, if I click the link again, another dialog will open. How can I make it such that the previously opened Boxy dialog will come into focus? I only want one instance of this dialog. I tried assigning a variable to var ele = Boxy.load(); but the variable ele returns undefined... Alas, I can't make out much from the limited Boxy documentation available. Enabling the option modal: true would prevent the user from clicking on the link multiple times, but I don't want the overlay to show. Thanks for any light you can shed on this. -Lyon

    Read the article

  • C# file Decryption - Bad Data

    - by Jon
    Hi all, I am in the process of rewriting an old application. The old app stored data in a scoreboard file that was encrypted with the following code: private const String SSecretKey = @"?B?n?Mj?"; public DataTable GetScoreboardFromFile() { FileInfo f = new FileInfo(scoreBoardLocation); if (!f.Exists) { return setupNewScoreBoard(); } DESCryptoServiceProvider DES = new DESCryptoServiceProvider(); //A 64 bit key and IV is required for this provider. //Set secret key For DES algorithm. DES.Key = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Set initialization vector. DES.IV = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Create a file stream to read the encrypted file back. FileStream fsread = new FileStream(scoreBoardLocation, FileMode.Open, FileAccess.Read); //Create a DES decryptor from the DES instance. ICryptoTransform desdecrypt = DES.CreateDecryptor(); //Create crypto stream set to read and do a //DES decryption transform on incoming bytes. CryptoStream cryptostreamDecr = new CryptoStream(fsread, desdecrypt, CryptoStreamMode.Read); DataTable dTable = new DataTable("scoreboard"); dTable.ReadXml(new StreamReader(cryptostreamDecr)); cryptostreamDecr.Close(); fsread.Close(); return dTable; } This works fine. I have copied the code into my new app so that I can create a legacy loader and convert the data into the new format. The problem is I get a "Bad Data" error: System.Security.Cryptography.CryptographicException was unhandled Message="Bad Data.\r\n" Source="mscorlib" The error fires at this line: dTable.ReadXml(new StreamReader(cryptostreamDecr)); The encrypted file was created today on the same machine with the old code. I guess that maybe the encryption / decryption process uses the application name / file or something and therefore means I can not open it. Does anyone have an idea as to: A) Be able explain why this isn't working? B) Offer a solution that would allow me to be able to open files that were created with the legacy application and be able to convert them please? Thank you

    Read the article

  • Can I change the user id of a user on one Linux server to match another server in /etc/passwd?

    - by user76177
    I have a Rails application that is on a virtual machine (RHEL 6) and it's database is on dedicated hardware (also RHEL 6). The app server has an NFS directory from the db server mounted and accessible. It needs to write images to that server that are uploaded via the app. Background processes on the db server need to read and write to the same directory, as they perform resizing operations on the uploaded files. Right now none of this is working, because the user ids are different between the two systems. I only need this to work for this one application, so it is way too much overhead to put an LDAP system in place. Can I simply change the user id of this one user in one of the systems, or will that cause mass chaos? UPDATE: The fix worked, at least on local devices. Unfortunately the device I have mounted to the main db server still thinks my user id is 502 instead of 506. Do I need to remount that device, or is there an NFS daemon I can stop and restart to refresh it?

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Making OpenSSL work on PHP Windows 2008 server with FastCGI

    - by KacieHouser
    I have been researching all day. Here is what I have done: In C:/PHP/php.ini and C:/PHP/php-cgi-fcgi.ini I have made the extension_dir = "C:/PHP/ext" I uncommented extension=php_openssl.dll I went to http://windows.php.net/download/ and got the thread safe version with the PHP 5.4 (5.4.8) version of DLL's In C:/PHP/ext I replaced the php_openssl.dll with the one I downloaded In System32 and SysWOW64 I added the following DLL's ssleay.dll libeay.dll I restarted the IIS server in the Server Manager under Web Server and stopped and started the World Wide Web Publishing Service That didn't work, so I tried same thing with the unthreaded versions. I still get: Fatal error: Call to undefined function ftp_ssl_connect() in C:\inetpub\wwwroot\REMOVED_dev\save_data.php on line 5 Here are related things from phpinfo(): System Windows NT DEV-WEB1 6.1 build 7601 (Windows Server 2008 R2 Standard Edition Service Pack 1) i586 Compiler MSVC9 (Visual C++ 2008) Architecture x86 Configure Command cscript /nologo configure.js "--enable-snapshot-build" "--enable-debug-pack" "--disable-zts" "--disable-isapi" "--disable-nsapi" "--without-mssql" "--without-pdo-mssql" "--without-pi3web" "--with-pdo-oci=C:\php-sdk\oracle\instantclient10\sdk,shared" "--with-oci8=C:\php-sdk\oracle\instantclient10\sdk,shared" "--with-oci8-11g=C:\php-sdk\oracle\instantclient11\sdk,shared" "--with-enchant=shared" "--enable-object-out-dir=../obj/" "--enable-com-dotnet" "--with-mcrypt=static" "--disable-static-analyze" "--with-pgo" Server API CGI/FastCGI Configuration File (php.ini) Path C:\Windows Loaded Configuration File C:\PHP\php-cgi-fcgi.ini Scan this dir for additional .ini files (none) Additional .ini files parsed (none) Registered PHP Streams php, file, glob, data, http, ftp, zip, compress.zlib, compress.bzip2, https, ftps, sqlsrv, phar Registered Stream Socket Transports tcp, udp, ssl, sslv3, sslv2, tls FTP support enabled Protocols dict, file, ftp, ftps, gopher, http, https, imap, imaps, ldap, pop3, pop3s, rtsp, scp, sftp, smtp, smtps, telnet, tftp openssl OpenSSL support enabled OpenSSL Library Version OpenSSL 0.9.8t 18 Jan 2012 OpenSSL Header Version OpenSSL 0.9.8x 10 May 2012 What am I missing here?

    Read the article

  • Issues resolving DNS entries for multi-homed servers

    - by I.T. Support
    This is difficult to explain, so bear with me. We have 2 domain controllers, each multi-homed to straddle 2 internal subnets, (subnet A and subnet B) and provide dns, dhcp, and ldap authentication. Both domain controllers each have 2 DNS entries. both entries have identical host names, but correspond to subnet A & subnet B respectively (example entries shown): dc1 host 192.168.8.1 dc1 host 192.168.9.1 dc2 host 192.168.8.2 dc2 host 192.168.9.2 We also have a 3rd subnet for our dmz, (subnet C) which neither domain controller has an IP address on, but our firewall/routing tables provide access to subnet A from subnet C and vice versa, but don't allow access to subnet B from subnet C. Here's my issue. How can I force/determine which dns entry is used when a server on subnet C queries either domain controller by host name? Right now it seems to randomly pick one of the two entries, swaps out the name for the IP address and that's that. The problem is if it randomly selects the entry that corresponds to the 9.x subnet B (no access from subnet C), then the server fails to resolve. If it picks the entry for the 8.x subnet A then it resolves (firewall/routing tables defined for communication between these 2 subnets) Here's what I'd like to know: What are Best Practices (if any) for dealing with DNS resolution on subnets that the DNS servers don't have a presence on? Can I control something akin to a metric value to force an order of DNS resolution when there are multiple entries for the same host name that correspond to different IP subnets? Should I even have 2 DNS HOST entries for the same name? Here's what I'd like to avoid: Making edits to the HOSTS files of servers on subnet C to force DNS resolution of the hostname to the appropriate subnet Adding NIC's to the DC's to have them straddle the DMZ as well, thus obtaining a third DNS entry that corresponds to subnet C Again, my apologies if this was too verbose / unclear. Thanks!

    Read the article

  • Dynamically add Server 2008 NLB Nodes

    - by Nick Jacques
    Hi All, I have a small NLB cluster for Terminal Servers. One of the things we're looking at doing for this particular project (this is for a college class) is dynamically creating Terminal Servers. What we've done is create policies for a certain OU, that sets the proper TS Farm properties and installs the Terminal Server role and NLB feature. Now what we'd like to do is create a script to be run on our Domain Controller to add hosts to the preexisting NLB cluster. On our Server 2008 R2 Domain Controller, I was thinking of running the following PowerShell script I've kind of hacked together. Any thoughts on if this will work? Is there any way I can trigger this script to run on the DC once all the scripts to install roles are done on the various Terminal Servers? Thanks very much in advance!! Import-Module NetworkLoadBalancingClusters $TermServs = @() $Interface = "Local Area Connection" $ou = [ADSI]"LDAP://OU=Term Servs,DC=example,DC=com" foreach ($child in $ou.psbase.Children) { if ($child.ObjectCategory -like '*computer*') {$TermServs += $child.Name} } foreach ($TS in $TermServs) { Get-NlbCluster 172.16.0.254 | Add-NlbClusterNode -NewNodeName $TS -NewNodeInterface $Interface }

    Read the article

  • Calling a .NET web service (WSE 3.0, WS-Security) from JAXWS-RI

    - by elduff
    I'm writing a JAXWS-RI client that must call a .NET Web Service that is using WS-Security. The service's WSDL does not contain any WS-Security info, but I have an example soap message from the service's authors and know that I must include wsse:Security headers, including X:509 tokens. I've been researching, and I've seen example of folks calling this type of web service from Axis and CXF (in conjunction with Rampart and/or WSS4J), but nothing about using plain JAXWS-RI itself. However, I'm (unfortunately) constrained to using JAXWS-RI by my gov't client. Does anyone have any examples/documentation of doing this from JAXWS-RI? I need to ultimately generate a SOAP header that looks something like the one below - this is a sample soap:header from a .NET client written by the service's authors. (Note: I've put the 'VALUE_HERE' string in places where I need to provide my own values) <soapenv:Envelope xmlns:iri="http://EOIR/IRIES" xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xenc="http://www.w3.org/2001/04/xmlenc#"> <soapenv:Header xmlns:wsa="http://www.w3.org/2005/08/addressing"> <wsse:Security xmlns:wsse="http://docs.oasis-open.org/wss/2004/01/oasis-200401- wss-wssecurity-secext-1.0.xsd"> <xenc:EncryptedKey Id="VALUE_HERE"> <xenc:EncryptionMethod Algorithm="http://www.w3.org/2001/04/xmlenc#rsa-oaep-mgf1p"/> <ds:KeyInfo xmlns:ds="http://www.w3.org/2000/09/xmldsig#"> <wsse:SecurityTokenReference> <wsse:KeyIdentifier EncodingType="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-soap-message-security-1.0#Base64Binary" ValueType="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-x509-token-profile-1.0#X509v3"> VALUE_HERE </wsse:KeyIdentifier> </wsse:SecurityTokenReference> </ds:KeyInfo> <xenc:CipherData> <xenc:CipherValue>VALUE_HERE</xenc:CipherValue> </xenc:CipherData> <xenc:ReferenceList> <xenc:DataReference URI="#EncDataId-8"/> </xenc:ReferenceList> </xenc:EncryptedKey> </wsse:Security>

    Read the article

  • Why is LOGON_USER Server Variable is blank on New Windows / New Tab?

    - by Alex Papadimoulis
    We are noticing some very strange behavior on an installation of a .NET2-based webapp on Server 2008. Our app uses "old school" Integrated Windows Authentication and simply reads the LOGIN_USER server variable from the request collection. There's a good reason for this, but that's somewhat irrelevant to the question, since the underlying WindowsAuthentication code from ASP.NET does the same thing. Anyway... When you enter the URL in the browser, it loads up just fine and displays the username (from LOGIN_USER) no problem. When you click on a link within the web app, it loads the page just fine and authenticates without any problems. When you "hard refresh" (Ctrl-F5) it also works just fine. However, when you click "open in a new window" or "open in a new tab", the LOGON_USER variable is blank Any ideas? Am I missing some IIS7 setting somewhere? Tested clients are Windows 7 with IE8 or Windows XP with IE6.

    Read the article

  • which ASP.NET hosting site allows listening on different ports than 80 and uses .NET 4?

    - by ijjo
    I'm trying to take advantage of HTML 5 web sockets in .NET and the easiest way appears to be something like what this guy does. I've already tested this myself and it works great, but there are a few problems if I try to deploy this to my hosting site (discountasp.net). Basically, I am not allowed to open up a port on 8080 and listen on it. I then tried to figure out a way to listen on port 80 with IIS as well, but using the HTTPListener, I run into sercurity issues as well. This doesn't seem like it will help since I can't mess with this stuff on the hosting site server either. So to make my life easier, I think I need to find a hosting site that simply allows me to open up a socket on port 8080 and listen on it. Anyone know of one? Or does anyone know of a workaround (besides sniffing all the traffic on port 80)?

    Read the article

  • Postfix installation error on Ubuntu

    - by kgpdeveloper
    How do I fix this error on Ubuntu 10.04 ? Reading package lists... Done Building dependency tree Reading state information... Done postfix is already the newest version. The following packages were automatically installed and are no longer required: libaprutil1-dbd-sqlite3 libcap2 apache2.2-bin libapr1 libaprutil1-ldap libaprutil1 php5-common Use 'apt-get autoremove' to remove them. 0 upgraded, 0 newly installed, 0 to remove and 1 not upgraded. 1 not fully installed or removed. After this operation, 0B of additional disk space will be used. Setting up postfix (2.7.0-1) ... Postfix configuration was not changed. If you need to make changes, edit /etc/postfix/main.cf (and others) as needed. To view Postfix configuration values, see postconf(1). After modifying main.cf, be sure to run '/etc/init.d/postfix reload'. Running newaliases newaliases: warning: valid_hostname: numeric hostname: 202002 newaliases: fatal: file /etc/postfix/main.cf: parameter myhostname: bad parameter value: 202002 dpkg: error processing postfix (--configure): subprocess installed post-installation script returned error exit status 75 Processing triggers for libc-bin ... ldconfig deferred processing now taking place Errors were encountered while processing: postfix E: Sub-process /usr/bin/dpkg returned an error code (1) Even if I reboot, the same error shows up. Thanks for the help..

    Read the article

  • gdb+osx: no output when using printf/CFShow

    - by yairchu
    I attached to a program with gdb in OSX and I want to use CFShow in the gdb console etc. However, nothing shows up. printf shows nothing as well: (gdb) call (int) printf("Hello\n") $10 = 6 (gdb) call (int) printf("Hello World!\n") $11 = 13 Apple suggests the following tip for when attaching with gdb, to make the output appear in the gdb console: (gdb) call (void) close(1) (gdb) call (void) close(2) (gdb) shell tty /dev/ttyp1 (gdb) call (int) open("/dev/ttyp1", 2, 0) $1 = 1 (gdb) call (int) open("/dev/ttyp1", 2, 0) $2 = 2 In xcode's gdb console tty gives "not a tty", so I tried it in gdb in a terminal. There tty does work but after redirecting stdout there's still no output. Also no output if I direct stdout to a file.. :/ Any salvation?

    Read the article

  • How do you fix an SVN 409 Conflict Error

    - by NerdStarGamer
    I used to use SVN 1.4 on OS X Leopard and everything was fine. A couple of weeks ago I installed a fresh copy of OS X 10.6. The version of SVN that comes with Snow Leopard is 1.6.5. I went ahead and built my own copy with 1.6.6. I'm using the built in apache server and just hosting repositories locally. Everything appeared to work fine until I actually tried to commit something. Everytime I try to commit a change, I get the following message: Transmitting file data .svn: Commit failed (details follow): svn: MERGE of '/svn/svn2': 409 Conflict (http://localhost) This happens with my old repositories, so I created a couple of new ones. Same deal. I also tried using the 1.6.5 version that comes with the system...same. Finally, I tried upgrading to the latest stable SVN (1.6.9) and still got the same problem. The Apache error logs the following for each failed commit: [Mon Mar 29 19:53:10 2010] [error] [client ::1] Could not MERGE resource "/svn/svn2/!svn/act/d399326f-c20f-424f-bb68-3bb40503b5b1" into "/svn/svn2". [409, #0] [Mon Mar 29 19:53:10 2010] [error] [client ::1] An error occurred while committing the transaction. [409, #2] [Mon Mar 29 19:53:10 2010] [error] [client ::1] Can't open directory '/usr/local/svn/svn2/db/transactions/5-6.txn/\xeb\xa9\x0f\x1f': No such file or directory [409, #2] [Mon Mar 29 19:53:11 2010] [error] [client ::1] Could not DELETE /svn/svn2/!svn/act/d399326f-c20f-424f-bb68-3bb40503b5b1. [500, #0] [Mon Mar 29 19:53:11 2010] [error] [client ::1] could not open transaction. [500, #2] [Mon Mar 29 19:53:11 2010] [error] [client ::1] Can't open file '/usr/local/svn/svn2/db/transactions/5-6.txn/props': No such file or directory [500, #2] And from the access log: ::1 - - [30/Mar/2010:13:02:20 -0400] "OPTIONS /svn/svn2 HTTP/1.1" 401 401 ::1 - user [30/Mar/2010:13:02:20 -0400] "OPTIONS /svn/svn2 HTTP/1.1" 200 188 ::1 - user [30/Mar/2010:13:02:20 -0400] "PROPFIND /svn/svn2 HTTP/1.1" 207 647 ::1 - user [30/Mar/2010:13:02:20 -0400] "PROPFIND /svn/svn2 HTTP/1.1" 207 647 ::1 - user [30/Mar/2010:13:02:20 -0400] "PROPFIND /svn/svn2/!svn/vcc/default HTTP/1.1" 207 398 ::1 - user [30/Mar/2010:13:02:20 -0400] "PROPFIND /svn/svn2/!svn/bln/6 HTTP/1.1" 207 449 ::1 - user [30/Mar/2010:13:02:20 -0400] "REPORT /svn/svn2/!svn/vcc/default HTTP/1.1" 200 1172 Curiously, the commit does actually commit the changes, but the working copy doesn't see that and everything gets screwy. I've tried to Google every variation I can think of for this problem, but the search results are pretty much useless. I'm not using TortoiseSVN or anything special and commits fail on a new repository, so I know it's not a problem with my old repos. Any help would be greatly appreciated.

    Read the article

  • Installing fonts

    - by Lazar
    I have "white nights" trying to install Hebrew/Arabic fonts on my level 7 (API 2.1) aka Nexus emulator. I can't understand why Google guys will want to waist my skills do something helpful for the community using Hebrew/Arabic fonts. After rw mount/remount I can do it for level 3 devices, but for Nexus - nada! Why? What can be done? Real devices guys already broke this peace of hardware, but I am sitting and looking wide eyes open like a sheep. Please make me happy and give the chance to install the fonts. That's what must be done for some of us: We need system image saved on exit for tomorrow to continue the work Open emulator to work in peace cp command included with the SDK. Thanks for any help

    Read the article

  • Python urllib.urlopen IOError

    - by Michael
    So I have the following lines of code in a function sock = urllib.urlopen(url) html = sock.read() sock.close() and they work fine when I call the function by hand. However, when I call the function in a loop (using the same urls as earlier) I get the following error: > Traceback (most recent call last): File "./headlines.py", line 256, in <module> main(argv[1:]) File "./headlines.py", line 37, in main write_articles(headline, output_folder + "articles_" + term +"/") File "./headlines.py", line 232, in write_articles print get_blogs(headline, 5) File "/Users/michaelnussbaum08/Documents/College/Sophmore_Year/Quarter_2/Innovation/Headlines/_code/get_content.py", line 41, in get_blogs sock = urllib.urlopen(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 87, in urlopen return opener.open(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 203, in open return getattr(self, name)(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 314, in open_http if not host: raise IOError, ('http error', 'no host given') IOError: [Errno http error] no host given Any ideas?

    Read the article

  • Serial Mac OS X constantly freezes/locks/dissappears for USB to Arduino

    - by Niraj D
    I have a problem with my C++ code running in Xcode with both the AMSerial library as well as the generic C (ioctl, termios). After a fresh restart, my application works well but after I "kill" the program the Serial (I think) is not released. I have checked my open files under /dev and have killed the connection to serial USB from there, but my C++ still can't open the USB port. I have narrowed this down to being a low level Mac OS X issue, regarding blocking the port indefinitely, regardless of closing it using the aforementioned libraries. Just for context, I'm trying to send numbers through my USB port, serially to an Arduino Duemilanove at 9600 baud. Running Serial Monitor in Arduino is perfectly fine, however, running through a C++ application it freezes up my computer, occasionally, my mouse/keyboard freeze up: requiring a hard reset. How can this problem be fixed? It seems like Mac OS X is not USB friendly!

    Read the article

  • Using VLANs/subnetting to separate management from services?

    - by YouAreTheHat
    Background: I recently purchased a server and a managed switch for my home in the hopes of getting more experience and some fun toys to play with. The devices and appliances I either have or plan to have cover a broad spectrum: router, DD-WRT AP, Dell switch, OpenLDAP server, FreeRADIUS server, OpenVPN gateway, home PCs, gaming consoles, etc. I intend to segment my network with VLANs and associated subnets (e.g., VID10 is populated by devices on 192.168.10.0/24). The idea is to secure the more sensitive appliances by forcing traffic through my router/FW. Setup: After thinking and planning for some time, I have tentatively decided on 4 VLANs: one for the WAN connection, one for servers, one for home/personal devices, and one for management. In theory, the home VLAN will have limited access to the servers, and the management VLAN will be totally isolated for security. Question: Since I want to restrict access to management interfaces, but some appliances have to be accessible to other devices, is it possible/wise to have only management (SSH, HTTP, RDP) available on one VLAN/IP and only services (LDAP, DHCP, RADIUS, VPN) available on other? Is this a thing that is done? Does it gain me the security I think it does, or hurt me in some way?

    Read the article

  • NETWORK_ERROR: XMLHttpRequest Exception 101

    - by pawan Mangal
    I am getting this Error NETWORK_ERROR: XMLHttpRequest Exception 101 when trying to get XML content from one site. Here is my code var xmlhttp; if(window.XMLHttpRequest) { xmlhttp = new XMLHttpRequest(); } if (xmlhttp==null) { alert ("Your browser does not support XMLHTTP!"); return; } xmlhttp.onReadyStateChange=function() { if(xmlhttp.readyState==4) { var value =xmlhttp.responseXML; alert(value); } } xmlhttp.open("GET",url,false); xmlhttp.send(); //alert(xmlhttp.responseXML); } xmlhttp.open("GET",url,false); xmlhttp.send(null); Does any one have a solution?

    Read the article

  • which asp net hosting site allows to listen on differnt port than 80 and uses .net 4?

    - by ijjo
    i'm trying to take advantage of html 5 web sockets in .NET and the easiest way appears to do something like this guy does: http://www.codeproject.com/KB/webservices/c_sharp_web_socket_server.aspx?msg=3485900#xx3485900xx i've already tested this myself and it works great, but there are a few problems if i try to deploy this to my hosting site (discountasp.net). basically i am not allowed to open up a port on 8080 and listen on it. i then tried to figure out a way to listen non port 80 with IIS as well, but using the HTTPListener runs into sercurity issues as well that doesn't seem like will help since i can't mess with this stuff on the hosting site server either: http://stackoverflow.com/questions/169904/can-i-listen-on-a-port-using-httplistener-or-other-net-code-on-vista-without-r so to make my life easier, i think i need to find a hosting site that simply allows me to open up a socket on port 8080 and listen on it. anyone know of one? or anyone know of a workaround (besides sniffing ALL the traffic on port 80)?

    Read the article

  • Why isn't my assets folder being installed on emulator?

    - by Brad Hein
    Where are my assets being installed to? I utilize an assets folder in my new app. I have two files in the folder. When I install my app on the emulator, I cannot access my assets, and furthermore I cannot see them on the emulator filesystem. Extracted my apk and confirmed the assets folder exists: $ ls -ltr assets/ total 16 -rw-rw-r--. 1 brad brad 1050 2010-05-20 00:33 schema-DashDB.sql -rw-rw-r--. 1 brad brad 9216 2010-05-20 00:33 dash.db On the emulator, no assets folder: # pwd /data/data/com.gtosoft.dash # ls -l drwxr-xr-x system system 2010-05-20 00:46 lib # I just want to package a pre-built database with my app and then open it to obtain data when needed. Just tried it on my Moto Droid, unable to access/open the DB, just like the emulator: DBFile=/data/data/com.gtosoft.dash/assets/dash.db Building the DB on the fly from a schema file is out of the question because its such a slow process (about 5-10 statements per second is all I get for throughput).

    Read the article

< Previous Page | 345 346 347 348 349 350 351 352 353 354 355 356  | Next Page >