Search Results

Search found 7716 results on 309 pages for 'target audience'.

Page 35/309 | < Previous Page | 31 32 33 34 35 36 37 38 39 40 41 42  | Next Page >

• MSBuild: convert relative path in imported project to absolute path.

  - by Ergwun

  Short version: I have an MSBuild project that imports another project. There is a property holding a relative path in the imported project that is relative to the location of the imported project. How do I convert this relative path to be absolute? I've tried the ConvertToAbsolutePath task, but this makes it relative to the importing project's location). Long version: I'm trying out Robert Koritnik's MSBuild task for integrating nunit output into Visual Studio (see this other SO question for a link). Since I like to have all my tools under version control, I want the target file with the custom task in it to point to the nunit console application using a relative path. My problem is that this relative path ends up being made relative to the importing project. E.g. (in ... MyRepository\Third Party\NUnit\MSBuild.NUnit.Task.Source\bin\Release\MSBuild.NUnit.Task.Targets): ... <PropertyGroup Condition="'$(NUnitConsoleToolPath)' == ''"> <NUnitConsoleToolPath>..\..\..\NUnit 2.5.5\bin\net-2.0</> </PropertyGroup> ... <Target Name="IntegratedTest"> <NUnitIntegrated TreatFailedTestsAsErrors="$(NUnitTreatFailedTestsAsErrors)" AssemblyName="$(AssemblyName)" OutputPath="$(OutputPath)" ConsoleToolPath="$(NUnitConsoleToolPath)" ConsoleTool="$(NUnitConsoleTool)" /> </Target> ... The above target fails with the error that the file cannot be found (that is the nunit-console.exe file). Inside the NUnitIntegrated MSBuild task, when the the execute() method is called, the current directory is the directory of the importing project, so relative paths will point to the wrong location. I tried to convert the relative path to absolute by adding these tasks to the IntegratedTest target: <ConvertToAbsolutePath Paths="$(NUnitConsoleToolPath)"> <Output TaskParameter="AbsolutePaths" PropertyName="AbsoluteNUnitConsoleToolPath"/> </ConvertToAbsolutePath> but this just converted it to be relative to the directory of the project file that imports this target file. I know I can use the property $(MSBuildProjectDirectory) to get the directory of the importing project, but can't find any equivalent for directory of the imported target file. Can anyone tell me how a path in an imported file that is supposed to be relative to the directory that the imported file is in can be made absolute? Thanks!

  Read the article

• XCode linking error when targeting armv7.

  - by Tom

  I've already spent countless hours puzzling over this, utilizing Google searches and other Stack Overflow questions to no avail. I have an iPhone/iPad universal application, which seems to compile fine when the target is armv6. However, when the device is iPad, I get this warning: warning: building for SDK 'Device - iPhone OS 3.2' requires an armv7 architecture. Oddly enough, the app still runs great on iPad in spite of this warning. However, I do want to do things the "right way" what ever that means in this case. When I switch the target architecture to armv7, I get linking errors: "___restore_vfp_d8_d15_regs", referenced from: *redacted* "___save_vfp_d8_d15_regs", referenced from: *redacted* ld: symbol(s) not found collect2: ld returned 1 exit status The "redacted" portions of the errors are references to the static library to which I'm trying to link. Here's what I've tried from the many suggestions online. Each of these were suggested more than once without any explanation, which leads me to believe nobody quite understands this problem: "Never use the drop down menu in the upper left of the XCode window to choose the target. Instead, set this to Base SDK and then the Base SDK to iPhone OS 3.0 in the target configuration. Set the target device to your preferred target (iPad, iPhone OS 3.2 in my situation.)" This yields the error "Library not found for -lcrt1.3.1.o" "Make sure that GCC isn't linking against the wrong version of the standard library. (You'll have to make sure the LIBRARY_SEARCH_PATH doesn't have the wrong path in it.)" My LIBRARY_SEARCH_PATH is already empty, so this doesn't seem relevant. "Try compiling with GCC 4.0 rather than GCC 4.2." I get a syntax error inside a UIKit header file. The error is "Syntax error before 'AT_NAME' token." The line is "UIKIT_EXTERN @interface UILocalizedIndexedCollation : NSObject." Another project compiles just fine with the same target settings, which is really making me question my sanity. Could I be dealing with a corrupt XCode project? If anyone knows what's actually happening and has a reference or doesn't mind explaining it, I would be so very grateful. Cheers!

  Read the article

• MSBuild command-line error - Silverlight 4 SDK is not installed

  - by Ned

  My MSBuild command line is as follows: msbuild e:\code\myProject.csproj /p:Configuration=Debug /p:OutputPath=bin/Debug /p:Platform=x86 /p:PlatformTarget=x86 The project builds fine on my development machine in VS2010 but not with the command above. I am running Win 7 64 - Bit. I'm getting an error that says I don't have the Silverlight 4 SDK installed but I do. I"ve read some posts that you have to set the Platform=x86 but to no avail. Here is the error message in full: Microsoft (R) Build Engine Version 4.0.30319.1 [Microsoft .NET Framework, Version 4.0.30319.1] Copyright (C) Microsoft Corporation 2007. All rights reserved. Build started 6/8/2010 4:03:38 PM. Project "E:\code\dashboards\MyProject2010\MyProject2010.Web\MyProject2010 .web.csproj" on node 1 (default targets). GenerateTargetFrameworkMonikerAttribute: Skipping target "GenerateTargetFrameworkMonikerAttribute" because all output fi les are up-to-date with respect to the input files. CoreCompile: Skipping target "CoreCompile" because all output files are up-to-date with resp ect to the input files. CopyFilesToOutputDirectory: Copying file from "obj\Debug\MyProject.Web.dll" to "bin\Debug\MyProject.Web .dll". MyProject2010.web - E:\code\dashboards\MyProject2010\MyProject2010.Web \bin\Debug\MyProject.Web.dll Copying file from "obj\Debug\MyProject.Web.pdb" to "bin\Debug\MyProject.Web .pdb". Project "E:\code\dashboards\MyProject2010\MyProject2010.Web\MyProject2010 .web.csproj" (1) is building "E:\code\dashboards\MyProject2010\MyProject20 10.Client\MyProject2010.Client.csproj" (2) on node 1 (GetXapOutputFile target( s)). C:\Program Files (x86)\MSBuild\Microsoft\Silverlight\v4.0\Microsoft.Silverlight .Common.targets(104,9): error : The Silverlight 4 SDK is not installed. [E:\cod e\dashboards\MyProject2010\MyProject2010.Client\MyProject2010.Client.cspr oj] Done Building Project "E:\code\dashboards\MyProject2010\MyProject2010.Clie nt\MyProject2010.Client.csproj" (GetXapOutputFile target(s)) -- FAILED. Done Building Project "E:\code\dashboards\MyProject2010\MyProject2010.Web\ MyProject2010.web.csproj" (default targets) -- FAILED. Build FAILED. "E:\code\dashboards\MyProject2010\MyProject2010.Web\MyProject2010.web.csp roj" (default target) (1) - "E:\code\dashboards\MyProject2010\MyProject2010.Client\MyProject2010.Clie nt.csproj" (GetXapOutputFile target) (2) - (GetFrameworkPaths target) - C:\Program Files (x86)\MSBuild\Microsoft\Silverlight\v4.0\Microsoft.Silverlig ht.Common.targets(104,9): error : The Silverlight 4 SDK is not installed. [E:\c ode\dashboards\MyProject2010\MyProject2010.Client\MyProject2010.Client.cs proj] 0 Warning(s) 1 Error(s) Time Elapsed 00:00:00.39 I appreciate anyone's help. Thanks.

  Read the article

• Ajax doesn't trigger a change-event on a webkit based browser

  - by user319464

  I have adapted a Jquery plugin to for-fill my needs to send GET requests to servers as a way of "pinging" them. I've also added some javascript code to add some fancy features like: depending on the changed value in a that the Jquery plugin changes, it changes the Icon accordingly. To make it all work essentially, I made so that when Ajax gets a "complete" event, it forces a "onChange" event to the span, triggering the javascript validation function to change the status icons. Here is the code of my slightly modified jQuery Plugin: /** * ping for jQuery * * Adapted by Carroarmato0 (to actually work instead of randomly "pinging" nowhere instead of faking * * @auth Jessica * @link http://www.skiyo.cn/demo/jquery.ping/ * */ (function($) { $.fn.ping = function(options) { var opts = $.extend({}, $.fn.ping.defaults, options); return this.each(function() { var ping, requestTime, responseTime ; var target = $(this); var server = target.html(); target.html('<img src="img/loading.gif" alt="loading" />'); function ping() { $.ajax({url: 'http://' + server, type: 'GET', dataType: 'html', timeout: 30000, beforeSend : function() { requestTime = new Date().getTime(); }, complete : function() { responseTime = new Date().getTime(); ping = Math.abs(requestTime - responseTime); if (ping > 2000) { target.text('niet bereikbaar'); } else { target.text(ping + opts.unit); } target.change(); } }); } ping(); opts.interval != 0 && setInterval(ping,opts.interval * 1000); }); }; $.fn.ping.defaults = { interval: 3, unit: 'ms' }; })(jQuery); target.change(); is the code that triggers the "onchange" event in the span: echo " <td class=\"center\"><span id=\"ping$pingNb\" onChange=\"checkServerIcon(this)\" >" .$server['IP'] . "</span></td>"; In Firefox this works, checkServerIcon(this) gets executed and passes the span object to the function. function checkServerIcon(object) { var delayText = object.innerHTML; var delay = delayText.substring(0, delayText.length - 2); if ( isInteger(delay) ) { object.parentNode.previousSibling.parentNode.getElementsByTagName('img')[0].src = 'img/servers/enable_server.png'; } else { if (delay == "bezig.") { object.parentNode.previousSibling.parentNode.getElementsByTagName('img')[0].src = 'img/servers/search_server.png'; } else { object.parentNode.previousSibling.parentNode.getElementsByTagName('img')[0].src = 'img/servers/desable_server.png'; } } } My guess would be that there's something different in WebKit browsers in the way object.parentNode.previousSibling.parentNode. .... works...

  Read the article

• Why is my namespace not recognized in Visual Studio / xaml

  - by msfanboy

  Hello, these are my 2 classes a Attachable Property SelectedItems: code is from here: http://stackoverflow.com/questions/1297643/sync-selecteditems-in-a-muliselect-listbox-with-a-collection-in-viewmodel The namespace TBM.Helper is for sure proper as it works for other classes too. The namespace reference is also in the xaml file: xmlns:Helper="clr_namespace:TBM.Helper" But <ListBox Helper:SelectedItems.Items="{Binding SelectedItems}" ... does not work because = The property 'SelectedItems.Items' does not exist in XML namespace 'clr_namespace:TBM.Helper'. The attachable property 'Items' was not found in type 'SelectedItems What do I have to change ? using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Windows.Controls; using System.Collections; using System.Windows; namespace TBM.Helper { public static class SelectedItems : DependencyObject { private static readonly DependencyProperty SelectedItemsBehaviorProperty = DependencyProperty.RegisterAttached( "SelectedItemsBehavior", typeof(SelectedItemsBehavior), typeof(ListBox), null); public static readonly DependencyProperty ItemsProperty = DependencyProperty.RegisterAttached( "Items", typeof(IList), typeof(SelectedItems), new PropertyMetadata(null, ItemsPropertyChanged)); public static void SetItems(ListBox listBox, IList list) { listBox.SetValue(ItemsProperty, list); } public static IList GetItems(ListBox listBox) { return listBox.GetValue(ItemsProperty) as IList; } private static void ItemsPropertyChanged(DependencyObject d, DependencyPropertyChangedEventArgs e) { var target = d as ListBox; if (target != null) { GetOrCreateBehavior(target, e.NewValue as IList); } } private static SelectedItemsBehavior GetOrCreateBehavior(ListBox target, IList list) { var behavior = target.GetValue(SelectedItemsBehaviorProperty) as SelectedItemsBehavior; if (behavior == null) { behavior = new SelectedItemsBehavior(target, list); target.SetValue(SelectedItemsBehaviorProperty, behavior); } return behavior; } } } using System.Windows; using System.Windows.Controls; using System.Collections; namespace TBM.Helper { public class SelectedItemsBehavior { private readonly ListBox _listBox; private readonly IList _boundList; public SelectedItemsBehavior(ListBox listBox, IList boundList) { _boundList = boundList; _listBox = listBox; SetSelectedItems(); _listBox.SelectionChanged += OnSelectionChanged; _listBox.DataContextChanged += OnDataContextChanged; } private void SetSelectedItems() { _listBox.SelectedItems.Clear(); foreach (object item in _boundList) { // References in _boundList might not be the same as in _listBox.Items int i = _listBox.Items.IndexOf(item); if (i >= 0) _listBox.SelectedItems.Add(_listBox.Items[i]); } } private void OnDataContextChanged(object sender, DependencyPropertyChangedEventArgs e) { SetSelectedItems(); } private void OnSelectionChanged(object sender, SelectionChangedEventArgs e) { _boundList.Clear(); foreach (var item in _listBox.SelectedItems) _boundList.Add(item); } } }

  Read the article

• How can I have a Makefile automatically rebuild source files that include a modified header file? (I

  - by Nicholas Flynt

  I have the following makefile that I use to build a program (a kernel, actually) that I'm working on. Its from scratch and I'm learning about the process, so its not perfect, but I think its powerful enough at this point for my level of experience writing makefiles. AS = nasm CC = gcc LD = ld TARGET = core BUILD = build SOURCES = source INCLUDE = include ASM = assembly VPATH = $(SOURCES) CFLAGS = -Wall -O -fstrength-reduce -fomit-frame-pointer -finline-functions \ -nostdinc -fno-builtin -I $(INCLUDE) ASFLAGS = -f elf #CFILES = core.c consoleio.c system.c CFILES = $(foreach dir,$(SOURCES),$(notdir $(wildcard $(dir)/*.c))) SFILES = assembly/start.asm SOBJS = $(SFILES:.asm=.o) COBJS = $(CFILES:.c=.o) OBJS = $(SOBJS) $(COBJS) build : $(TARGET).img $(TARGET).img : $(TARGET).elf c:/python26/python.exe concat.py stage1 stage2 pad.bin core.elf floppy.img $(TARGET).elf : $(OBJS) $(LD) -T link.ld -o $@ $^ $(SOBJS) : $(SFILES) $(AS) $(ASFLAGS) $< -o $@ %.o: %.c @echo Compiling $<... $(CC) $(CFLAGS) -c -o $@ $< #Clean Script - Should clear out all .o files everywhere and all that. clean: -del *.img -del *.o -del assembly\*.o -del core.elf My main issue with this makefile is that when I modify a header file that one or more C files include, the C files aren't rebuilt. I can fix this quite easily by having all of my header files be dependencies for all of my C files, but that would effectively cause a complete rebuild of the project any time I changed/added a header file, which would not be very graceful. What I want is for only the C files that include the header file I change to be rebuilt, and for the entire project to be linked again. I can do the linking by causing all header files to be dependencies of the target, but I cannot figure out how to make the C files be invalidated when their included header files are newer. I've heard that GCC has some commands to make this possible (so the makefile can somehow figure out which files need to be rebuilt) but I can't for the life of me find an actual implementation example to look at. Can someone post a solution that will enable this behavior in a makefile? EDIT: I should clarify, I'm familiar with the concept of putting the individual targets in and having each target.o require the header files. That requires me to be editing the makefile every time I include a header file somewhere, which is a bit of a pain. I'm looking for a solution that can derive the header file dependencies on its own, which I'm fairly certain I've seen in other projects.

  Read the article

• def constrainedMatchPair(firstMatch,secondMatch,length):

  - by smart

  matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

  Read the article

• Code Golf: Countdown Number Game

  - by Noldorin

  Challenge Here is the task, inspired by the well-known British TV game show Countdown. The challenge should be pretty clear even without any knowledge of the game, but feel free to ask for clarifications. And if you fancy seeing a clip of this game in action, check out this YouTube clip. It features the wonderful late Richard Whitely in 1997. You are given 6 numbers, chosen at random from the set {1, 2, 3, 4, 5, 6, 8, 9, 10, 25, 50, 75, 100}, and a random target number between 100 and 999. The aim is to make use the six given numbers and the four common arithmetic operations (addition, subtraction, multiplication, division; all over the rational numbers) to generate the target - or as close as possible either side. Each number may only be used once at most, while each arithmetic operator may be used any number of times (including zero.) Note that it does not matter how many numbers are used. Write a function that takes the target number and set of 6 numbers (can be represented as list/collection/array/sequence) and returns the solution in any standard numerical notation (e.g. infix, prefix, postfix). The function must always return the closest-possible result to the target, and must run in at most 1 minute on a standard PC. Note that in the case where more than one solution exists, any single solution is sufficient. Examples: {50, 100, 4, 2, 2, 4}, target 203 e.g. 100 * 2 + 2 + (4 / 4) e.g. (100 + 50) * 4 * 2 / (4 + 2) {25, 4, 9, 2, 3, 10}, target 465 e.g. (25 + 10 - 4) * (9 * 2 - 3) {9, 8, 10, 5, 9, 7), target 241 e.g. ((10 + 9) * 9 * 7) + 8) / 5 Rules Other than mentioned in the problem statement, there are no further restrictions. You may write the function in any standard language (standard I/O is not necessary). The aim as always is to solve the task with the smallest number of characters of code. Saying that, I may not simply accept the answer with the shortest code. I'll also be looking at elegance of the code and time complexity of the algorithm! My Solution I'm attempting an F# solution when I find the free time - will post it here when I have something! Format Please post all answers in the following format for the purpose of easy comparison: Language Number of characters: ??? Fully obfuscated function: (code here) Clear (ideally commented) function: (code here) Any notes on the algorithm/clever shortcuts it takes.

  Read the article

• Simple MSBuild Configuration: Updating Assemblies With A Version Number

  - by srkirkland

  When distributing a library you often run up against versioning problems, once facet of which is simply determining which version of that library your client is running.  Of course, each project in your solution has an AssemblyInfo.cs file which provides, among other things, the ability to set the Assembly name and version number.  Unfortunately, setting the assembly version here would require not only changing the version manually for each build (depending on your schedule), but keeping it in sync across all projects.  There are many ways to solve this versioning problem, and in this blog post I’m going to try to explain what I think is the easiest and most flexible solution.  I will walk you through using MSBuild to create a simple build script, and I’ll even show how to (optionally) integrate with a Team City build server.  All of the code from this post can be found at https://github.com/srkirkland/BuildVersion. Create CommonAssemblyInfo.cs The first step is to create a common location for the repeated assembly info that is spread across all of your projects.  Create a new solution-level file (I usually create a Build/ folder in the solution root, but anywhere reachable by all your projects will do) called CommonAssemblyInfo.cs.  In here you can put any information common to all your assemblies, including the version number.  An example CommonAssemblyInfo.cs is as follows: using System.Reflection; using System.Resources; using System.Runtime.InteropServices;   [assembly: AssemblyCompany("University of California, Davis")] [assembly: AssemblyProduct("BuildVersionTest")] [assembly: AssemblyCopyright("Scott Kirkland & UC Regents")] [assembly: AssemblyConfiguration("")] [assembly: AssemblyTrademark("")]   [assembly: ComVisible(false)]   [assembly: AssemblyVersion("1.2.3.4")] //Will be replaced   [assembly: NeutralResourcesLanguage("en-US")] .csharpcode, .csharpcode pre { font-size: small; color: black; font-family: consolas, "Courier New", courier, monospace; background-color: #ffffff; /*white-space: pre;*/ } .csharpcode pre { margin: 0em; } .csharpcode .rem { color: #008000; } .csharpcode .kwrd { color: #0000ff; } .csharpcode .str { color: #006080; } .csharpcode .op { color: #0000c0; } .csharpcode .preproc { color: #cc6633; } .csharpcode .asp { background-color: #ffff00; } .csharpcode .html { color: #800000; } .csharpcode .attr { color: #ff0000; } .csharpcode .alt { background-color: #f4f4f4; width: 100%; margin: 0em; } .csharpcode .lnum { color: #606060; } .csharpcode, .csharpcode pre { font-size: small; color: black; font-family: consolas, "Courier New", courier, monospace; background-color: #ffffff; /*white-space: pre;*/ } .csharpcode pre { margin: 0em; } .csharpcode .rem { color: #008000; } .csharpcode .kwrd { color: #0000ff; } .csharpcode .str { color: #006080; } .csharpcode .op { color: #0000c0; } .csharpcode .preproc { color: #cc6633; } .csharpcode .asp { background-color: #ffff00; } .csharpcode .html { color: #800000; } .csharpcode .attr { color: #ff0000; } .csharpcode .alt { background-color: #f4f4f4; width: 100%; margin: 0em; } .csharpcode .lnum { color: #606060; }   Cleanup AssemblyInfo.cs & Link CommonAssemblyInfo.cs For each of your projects, you’ll want to clean up your assembly info to contain only information that is unique to that assembly – everything else will go in the CommonAssemblyInfo.cs file.  For most of my projects, that just means setting the AssemblyTitle, though you may feel AssemblyDescription is warranted.  An example AssemblyInfo.cs file is as follows: using System.Reflection;   [assembly: AssemblyTitle("BuildVersionTest")] .csharpcode, .csharpcode pre { font-size: small; color: black; font-family: consolas, "Courier New", courier, monospace; background-color: #ffffff; /*white-space: pre;*/ } .csharpcode pre { margin: 0em; } .csharpcode .rem { color: #008000; } .csharpcode .kwrd { color: #0000ff; } .csharpcode .str { color: #006080; } .csharpcode .op { color: #0000c0; } .csharpcode .preproc { color: #cc6633; } .csharpcode .asp { background-color: #ffff00; } .csharpcode .html { color: #800000; } .csharpcode .attr { color: #ff0000; } .csharpcode .alt { background-color: #f4f4f4; width: 100%; margin: 0em; } .csharpcode .lnum { color: #606060; } Next, you need to “link” the CommonAssemblyinfo.cs file into your projects right beside your newly lean AssemblyInfo.cs file.  To do this, right click on your project and choose Add | Existing Item from the context menu.  Navigate to your CommonAssemblyinfo.cs file but instead of clicking Add, click the little down-arrow next to add and choose “Add as Link.”  You should see a little link graphic similar to this: We’ve actually reduced complexity a lot already, because if you build all of your assemblies will have the same common info, including the product name and our static (fake) assembly version.  Let’s take this one step further and introduce a build script. Create an MSBuild file What we want from the build script (for now) is basically just to have the common assembly version number changed via a parameter (eventually to be passed in by the build server) and then for the project to build.  Also we’d like to have a flexibility to define what build configuration to use (debug, release, etc). In order to find/replace the version number, we are going to use a Regular Expression to find and replace the text within your CommonAssemblyInfo.cs file.  There are many other ways to do this using community build task add-ins, but since we want to keep it simple let’s just define the Regular Expression task manually in a new file, Build.tasks (this example taken from the NuGet build.tasks file). <?xml version="1.0" encoding="utf-8"?> <Project ToolsVersion="4.0" DefaultTargets="Go" xmlns="http://schemas.microsoft.com/developer/msbuild/2003"> <UsingTask TaskName="RegexTransform" TaskFactory="CodeTaskFactory" AssemblyFile="$(MSBuildToolsPath)\Microsoft.Build.Tasks.v4.0.dll"> <ParameterGroup> <Items ParameterType="Microsoft.Build.Framework.ITaskItem[]" /> </ParameterGroup> <Task> <Using Namespace="System.IO" /> <Using Namespace="System.Text.RegularExpressions" /> <Using Namespace="Microsoft.Build.Framework" /> <Code Type="Fragment" Language="cs"> <![CDATA[ foreach(ITaskItem item in Items) { string fileName = item.GetMetadata("FullPath"); string find = item.GetMetadata("Find"); string replaceWith = item.GetMetadata("ReplaceWith"); if(!File.Exists(fileName)) { Log.LogError(null, null, null, null, 0, 0, 0, 0, String.Format("Could not find version file: {0}", fileName), new object[0]); } string content = File.ReadAllText(fileName); File.WriteAllText( fileName, Regex.Replace( content, find, replaceWith ) ); } ]]> </Code> </Task> </UsingTask> </Project> .csharpcode, .csharpcode pre { font-size: small; color: black; font-family: consolas, "Courier New", courier, monospace; background-color: #ffffff; /*white-space: pre;*/ } .csharpcode pre { margin: 0em; } .csharpcode .rem { color: #008000; } .csharpcode .kwrd { color: #0000ff; } .csharpcode .str { color: #006080; } .csharpcode .op { color: #0000c0; } .csharpcode .preproc { color: #cc6633; } .csharpcode .asp { background-color: #ffff00; } .csharpcode .html { color: #800000; } .csharpcode .attr { color: #ff0000; } .csharpcode .alt { background-color: #f4f4f4; width: 100%; margin: 0em; } .csharpcode .lnum { color: #606060; } If you glance at the code, you’ll see it’s really just going a Regex.Replace() on a given file, which is exactly what we need. Now we are ready to write our build file, called (by convention) Build.proj. <?xml version="1.0" encoding="utf-8"?> <Project ToolsVersion="4.0" DefaultTargets="Go" xmlns="http://schemas.microsoft.com/developer/msbuild/2003"> <Import Project="$(MSBuildProjectDirectory)\Build.tasks" /> <PropertyGroup> <Configuration Condition="'$(Configuration)' == ''">Debug</Configuration> <SolutionRoot>$(MSBuildProjectDirectory)</SolutionRoot> </PropertyGroup>   <ItemGroup> <RegexTransform Include="$(SolutionRoot)\CommonAssemblyInfo.cs"> <Find>(?&lt;major&gt;\d+)\.(?&lt;minor&gt;\d+)\.\d+\.(?&lt;revision&gt;\d+)</Find> <ReplaceWith>$(BUILD_NUMBER)</ReplaceWith> </RegexTransform> </ItemGroup>   <Target Name="Go" DependsOnTargets="UpdateAssemblyVersion; Build"> </Target>   <Target Name="UpdateAssemblyVersion" Condition="'$(BUILD_NUMBER)' != ''"> <RegexTransform Items="@(RegexTransform)" /> </Target>   <Target Name="Build"> <MSBuild Projects="$(SolutionRoot)\BuildVersionTest.sln" Targets="Build" /> </Target>   </Project> Reviewing this MSBuild file, we see that by default the “Go” target will be called, which in turn depends on “UpdateAssemblyVersion” and then “Build.”  We go ahead and import the Bulid.tasks file and then setup some handy properties for setting the build configuration and solution root (in this case, my build files are in the solution root, but we might want to create a Build/ directory later).  The rest of the file flows logically, we setup the RegexTransform to match version numbers such as <major>.<minor>.1.<revision> (1.2.3.4 in our example) and replace it with a $(BUILD_NUMBER) parameter which will be supplied externally.  The first target, “UpdateAssemblyVersion” just runs the RegexTransform, and the second target, “Build” just runs the default MSBuild on our solution. Testing the MSBuild file locally Now we have a build file which can replace assembly version numbers and build, so let’s setup a quick batch file to be able to build locally.  To do this you simply create a file called Build.cmd and have it call MSBuild on your Build.proj file.  I’ve added a bit more flexibility so you can specify build configuration and version number, which makes your Build.cmd look as follows: set config=%1 if "%config%" == "" ( set config=debug ) set version=%2 if "%version%" == "" ( set version=2.3.4.5 ) %WINDIR%\Microsoft.NET\Framework\v4.0.30319\msbuild Build.proj /p:Configuration="%config%" /p:build_number="%version%" .csharpcode, .csharpcode pre { font-size: small; color: black; font-family: consolas, "Courier New", courier, monospace; background-color: #ffffff; /*white-space: pre;*/ } .csharpcode pre { margin: 0em; } .csharpcode .rem { color: #008000; } .csharpcode .kwrd { color: #0000ff; } .csharpcode .str { color: #006080; } .csharpcode .op { color: #0000c0; } .csharpcode .preproc { color: #cc6633; } .csharpcode .asp { background-color: #ffff00; } .csharpcode .html { color: #800000; } .csharpcode .attr { color: #ff0000; } .csharpcode .alt { background-color: #f4f4f4; width: 100%; margin: 0em; } .csharpcode .lnum { color: #606060; } Now if you click on the Build.cmd file, you will get a default debug build using the version 2.3.4.5.  Let’s run it in a command window with the parameters set for a release build version 2.0.1.453.   Excellent!  We can now run one simple command and govern the build configuration and version number of our entire solution.  Each DLL produced will have the same version number, making determining which version of a library you are running very simple and accurate. Configure the build server (TeamCity) Of course you are not really going to want to run a build command manually every time, and typing in incrementing version numbers will also not be ideal.  A good solution is to have a computer (or set of computers) act as a build server and build your code for you, providing you a consistent environment, excellent reporting, and much more.  One of the most popular Build Servers is JetBrains’ TeamCity, and this last section will show you the few configuration parameters to use when setting up a build using your MSBuild file created earlier.  If you are using a different build server, the same principals should apply. First, when setting up the project you want to specify the “Build Number Format,” often given in the form <major>.<minor>.<revision>.<build>.  In this case you will set major/minor manually, and optionally revision (or you can use your VCS revision number with %build.vcs.number%), and then build using the {0} wildcard.  Thus your build number format might look like this: 2.0.1.{0}.  During each build, this value will be created and passed into the $BUILD_NUMBER variable of our Build.proj file, which then uses it to decorate your assemblies with the proper version. After setting up the build number, you must choose MSBuild as the Build Runner, then provide a path to your build file (Build.proj).  After specifying your MSBuild Version (equivalent to your .NET Framework Version), you have the option to specify targets (the default being “Go”) and additional MSBuild parameters.  The one parameter that is often useful is manually setting the configuration property (/p:Configuration="Release") if you want something other than the default (which is Debug in our example).  Your resulting configuration will look something like this: [Under General Settings] [Build Runner Settings]   Now every time your build is run, a newly incremented build version number will be generated and passed to MSBuild, which will then version your assemblies and build your solution.   A Quick Review Our goal was to version our output assemblies in an automated way, and we accomplished it by performing a few quick steps: Move the common assembly information, including version, into a linked CommonAssemblyInfo.cs file Create a simple MSBuild script to replace the common assembly version number and build your solution Direct your build server to use the created MSBuild script That’s really all there is to it.  You can find all of the code from this post at https://github.com/srkirkland/BuildVersion. Enjoy!

  Read the article

• SQLAuthority News – TechEd India – April 12-14, 2010 Bangalore – An Unforgettable Experience – An Op

  - by pinaldave

  TechEd India was one of the largest Technology events in India led by Microsoft. This event was attended by more than 3,000 technology enthusiasts, making it one of the most well-organized events of the year. Though I attempted to attend almost all the technology events here, I have not seen any bigger or better event in Indian subcontinents other than this. There are 21 Technical Tracks at Tech·Ed India 2010 that span more than 745 learning opportunities. I was fortunate enough to be a part of this whole event as a speaker and a delegate, as well. TechEd India Speaker Badge and A Token of Lifetime Hotel Selection I presented three different sessions at TechEd India and was also a part of panel discussion. (The details of the sessions are given at the end of this blog post.) Due to extensive traveling, I stay away from my family occasionally. For this reason, I took my wife – Nupur and daughter Shaivi (8 months old) to the event along with me. We stayed at the same hotel where the event was organized so as to maximize my time bonding with my family and to have more time in networking with technology community, at the same time. The hotel Lalit Ashok is the largest and most luxurious venue one can find in Bangalore, located in the middle of the city. The cost of the hotel was a bit pricey, but looking at all the advantages, I had decided to ask for a booking there. Hotel Lalit Ashok Nupur Dave and Shaivi Dave Arrival Day – DAY 0 – April 11, 2010 I reached the event a day earlier, and that was one wise decision for I was able to relax a bit and go over my presentation for the next day’s course. I am a kind of person who likes to get everything ready ahead of time. I was also able to enjoy a pleasant evening with several Microsoft employees and my family friends. I even checked out the location where I would be doing presentations the next day. I was fortunate enough to meet Bijoy Singhal from Microsoft who helped me out with a few of the logistics issues that occured the day before. I was not aware of the fact that the very next day he was going to be “The Man” of the TechEd 2010 event. Vinod Kumar from Microsoft was really very kind as he talked to me regarding my subsequent session. He gave me some suggestions which were really helpful that I was able to incorporate them during my presentation. Finally, I was able to meet Abhishek Kant from Microsoft; his valuable suggestions and unlimited passion have inspired many people like me to work with the Community. Pradipta from Microsoft was also around, being extremely busy with logistics; however, in those busy times, he did find some good spare time to have a chat with me and the other Community leaders. I also met Harish Ranganathan and Sachin Rathi, both from Microsoft. It was so interesting to listen to both of them talking about SharePoint. I just have no words to express my overwhelmed spirit because of all these passionate young guys - Pradipta,Vinod, Bijoy, Harish, Sachin and Ahishek (of course!). Map of TechEd India 2010 Event Day 1 – April 12, 2010 From morning until night time, today was truly a very busy day for me. I had two presentations and one panel discussion for the day. Needless to say, I had a few meetings to attend as well. The day started with a keynote from S. Somaseger where he announced the launch of Visual Studio 2010. The keynote area was really eye-catching because of the very large, bigger-than- life uniform screen. This was truly one to show. The title music of the keynote was very interesting and it featured Bijoy Singhal as the model. It was interesting to talk to him afterwards, when we laughed at jokes together about his modeling assignment. TechEd India Keynote Opening Featuring Bijoy TechEd India 2010 Keynote – S. Somasegar Time: 11:15pm – 11:45pm Session 1: True Lies of SQL Server – SQL Myth Buster Following the excellent keynote, I had my very first session on the subject of SQL Server Myth Buster. At first, I was a bit nervous as right after the keynote, for this was my very first session and during my presentation I saw lots of Microsoft Product Team members. Well, it really went well and I had a really good discussion with attendees of the session. I felt that a well begin was half-done and my confidence was regained. Right after the session, I met a few of my Community friends and had meaningful discussions with them on many subjects. The abstract of the session is as follows: In this 30-minute demo session, I am going to briefly demonstrate few SQL Server Myths and their resolutions as I back them up with some demo. This demo presentation is a must-attend for all developers and administrators who would come to the event. This is going to be a very quick yet fun session. Pinal Presenting session at TechEd India 2010 Time: 1:00 PM – 2:00 PM Lunch with Somasegar After the session I went to see my daughter, and then I headed right away to the lunch with S. Somasegar – the keynote speaker and senior vice president of the Developer Division at Microsoft. I really thank to Abhishek who made it possible for us. Because of his efforts, all the MVPs had the opportunity to meet such a legendary person and had to talk with them on Microsoft Technology. Though Somasegar is currently holding such a high position in Microsoft, he is very polite and a real gentleman, and how I wish that everybody in industry is like him. Believe me, if you spread love and kindness, then that is what you will receive back. As soon as lunch time was over, I ran to the session hall as my second presentation was about to start. Time: 2:30pm – 3:30pm Session 2: Master Data Services in Microsoft SQL Server 2008 R2 Business Intelligence is a subject which was widely talked about at TechEd. Everybody was interested in this subject, and I did not excuse myself from this great concept as well. I consider myself fortunate as I was presenting on the subject of Master Data Services at TechEd. When I had initially learned this subject, I had a bit of confusion about the usage of this tool. Later on, I decided that I would tackle about how we all developers and DBAs are not able to understand something so simple such as this, and even worst, creating confusion about the technology. During system designing, it is very important to have a reference material or master lookup tables. Well, I talked about the same subject and presented the session keeping that as my center talk. The session went very well and I received lots of interesting questions. I got many compliments for talking about this subject on the real-life scenario. I really thank Rushabh Mehta (CEO, Solid Quality Mentors India) for his supportive suggestions that helped me prepare the slide deck, as well as the subject. Pinal Presenting session at TechEd India 2010 The abstract of the session is as follows: SQL Server Master Data Services will ship with SQL Server 2008 R2 and will improve Microsoft’s platform appeal. This session provides an in-depth demonstration of MDS features and highlights important usage scenarios. Master Data Services enables consistent decision-making process by allowing you to create, manage and propagate changes from a single master view of your business entities. Also, MDS – Master Data-hub which is a vital component, helps ensure the consistency of reporting across systems and deliver faster and more accurate results across the enterprise. We will talk about establishing the basis for a centralized approach to defining, deploying, and managing master data in the enterprise. Pinal Presenting session at TechEd India 2010 The day was still not over for me. I had ran into several friends but we were not able keep our enthusiasm under control about all the rumors saying that SQL Server 2008 R2 was about to be launched tomorrow in the keynote. I then ran to my third and final technical event for the day- a panel discussion with the top technologies of India. Time: 5:00pm – 6:00pm Panel Discussion: Harness the power of Web – SEO and Technical Blogging As I have delivered two technical sessions by this time, I was a bit tired but  not less enthusiastic when I had to talk about Blog and Technology. We discussed many different topics there. I told them that the most important aspect for any blog is its content. We discussed in depth the issues with plagiarism and how to avoid it. Another topic of discussion was how we technology bloggers can create awareness in the Community about what the right kind of blogging is and what morally and technically wrong acts are. A couple of questions were raised about what type of liberty a person can have in terms of writing blogs. Well, it was generically agreed that a blog is mainly a representation of our ideas and thoughts; it should not be governed by external entities. As long as one is writing what they really want to say, but not providing incorrect information or not practicing plagiarism, a blogger should be allowed to express himself. This panel discussion was supposed to be over in an hour, but the interest of the participants was remarkable and so it was extended for 30 minutes more. Finally, we decided to bring to a close the discussion and agreed that we will continue the topic next year. TechEd India Panel Discussion on Web, Technology and SEO Surprisingly, the day was just beginning after doing all of these. By this time, I have almost met all the MVP who arrived at the event, as well as many Microsoft employees. There were lots of Community folks present, too. I decided that I would go to meet several friends from the Community and continue to communicate with me on SQLAuthority.com. I also met Abhishek Baxi and had a good talk with him regarding Win Mobile and Twitter. He also took a very quick video of me wherein I spoke in my mother’s tongue, Gujarati. It was funny that I talked in Gujarati almost all the day, but when I was talking in the interview I could not find the right Gujarati words to speak. I think we all think in English when we think about Technology, so as to address universality. After meeting them, I headed towards the Speakers’ Dinner. Time: 8:00 PM – onwards Speakers Dinner The Speakers’ dinner was indeed a wonderful opportunity for all the speakers to get together and relax. We talked so many different things, from XBOX to Hindi Movies, and from SQL to Samosas. I just could not express how much fun I had. After a long evening, when I returned tmy room and met Shaivi, I just felt instantly relaxed. Kids are really gifts from God. Today was a really long but exciting day. So many things happened in just one day: Visual Studio Lanch, lunch with Somasegar, 2 technical sessions, 1 panel discussion, community leaders meeting, speakers dinner and, last but not leas,t playing with my child! A perfect day! Day 2 – April 13, 2010 Today started with a bang with the excellent keynote by Kamal Hathi who launched SQL Server 2008 R2 in India and demonstrated the power of PowerPivot to all of us. 101 Million Rows in Excel brought lots of applause from the audience. Kamal Hathi Presenting Keynote at TechEd India 2010 The day was a bit easier one for me. I had no sessions today and no events planned. I had a few meetings planned for the second day of the event. I sat in the speaker’s lounge for half a day and met many people there. I attended nearly 9 different meetings today. The subjects of the meetings were very different. Here is a list of the topics of the Community-related meetings: SQL PASS and its involvement in India and subcontinents How to start community blogging Forums and developing aptitude towards technology Ahmedabad/Gandhinagar User Groups and their developments SharePoint and SQL Business Meeting – a client meeting Business Meeting – a potential performance tuning project Business Meeting – Solid Quality Mentors (SolidQ) And family friends Pinal Dave at TechEd India The day passed by so quickly during this meeting. In the evening, I headed to Partners Expo with friends and checked out few of the booths. I really wanted to talk about some of the products, but due to the freebies there was so much crowd that I finally decided to just take the contact details of the partner. I will now start sending them with my queries and, hopefully, I will have my questions answered. Nupur and Shaivi had also one meeting to attend; it was with our family friend Vijay Raj. Vijay is also a person who loves Technology and loves it more than anybody. I see him growing and learning every day, but still remaining as a ‘human’. I believe that if someone acquires as much knowledge as him, that person will become either a computer or cyborg. Here, Vijay is still a kind gentleman and is able to stay as our close family friend. Shaivi was really happy to play with Uncle Vijay. Pinal Dave and Vijay Raj Renuka Prasad, a Microsoft MVP, impressed me with his passion and knowledge of SQL. Every time he gives me credit for his success, I believe that he is very humble. He has way more certifications than me and has worked many more years with SQL compared to me. He is an excellent photographer as well. Most of the photos in this blog post have been taken by him. I told him if ever he wants to do a part time job, he can do the photography very well. Pinal Dave and Renuka Prasad I also met L Srividya from Microsoft, whom I was looking forward to meet. She is a bundle of knowledge that everyone would surely learn a lot from her. I was able to get a few minutes from her and well, I felt confident. She enlightened me with SQL Server BI concepts, domain management and SQL Server security and few other interesting details. I also had a wonderful time talking about SharePoint with fellow Solid Quality Mentor Joy Rathnayake. He is very passionate about SharePoint but when you talk .NET and SQL with him, he is still overwhelmingly knowledgeable. In fact, while talking to him, I figured out that the recent training he delivered was on SQL Server 2008 R2. I told him a joke that it hurts my ego as he is more popular now in SQL training and consulting than me. I am sure all of you agree that working with good people is a gift from God. I am fortunate enough to work with the best of the best Industry experts. It was a great pleasure to hang out with my Community friends – Ahswin Kini, HimaBindu Vejella, Vasudev G, Suprotim Agrawal, Dhananjay, Vikram Pendse, Mahesh Dhola, Mahesh Mitkari,  Manu Zacharia, Shobhan, Hardik Shah, Ashish Mohta, Manan, Subodh Sohani and Sanjay Shetty (of course!) .  (Please let me know if I have met you at the event and forgot your name to list here). Time: 8:00 PM – onwards Community Leaders Dinner After lots of meetings, I headed towards the Community Leaders dinner meeting and met almost all the folks I met in morning. The discussion was almost the same but the real good thing was that we were enjoying it. The food was really good. Nupur was invited in the event, but Shaivi could not come. When Nupur tried to enter the event, she was stopped as Shaivi did not have the pass to enter the dinner. Nupur expressed that Shaivi is only 8 months old and does not eat outside food as well and could not stay by herself at this age, but the door keeper did not agree and asked that without the entry details Shaivi could not go in, but Nupur could. Nupur called me on phone and asked me to help her out. By the time, I was outside; the organizer of the event reached to the door and happily approved Shaivi to join the party. Once in the party, Shaivi had lots of fun meeting so many people. Shaivi Dave and Abhishek Kant Dean Guida (Infragistics President and CEO) and Pinal Dave (SQLAuthority.com) Day 3 – April 14, 2010 Though, it was last day, I was very much excited today as I was about to present my very favorite session. Query Optimization and Performance Tuning is my domain expertise and I make my leaving by consulting and training the same. Today’s session was on the same subject and as an additional twist, another subject about Spatial Database was presented. I was always intrigued with Spatial Database and I have enjoyed learning about it; however, I have never thought about Spatial Indexing before it was decided that I will do this session. I really thank Solid Quality Mentor Dr. Greg Low for his assistance in helping me prepare the slide deck and also review the content. Furthermore, today was really what I call my ‘learning day’ . So far I had not attended any session in TechEd and I felt a bit down for that. Everybody spends their valuable time & money to learn something new and exciting in TechEd and I had not attended a single session at the moment thinking that it was already last day of the event. I did have a plan for the day and I attended two technical sessions before my session of spatial database. I attended 2 sessions of Vinod Kumar. Vinod is a natural storyteller and there was no doubt that his sessions would be jam-packed. People attended his sessions simply because Vinod is syhe speaker. He did not have a single time disappointed audience; he is truly a good speaker. He knows his stuff very well. I personally do not think that in India he can be compared to anyone for SQL. Time: 12:30pm-1:30pm SQL Server Query Optimization, Execution and Debugging Query Performance I really had a fun time attending this session. Vinod made this session very interactive. The entire audience really got into the presentation and started participating in the event. Vinod was presenting a small problem with Query Tuning, which any developer would have encountered and solved with their help in such a fashion that a developer feels he or she have already resolved it. In one question, I was the only one who was ready to answer and Vinod told me in a light tone that I am now allowed to answer it! The audience really found it very amusing. There was a huge crowd around Vinod after the session. Vinod – A master storyteller! Time: 3:45pm-4:45pm Data Recovery / consistency with CheckDB This session was much heavier than the earlier one, and I must say this is my most favorite session I EVER attended in India. In this TechEd I have only attended two sessions, but in my career, I have attended numerous technical sessions not only in India, but all over the world. This session had taken my breath away. One by one, Vinod took the different databases, and started to corrupt them in different ways. Each database has some unique ways to get corrupted. Once that was done, Vinod started to show the DBCC CEHCKDB and demonstrated how it can solve your problem. He finally fixed all the databases with this single tool. I do have a good knowledge of this subject, but let me honestly admit that I have learned a lot from this session. I enjoyed and cheered during this session along with other attendees. I had total satisfaction that, just like everyone, I took advantage of the event and learned something. I am now TECHnically EDucated. Pinal Dave and Vinod Kumar After two very interactive and informative SQL Sessions from Vinod Kumar, the next turn me presenting on Spatial Database and Indexing. I got once again nervous but Vinod told me to stay natural and do my presentation. Well, once I got a huge stage with a total of four projectors and a large crowd, I felt better. Time: 5:00pm-6:00pm Session 3: Developing with SQL Server Spatial and Deep Dive into Spatial Indexing Pinal Presenting session at TechEd India 2010 Pinal Presenting session at TechEd India 2010 I kicked off this session with Michael J Swart‘s beautiful spatial image. This session was the last one for the day but, to my surprise, I had more than 200+ attendees. Slowly, the rain was starting outside and I was worried that the hall would not be full; despite this, there was not a single seat available in the first five minutes of the session. Thanks to all of you for attending my presentation. I had demonstrated the map of world (and India) and quickly explained what  Geographic and Geometry data types in Spatial Database are. This session had interesting story of Indexing and Comparison, as well as how different traditional indexes are from spatial indexing. Pinal Presenting session at TechEd India 2010 Due to the heavy rain during this event, the power went off for about 22 minutes (just an accident – nobodies fault). During these minutes, there were no audio, no video and no light. I continued to address the mass of 200+ people without any audio device and PowerPoint. I must thank the audience because not a single person left from the session. They all stayed in their place, some moved closure to listen to me properly. I noticed that the curiosity and eagerness to learn new things was at the peak even though it was the very last session of the TechEd. Everybody wanted get the maximum knowledge out of this whole event. I was touched by the support from audience. They listened and participated in my session even without any kinds of technology (no ppt, no mike, no AC, nothing). During these 22 minutes, I had completed my theory verbally. Pinal Presenting session at TechEd India 2010 After a while, we got the projector back online and we continued with some exciting demos. Many thanks to Microsoft people who worked energetically in background to get the backup power for project up. I had a very interesting demo wherein I overlaid Bangalore and Hyderabad on the India Map and find their aerial distance between them. After finding the aerial distance, we browsed online and found that SQL Server estimates the exact aerial distance between these two cities, as compared to the factual distance. There was a huge applause from the crowd on the subject that SQL Server takes into the count of the curvature of the earth and finds the precise distances based on details. During the process of finding the distance, I demonstrated a few examples of the indexes where I expressed how one can use those indexes to find these distances and how they can improve the performance of similar query. I also demonstrated few examples wherein we were able to see in which data type the Index is most useful. We finished the demos with a few more internal stuff. Pinal Presenting session at TechEd India 2010 Despite all issues, I was mostly satisfied with my presentation. I think it was the best session I have ever presented at any conference. There was no help from Technology for a while, but I still got lots of appreciation at the end. When we ended the session, the applause from the audience was so loud that for a moment, the rain was not audible. I was truly moved by the dedication of the Technology enthusiasts. Pinal Dave After Presenting session at TechEd India 2010 The abstract of the session is as follows: The Microsoft SQL Server 2008 delivers new spatial data types that enable you to consume, use, and extend location-based data through spatial-enabled applications. Attend this session to learn how to use spatial functionality in next version of SQL Server to build and optimize spatial queries. This session outlines the new geography data type to store geodetic spatial data and perform operations on it, use the new geometry data type to store planar spatial data and perform operations on it, take advantage of new spatial indexes for high performance queries, use the new spatial results tab to quickly and easily view spatial query results directly from within Management Studio, extend spatial data capabilities by building or integrating location-enabled applications through support for spatial standards and specifications and much more. Time: 8:00 PM – onwards Dinner by Sponsors After the lively session during the day, there was another dinner party courtesy of one of the sponsors of TechEd. All the MVPs and several Community leaders were present at the dinner. I would like to express my gratitude to Abhishek Kant for organizing this wonderful event for us. It was a blast and really relaxing in all angles. We all stayed there for a long time and talked about our sweet and unforgettable memories of the event. Pinal Dave and Bijoy Singhal It was really one wonderful event. After writing this much, I say that I have no words to express about how much I enjoyed TechEd. However, it is true that I shared with you only 1% of the total activities I have done at the event. There were so many people I have met, yet were not mentioned here although I wanted to write their names here, too . Anyway, I have learned so many things and up until now, I am not able to get over all the fun I had in this event. Pinal Dave at TechEd India 2010 The Next Days – April 15, 2010 – till today I am still not able to get my mind out of the whole experience I had at TechEd India 2010. It was like a whole Microsoft Family working together to celebrate a happy occasion. TechEd India – Truly An Unforgettable Experience! Reference : Pinal Dave (http://blog.SQLAuthority.com) Filed under: About Me, MVP, Pinal Dave, SQL, SQL Authority, SQL Query, SQL Server, SQL Tips and Tricks, SQLAuthority Author Visit, SQLAuthority News, SQLServer, T SQL, Technology Tagged: TechEd, TechEdIn

  Read the article

• SQLAuthority News – TechEd India – April 12-14, 2010 Bangalore – An Unforgettable Experience – An Op

  - by pinaldave

  TechEd India was one of the largest Technology events in India led by Microsoft. This event was attended by more than 3,000 technology enthusiasts, making it one of the most well-organized events of the year. Though I attempted to attend almost all the technology events here, I have not seen any bigger or better event in Indian subcontinents other than this. There are 21 Technical Tracks at Tech·Ed India 2010 that span more than 745 learning opportunities. I was fortunate enough to be a part of this whole event as a speaker and a delegate, as well. TechEd India Speaker Badge and A Token of Lifetime Hotel Selection I presented three different sessions at TechEd India and was also a part of panel discussion. (The details of the sessions are given at the end of this blog post.) Due to extensive traveling, I stay away from my family occasionally. For this reason, I took my wife – Nupur and daughter Shaivi (8 months old) to the event along with me. We stayed at the same hotel where the event was organized so as to maximize my time bonding with my family and to have more time in networking with technology community, at the same time. The hotel Lalit Ashok is the largest and most luxurious venue one can find in Bangalore, located in the middle of the city. The cost of the hotel was a bit pricey, but looking at all the advantages, I had decided to ask for a booking there. Hotel Lalit Ashok Nupur Dave and Shaivi Dave Arrival Day – DAY 0 – April 11, 2010 I reached the event a day earlier, and that was one wise decision for I was able to relax a bit and go over my presentation for the next day’s course. I am a kind of person who likes to get everything ready ahead of time. I was also able to enjoy a pleasant evening with several Microsoft employees and my family friends. I even checked out the location where I would be doing presentations the next day. I was fortunate enough to meet Bijoy Singhal from Microsoft who helped me out with a few of the logistics issues that occured the day before. I was not aware of the fact that the very next day he was going to be “The Man” of the TechEd 2010 event. Vinod Kumar from Microsoft was really very kind as he talked to me regarding my subsequent session. He gave me some suggestions which were really helpful that I was able to incorporate them during my presentation. Finally, I was able to meet Abhishek Kant from Microsoft; his valuable suggestions and unlimited passion have inspired many people like me to work with the Community. Pradipta from Microsoft was also around, being extremely busy with logistics; however, in those busy times, he did find some good spare time to have a chat with me and the other Community leaders. I also met Harish Ranganathan and Sachin Rathi, both from Microsoft. It was so interesting to listen to both of them talking about SharePoint. I just have no words to express my overwhelmed spirit because of all these passionate young guys - Pradipta,Vinod, Bijoy, Harish, Sachin and Ahishek (of course!). Map of TechEd India 2010 Event Day 1 – April 12, 2010 From morning until night time, today was truly a very busy day for me. I had two presentations and one panel discussion for the day. Needless to say, I had a few meetings to attend as well. The day started with a keynote from S. Somaseger where he announced the launch of Visual Studio 2010. The keynote area was really eye-catching because of the very large, bigger-than- life uniform screen. This was truly one to show. The title music of the keynote was very interesting and it featured Bijoy Singhal as the model. It was interesting to talk to him afterwards, when we laughed at jokes together about his modeling assignment. TechEd India Keynote Opening Featuring Bijoy TechEd India 2010 Keynote – S. Somasegar Time: 11:15pm – 11:45pm Session 1: True Lies of SQL Server – SQL Myth Buster Following the excellent keynote, I had my very first session on the subject of SQL Server Myth Buster. At first, I was a bit nervous as right after the keynote, for this was my very first session and during my presentation I saw lots of Microsoft Product Team members. Well, it really went well and I had a really good discussion with attendees of the session. I felt that a well begin was half-done and my confidence was regained. Right after the session, I met a few of my Community friends and had meaningful discussions with them on many subjects. The abstract of the session is as follows: In this 30-minute demo session, I am going to briefly demonstrate few SQL Server Myths and their resolutions as I back them up with some demo. This demo presentation is a must-attend for all developers and administrators who would come to the event. This is going to be a very quick yet fun session. Pinal Presenting session at TechEd India 2010 Time: 1:00 PM – 2:00 PM Lunch with Somasegar After the session I went to see my daughter, and then I headed right away to the lunch with S. Somasegar – the keynote speaker and senior vice president of the Developer Division at Microsoft. I really thank to Abhishek who made it possible for us. Because of his efforts, all the MVPs had the opportunity to meet such a legendary person and had to talk with them on Microsoft Technology. Though Somasegar is currently holding such a high position in Microsoft, he is very polite and a real gentleman, and how I wish that everybody in industry is like him. Believe me, if you spread love and kindness, then that is what you will receive back. As soon as lunch time was over, I ran to the session hall as my second presentation was about to start. Time: 2:30pm – 3:30pm Session 2: Master Data Services in Microsoft SQL Server 2008 R2 Business Intelligence is a subject which was widely talked about at TechEd. Everybody was interested in this subject, and I did not excuse myself from this great concept as well. I consider myself fortunate as I was presenting on the subject of Master Data Services at TechEd. When I had initially learned this subject, I had a bit of confusion about the usage of this tool. Later on, I decided that I would tackle about how we all developers and DBAs are not able to understand something so simple such as this, and even worst, creating confusion about the technology. During system designing, it is very important to have a reference material or master lookup tables. Well, I talked about the same subject and presented the session keeping that as my center talk. The session went very well and I received lots of interesting questions. I got many compliments for talking about this subject on the real-life scenario. I really thank Rushabh Mehta (CEO, Solid Quality Mentors India) for his supportive suggestions that helped me prepare the slide deck, as well as the subject. Pinal Presenting session at TechEd India 2010 The abstract of the session is as follows: SQL Server Master Data Services will ship with SQL Server 2008 R2 and will improve Microsoft’s platform appeal. This session provides an in-depth demonstration of MDS features and highlights important usage scenarios. Master Data Services enables consistent decision-making process by allowing you to create, manage and propagate changes from a single master view of your business entities. Also, MDS – Master Data-hub which is a vital component, helps ensure the consistency of reporting across systems and deliver faster and more accurate results across the enterprise. We will talk about establishing the basis for a centralized approach to defining, deploying, and managing master data in the enterprise. Pinal Presenting session at TechEd India 2010 The day was still not over for me. I had ran into several friends but we were not able keep our enthusiasm under control about all the rumors saying that SQL Server 2008 R2 was about to be launched tomorrow in the keynote. I then ran to my third and final technical event for the day- a panel discussion with the top technologies of India. Time: 5:00pm – 6:00pm Panel Discussion: Harness the power of Web – SEO and Technical Blogging As I have delivered two technical sessions by this time, I was a bit tired but  not less enthusiastic when I had to talk about Blog and Technology. We discussed many different topics there. I told them that the most important aspect for any blog is its content. We discussed in depth the issues with plagiarism and how to avoid it. Another topic of discussion was how we technology bloggers can create awareness in the Community about what the right kind of blogging is and what morally and technically wrong acts are. A couple of questions were raised about what type of liberty a person can have in terms of writing blogs. Well, it was generically agreed that a blog is mainly a representation of our ideas and thoughts; it should not be governed by external entities. As long as one is writing what they really want to say, but not providing incorrect information or not practicing plagiarism, a blogger should be allowed to express himself. This panel discussion was supposed to be over in an hour, but the interest of the participants was remarkable and so it was extended for 30 minutes more. Finally, we decided to bring to a close the discussion and agreed that we will continue the topic next year. TechEd India Panel Discussion on Web, Technology and SEO Surprisingly, the day was just beginning after doing all of these. By this time, I have almost met all the MVP who arrived at the event, as well as many Microsoft employees. There were lots of Community folks present, too. I decided that I would go to meet several friends from the Community and continue to communicate with me on SQLAuthority.com. I also met Abhishek Baxi and had a good talk with him regarding Win Mobile and Twitter. He also took a very quick video of me wherein I spoke in my mother’s tongue, Gujarati. It was funny that I talked in Gujarati almost all the day, but when I was talking in the interview I could not find the right Gujarati words to speak. I think we all think in English when we think about Technology, so as to address universality. After meeting them, I headed towards the Speakers’ Dinner. Time: 8:00 PM – onwards Speakers Dinner The Speakers’ dinner was indeed a wonderful opportunity for all the speakers to get together and relax. We talked so many different things, from XBOX to Hindi Movies, and from SQL to Samosas. I just could not express how much fun I had. After a long evening, when I returned tmy room and met Shaivi, I just felt instantly relaxed. Kids are really gifts from God. Today was a really long but exciting day. So many things happened in just one day: Visual Studio Lanch, lunch with Somasegar, 2 technical sessions, 1 panel discussion, community leaders meeting, speakers dinner and, last but not leas,t playing with my child! A perfect day! Day 2 – April 13, 2010 Today started with a bang with the excellent keynote by Kamal Hathi who launched SQL Server 2008 R2 in India and demonstrated the power of PowerPivot to all of us. 101 Million Rows in Excel brought lots of applause from the audience. Kamal Hathi Presenting Keynote at TechEd India 2010 The day was a bit easier one for me. I had no sessions today and no events planned. I had a few meetings planned for the second day of the event. I sat in the speaker’s lounge for half a day and met many people there. I attended nearly 9 different meetings today. The subjects of the meetings were very different. Here is a list of the topics of the Community-related meetings: SQL PASS and its involvement in India and subcontinents How to start community blogging Forums and developing aptitude towards technology Ahmedabad/Gandhinagar User Groups and their developments SharePoint and SQL Business Meeting – a client meeting Business Meeting – a potential performance tuning project Business Meeting – Solid Quality Mentors (SolidQ) And family friends Pinal Dave at TechEd India The day passed by so quickly during this meeting. In the evening, I headed to Partners Expo with friends and checked out few of the booths. I really wanted to talk about some of the products, but due to the freebies there was so much crowd that I finally decided to just take the contact details of the partner. I will now start sending them with my queries and, hopefully, I will have my questions answered. Nupur and Shaivi had also one meeting to attend; it was with our family friend Vijay Raj. Vijay is also a person who loves Technology and loves it more than anybody. I see him growing and learning every day, but still remaining as a ‘human’. I believe that if someone acquires as much knowledge as him, that person will become either a computer or cyborg. Here, Vijay is still a kind gentleman and is able to stay as our close family friend. Shaivi was really happy to play with Uncle Vijay. Pinal Dave and Vijay Raj Renuka Prasad, a Microsoft MVP, impressed me with his passion and knowledge of SQL. Every time he gives me credit for his success, I believe that he is very humble. He has way more certifications than me and has worked many more years with SQL compared to me. He is an excellent photographer as well. Most of the photos in this blog post have been taken by him. I told him if ever he wants to do a part time job, he can do the photography very well. Pinal Dave and Renuka Prasad I also met L Srividya from Microsoft, whom I was looking forward to meet. She is a bundle of knowledge that everyone would surely learn a lot from her. I was able to get a few minutes from her and well, I felt confident. She enlightened me with SQL Server BI concepts, domain management and SQL Server security and few other interesting details. I also had a wonderful time talking about SharePoint with fellow Solid Quality Mentor Joy Rathnayake. He is very passionate about SharePoint but when you talk .NET and SQL with him, he is still overwhelmingly knowledgeable. In fact, while talking to him, I figured out that the recent training he delivered was on SQL Server 2008 R2. I told him a joke that it hurts my ego as he is more popular now in SQL training and consulting than me. I am sure all of you agree that working with good people is a gift from God. I am fortunate enough to work with the best of the best Industry experts. It was a great pleasure to hang out with my Community friends – Ahswin Kini, HimaBindu Vejella, Vasudev G, Suprotim Agrawal, Dhananjay, Vikram Pendse, Mahesh Dhola, Mahesh Mitkari,  Manu Zacharia, Shobhan, Hardik Shah, Ashish Mohta, Manan, Subodh Sohani and Sanjay Shetty (of course!) .  (Please let me know if I have met you at the event and forgot your name to list here). Time: 8:00 PM – onwards Community Leaders Dinner After lots of meetings, I headed towards the Community Leaders dinner meeting and met almost all the folks I met in morning. The discussion was almost the same but the real good thing was that we were enjoying it. The food was really good. Nupur was invited in the event, but Shaivi could not come. When Nupur tried to enter the event, she was stopped as Shaivi did not have the pass to enter the dinner. Nupur expressed that Shaivi is only 8 months old and does not eat outside food as well and could not stay by herself at this age, but the door keeper did not agree and asked that without the entry details Shaivi could not go in, but Nupur could. Nupur called me on phone and asked me to help her out. By the time, I was outside; the organizer of the event reached to the door and happily approved Shaivi to join the party. Once in the party, Shaivi had lots of fun meeting so many people. Shaivi Dave and Abhishek Kant Dean Guida (Infragistics President and CEO) and Pinal Dave (SQLAuthority.com) Day 3 – April 14, 2010 Though, it was last day, I was very much excited today as I was about to present my very favorite session. Query Optimization and Performance Tuning is my domain expertise and I make my leaving by consulting and training the same. Today’s session was on the same subject and as an additional twist, another subject about Spatial Database was presented. I was always intrigued with Spatial Database and I have enjoyed learning about it; however, I have never thought about Spatial Indexing before it was decided that I will do this session. I really thank Solid Quality Mentor Dr. Greg Low for his assistance in helping me prepare the slide deck and also review the content. Furthermore, today was really what I call my ‘learning day’ . So far I had not attended any session in TechEd and I felt a bit down for that. Everybody spends their valuable time & money to learn something new and exciting in TechEd and I had not attended a single session at the moment thinking that it was already last day of the event. I did have a plan for the day and I attended two technical sessions before my session of spatial database. I attended 2 sessions of Vinod Kumar. Vinod is a natural storyteller and there was no doubt that his sessions would be jam-packed. People attended his sessions simply because Vinod is syhe speaker. He did not have a single time disappointed audience; he is truly a good speaker. He knows his stuff very well. I personally do not think that in India he can be compared to anyone for SQL. Time: 12:30pm-1:30pm SQL Server Query Optimization, Execution and Debugging Query Performance I really had a fun time attending this session. Vinod made this session very interactive. The entire audience really got into the presentation and started participating in the event. Vinod was presenting a small problem with Query Tuning, which any developer would have encountered and solved with their help in such a fashion that a developer feels he or she have already resolved it. In one question, I was the only one who was ready to answer and Vinod told me in a light tone that I am now allowed to answer it! The audience really found it very amusing. There was a huge crowd around Vinod after the session. Vinod – A master storyteller! Time: 3:45pm-4:45pm Data Recovery / consistency with CheckDB This session was much heavier than the earlier one, and I must say this is my most favorite session I EVER attended in India. In this TechEd I have only attended two sessions, but in my career, I have attended numerous technical sessions not only in India, but all over the world. This session had taken my breath away. One by one, Vinod took the different databases, and started to corrupt them in different ways. Each database has some unique ways to get corrupted. Once that was done, Vinod started to show the DBCC CEHCKDB and demonstrated how it can solve your problem. He finally fixed all the databases with this single tool. I do have a good knowledge of this subject, but let me honestly admit that I have learned a lot from this session. I enjoyed and cheered during this session along with other attendees. I had total satisfaction that, just like everyone, I took advantage of the event and learned something. I am now TECHnically EDucated. Pinal Dave and Vinod Kumar After two very interactive and informative SQL Sessions from Vinod Kumar, the next turn me presenting on Spatial Database and Indexing. I got once again nervous but Vinod told me to stay natural and do my presentation. Well, once I got a huge stage with a total of four projectors and a large crowd, I felt better. Time: 5:00pm-6:00pm Session 3: Developing with SQL Server Spatial and Deep Dive into Spatial Indexing Pinal Presenting session at TechEd India 2010 Pinal Presenting session at TechEd India 2010 I kicked off this session with Michael J Swart‘s beautiful spatial image. This session was the last one for the day but, to my surprise, I had more than 200+ attendees. Slowly, the rain was starting outside and I was worried that the hall would not be full; despite this, there was not a single seat available in the first five minutes of the session. Thanks to all of you for attending my presentation. I had demonstrated the map of world (and India) and quickly explained what  Geographic and Geometry data types in Spatial Database are. This session had interesting story of Indexing and Comparison, as well as how different traditional indexes are from spatial indexing. Pinal Presenting session at TechEd India 2010 Due to the heavy rain during this event, the power went off for about 22 minutes (just an accident – nobodies fault). During these minutes, there were no audio, no video and no light. I continued to address the mass of 200+ people without any audio device and PowerPoint. I must thank the audience because not a single person left from the session. They all stayed in their place, some moved closure to listen to me properly. I noticed that the curiosity and eagerness to learn new things was at the peak even though it was the very last session of the TechEd. Everybody wanted get the maximum knowledge out of this whole event. I was touched by the support from audience. They listened and participated in my session even without any kinds of technology (no ppt, no mike, no AC, nothing). During these 22 minutes, I had completed my theory verbally. Pinal Presenting session at TechEd India 2010 After a while, we got the projector back online and we continued with some exciting demos. Many thanks to Microsoft people who worked energetically in background to get the backup power for project up. I had a very interesting demo wherein I overlaid Bangalore and Hyderabad on the India Map and find their aerial distance between them. After finding the aerial distance, we browsed online and found that SQL Server estimates the exact aerial distance between these two cities, as compared to the factual distance. There was a huge applause from the crowd on the subject that SQL Server takes into the count of the curvature of the earth and finds the precise distances based on details. During the process of finding the distance, I demonstrated a few examples of the indexes where I expressed how one can use those indexes to find these distances and how they can improve the performance of similar query. I also demonstrated few examples wherein we were able to see in which data type the Index is most useful. We finished the demos with a few more internal stuff. Pinal Presenting session at TechEd India 2010 Despite all issues, I was mostly satisfied with my presentation. I think it was the best session I have ever presented at any conference. There was no help from Technology for a while, but I still got lots of appreciation at the end. When we ended the session, the applause from the audience was so loud that for a moment, the rain was not audible. I was truly moved by the dedication of the Technology enthusiasts. Pinal Dave After Presenting session at TechEd India 2010 The abstract of the session is as follows: The Microsoft SQL Server 2008 delivers new spatial data types that enable you to consume, use, and extend location-based data through spatial-enabled applications. Attend this session to learn how to use spatial functionality in next version of SQL Server to build and optimize spatial queries. This session outlines the new geography data type to store geodetic spatial data and perform operations on it, use the new geometry data type to store planar spatial data and perform operations on it, take advantage of new spatial indexes for high performance queries, use the new spatial results tab to quickly and easily view spatial query results directly from within Management Studio, extend spatial data capabilities by building or integrating location-enabled applications through support for spatial standards and specifications and much more. Time: 8:00 PM – onwards Dinner by Sponsors After the lively session during the day, there was another dinner party courtesy of one of the sponsors of TechEd. All the MVPs and several Community leaders were present at the dinner. I would like to express my gratitude to Abhishek Kant for organizing this wonderful event for us. It was a blast and really relaxing in all angles. We all stayed there for a long time and talked about our sweet and unforgettable memories of the event. Pinal Dave and Bijoy Singhal It was really one wonderful event. After writing this much, I say that I have no words to express about how much I enjoyed TechEd. However, it is true that I shared with you only 1% of the total activities I have done at the event. There were so many people I have met, yet were not mentioned here although I wanted to write their names here, too . Anyway, I have learned so many things and up until now, I am not able to get over all the fun I had in this event. Pinal Dave at TechEd India 2010 The Next Days – April 15, 2010 – till today I am still not able to get my mind out of the whole experience I had at TechEd India 2010. It was like a whole Microsoft Family working together to celebrate a happy occasion. TechEd India – Truly An Unforgettable Experience! Reference : Pinal Dave (http://blog.SQLAuthority.com) Filed under: About Me, MVP, Pinal Dave, SQL, SQL Authority, SQL Query, SQL Server, SQL Tips and Tricks, SQLAuthority Author Visit, SQLAuthority News, SQLServer, T SQL, Technology Tagged: TechEd, TechEdIn

  Read the article

• Drop outs when accessing share by DFS name.

  - by Stephen Woolhead

  I have a strange problem, aren't they all! I have a DFS root \domain\files\vms, it has a single target on a different server than the namespace. I can copy a test file set from the target directly via \server\vms$\testfiles and all is well, the files copy fine. I have repeated these tests many times. If I try and copy the files from the dfs root I get big pauses in the network traffic, about 50 seconds every couple of minutes, all the traffic just stops for the copy. If I start another copy between the same two machines during this pause, it starts copying fine, so I know it's not an issue with the disks on the server. Every once in a while the copy will fail, no errors, the progress bar will just zip all the way to 100% and the copy dialog will close. Checking the target folder show that the copy is incomplete. I've moved the LUN to another server and had the same problem. The servers are all 2008 R2, the clients are Vista x64, Windows7 x64 and 2008 R2, all have the same problem. Anyone got any ideas? Cheers, Stephen More Information: I've been running a NetMon trace on the connection when the file copy fails and what seems to be standing out is that when opening a file that the copy completes on the SMB command looks like this: SMB2: C CREATE (0x5), Name=Training\PDC2008\BB34 Live Services Notifications, Awareness, and Communications.wmv@#422082, Context=DHnQ, Context=MxAc, Context=QFid, Context=RqLs, Mid = 245376 SMB2: R CREATE (0x5), Context=MxAc, Context=RqLs, Context=DHnQ, Context=QFid, FID=0xFFFFFFFF00000015, Mid = 245376 But for the last file when the copy dialog closes looks like this: SMB2: C CREATE (0x5), Name=gt\files\Media\Training\PDC2008\BB36 FAST Building Search-Driven Portals with Microsoft Office SharePoint Server 2007 and Microsoft Silverlight.wmv@#859374, Context=DHnQ, Context=MxAc, Context=QFid, Context=RqLs, Mid = 77 SMB2: R , Mid = 77 - NT Status: System - Error, Code = (58) STATUS_OBJECT_PATH_NOT_FOUND The main difference seems to be in the name, one is relative to the open file share, the other has gained the gt\files\media prefix which is the name of the DFS target. These failures are always preceded by logoff and back on of the SMB target. Might have to bump this one to PSS.

  Read the article

• iptables (NAT/PAT) setup for SSH & Samba

  - by IanVaughan

  I need to access a Linux box via SSH & Samba that is hidden/connected behind another one. Setup :- A switch B C |----| |---| |----| |----| |eth0|----| |----|eth0| | | |----| |---| |eth1|----|eth1| |----| |----| Eg, SSH/Samba from A to C How does one go about this? I was thinking that it cannot be done via IP alone? Or can it? Could B say "hi on eth0, if your looking for 192.168.0.2, its here on eth1"? Is this NAT? This is a large private network, so what about if another PC has that IP?! More likely it would be PAT? A would say "hi 192.168.109.15:1234" B would say "hi on eth0, traffic for port 1234 goes on here eth1" How could that be done? And would the SSH/Samba demons see the correct packet header info and work?? IP info :- A - eth0 - 192.168.109.2 B - eth0 - B1 = 192.168.109.15 B2 = 172.24.40.130 - eth1 - 192.168.0.1 C - eth1 - 192.168.0.2 A, B & C are RHEL (RedHat) But Windows computers can be connected to the switch. I configured the 192.168.0.* IPs, they are changeable. Update after response from Eddie Few problems (and Machines' B IP is different!) From A :- ssh 172.24.40.130 works ok, (can get to B2) but ssh 172.24.40.130 -p 2022 -vv times out with :- OpenSSH_4.3p2, OpenSSL 0.9.8e-fips-rhel5 01 Jul 2008 debug1: Reading configuration data /etc/ssh/ssh_config debug1: Applying options for * debug2: ssh_connect: needpriv 0 debug1: Connecting to 172.24.40.130 [172.24.40.130] port 2022. ...wait ages... debug1: connect to address 172.24.40.130 port 2022: Connection timed out ssh: connect to host 172.24.40.130 port 2022: Connection timed out From B2 :- $ service iptables status Table: filter Chain INPUT (policy ACCEPT) num target prot opt source destination Chain FORWARD (policy ACCEPT) num target prot opt source destination 1 ACCEPT tcp -- 0.0.0.0/0 192.168.0.2 tcp dpt:22 Chain OUTPUT (policy ACCEPT) num target prot opt source destination Table: nat Chain PREROUTING (policy ACCEPT) num target prot opt source destination 1 DNAT tcp -- 0.0.0.0/0 0.0.0.0/0 tcp dpt:2022 to:192.168.0.2:22 Chain POSTROUTING (policy ACCEPT) num target prot opt source destination Chain OUTPUT (policy ACCEPT) num target prot opt source destination And ssh from B2 to C works fine :- $ ssh 192.168.0.2 Route info :- $ route Kernel IP routing table Destination Gateway Genmask Flags Metric Ref Use Iface 192.168.0.0 * 255.255.255.0 U 0 0 0 eth1 172.24.40.0 * 255.255.255.0 U 0 0 0 eth0 169.254.0.0 * 255.255.0.0 U 0 0 0 eth1 default 172.24.40.1 0.0.0.0 UG 0 0 0 eth0 $ ip route 192.168.0.0/24 dev eth1 proto kernel scope link src 192.168.0.1 172.24.40.0/24 dev eth0 proto kernel scope link src 172.24.40.130 169.254.0.0/16 dev eth1 scope link default via 172.24.40.1 dev eth0 So I just dont know why the port forward doesnt work from A to B2?

  Read the article

• Can't install NPM after installing Node on EC2 Linux instance?

  - by frequent

  I'm trying my first attempt on getting a node server set up on an amazon ec2 linux instance. I think I made it quite far. First problem I ran into was when trying to make Node the connection timed out after a while, so I need three attempts until I got this: LINK(target) /home/ec2-user/node/out/Release/node: Finished touch /home/ec2-user/node/out/Release/obj.target/node_dtrace_header.stamp touch /home/ec2-user/node/out/Release/obj.target/node_dtrace_provider.stamp touch /home/ec2-user/node/out/Release/obj.target/node_dtrace_ustack.stamp touch /home/ec2-user/node/out/Release/obj.target/node_etw.stamp make[1]: Leaving directory `/home/ec2-user/node/out' ln -fs out/Release/node node Which tells me, "Node is done", although I'm not sure it is also working as it should. Following this,this and this tutorial, I'm now stuck at installing npm. I think I first cloned into the wrong folder, which always gave me error 127, but even if I'm doing this: cd ~ git clone git://github.com/isaacs/npm.git cd npm sudo -s PATH=/usr/local/bin:$PATH make install I'm still getting this: #after cloning# make[1]: Entering directory `/root/npm' node cli.js install bash: node: command not found make[1]: *** [node_modules/.bin/ronn] Error 127 make[1]: Leaving directory `/root/npm' make: *** [man/man3/start.3] Error 2 Question:: Since I'm pretty much a newby at everything I'm trying here, can someone please tell me what I'm doing wrong and how to get npm to install? Also, in case I cloned into the wrong folder, is there a way to remove the "false clone" or is this not written to disk until I call make install and I don't need to worry? Thanks for helping out!

  Read the article

• Windows computer account appears to reset its own password, why?

  - by David Yu

  Has anyone seen this where a computer account appears to reset its password? The password for user 'WEST\SQLCLUSTER$' was reset by 'WEST\SQLCLUSTER$' on 'DOMAINCONTROLLER.WEST.company.corp' at '04/23/10 20:47:41' Event Type: Success Audit Event Source: Security Event Category: Account Management Event ID: 628 Date: Friday, April 23, 2010 Time: 8:47 PM User: WEST\SQLCLUSTER$ Computer: DOMAINCONTROLLER.WEST.company.corp Description: User Account password set: Target Account Name: SQLCLUSTER$ Target Domain: WEST Target Account ID: WEST\SQLCLUSTER$ Caller User Name: SQLCLUSTER$ Caller Domain: WEST Caller Logon ID: (0x0,0x7A518945)

  Read the article

• Variable directory names over SCP

  - by nedm

  We have a backup routine that previously ran from one disk to another on the same server, but have recently moved the source data to a remote server and are trying to replicate the job via scp. We need to run the script on the target server, and we've set up key-based scp (no username/password required) between the two servers. Using scp to copy specific files and directories works perfectly: scp -r -p -B [email protected]:/mnt/disk1/bsource/filename.txt /mnt/disk2/btarget/ However, our previous routine iterates through directories on the source disk to determine which files to copy, then runs them individually through gpg encryption. Is there any way to do this only by using scp? Again, this script needs to run from the target server, and the user the job runs under only has scp (no ssh) access to the target system. The old job would look something like this: #Change to source dir cd /mnt/disk1 #Create variable to store # directories named by date YYYYMMDD j="20000101/" #Iterate though directories in the current dir # to get the most recent folder name for i in $(ls -d */); do if [ "$j" \< "$i" ]; then j=${i%/*} fi done #Encrypt individual files from $j to target directory cd ./${j%%}/bsource/ for k in $(ls -p | grep -v /$); do sudo /usr/bin/gpg -e -r "Backup Key" --batch --no-tty -o "/mnt/disk2/btarget/$k.gpg" "$/mnt/disk1/$j/bsource/$k" done Can anyone suggest how to do this via scp from the target system? Thanks in advance.

  Read the article

• Resize videos with different widths to a fixed height preserving aspect ratio with ffmpeg

  - by Axarydax

  I'd like to convert a lot of video files to flash video for our company's website. I have a requirement that all of the videos must be in 360p format, so their size would be Nx360. FFMpeg uses -s argument to specify target resolution as WxH. I don't know Width, as it depends on source file aspect ratio. If source is 640x480, target will be 480x360. If source is 848x480, target will be 636x360. Is there a way to do it with some switch of ffmpeg? That it will preserve aspect ratio and I'll only specify the height of target video? I could easily solve it by making a program that will launch ffprobe to get source video size, calculate aspect ratio and then calculate a new width.

  Read the article

• BUILDROOT files during RPM generation

  - by khmarbaise

  Currently i have the following spec file to create a RPM. The spec file is generated by maven plugin to produce a RPM out of it. The question is: will i find files which are mentioned in the spec file after the rpm generation inside the BUILDROOT/SPECS/SOURCES/SRPMS structure? %define _unpackaged_files_terminate_build 0 Name: rpm-1 Version: 1.0 Release: 1 Summary: rpm-1 License: 2009 my org Distribution: My App Vendor: my org URL: www.my.org Group: Application/Collectors Packager: my org Provides: project Requires: /bin/sh Requires: jre >= 1.5 Requires: BASE_PACKAGE PreReq: dependency Obsoletes: project autoprov: yes autoreq: yes BuildRoot: /home/build/.jenkins/jobs/rpm-maven-plugin/workspace/target/it/rpm-1/target/rpm/rpm-1/buildroot %description %install if [ -e $RPM_BUILD_ROOT ]; then mv /home/build/.jenkins/jobs/rpm-maven-plugin/workspace/target/it/rpm-1/target/rpm/rpm-1/tmp-buildroot/* $RPM_BUILD_ROOT else mv /home/build/.jenkins/jobs/rpm-maven-plugin/workspace/target/it/rpm-1/target/rpm/rpm-1/tmp-buildroot $RPM_BUILD_ROOT fi ln -s /usr/myusr/app $RPM_BUILD_ROOT/usr/myusr/app2 ln -s /tmp/myapp/somefile $RPM_BUILD_ROOT/tmp/myapp/somefile2 ln -s name.sh $RPM_BUILD_ROOT/usr/myusr/app/bin/oldname.sh %files %defattr(-,myuser,mygroup,-) %dir "/usr/myusr/app" "/usr/myusr/app2" "/tmp/myapp/somefile" "/tmp/myapp/somefile2" "/usr/myusr/app/lib" %attr(755,myuser,mygroup) "/usr/myusr/app/bin/start.sh" %attr(755,myuser,mygroup) "/usr/myusr/app/bin/filter-version.txt" %attr(755,myuser,mygroup) "/usr/myusr/app/bin/name.sh" %attr(755,myuser,mygroup) "/usr/myusr/app/bin/name-Linux.sh" %attr(755,myuser,mygroup) "/usr/myusr/app/bin/filter.txt" %attr(755,myuser,mygroup) "/usr/myusr/app/bin/oldname.sh" %dir "/usr/myusr/app/conf" %config "/usr/myusr/app/conf/log4j.xml" "/usr/myusr/app/conf/log4j.xml.deliver" %prep echo "hello from prepare" %pre -p /bin/sh #!/bin/sh if [ -s "/etc/init.d/myapp" ] then /etc/init.d/myapp stop rm /etc/init.d/myapp fi %post #!/bin/sh #create soft link script to services directory ln -s /usr/myusr/app/bin/start.sh /etc/init.d/myapp chmod 555 /etc/init.d/myapp %preun #!/bin/sh #the argument being passed in indicates how many versions will exist #during an upgrade, this value will be 1, in which case we do not want to stop #the service since the new version will be running once this script is called #during an uninstall, the value will be 0, in which case we do want to stop #the service and remove the /etc/init.d script. if [ "$1" = "0" ] then if [ -s "/etc/init.d/myapp" ] then /etc/init.d/myapp stop rm /etc/init.d/myapp fi fi; %triggerin -- dependency, dependency1 echo "hello from install" %changelog * Tue May 23 2000 Vincent Danen <[email protected]> 0.27.2-2mdk -update BuildPreReq to include rep-gtk and rep-gtkgnome * Thu May 11 2000 Vincent Danen <[email protected]> 0.27.2-1mdk -0.27.2 * Thu May 11 2000 Vincent Danen <[email protected]> 0.27.1-2mdk -added BuildPreReq -change name from Sawmill to Sawfish The problem i found is that the files (filter.txt in particular) after the generation process on a Ubuntu system but not on SuSE system. Which might be caused by different rpm versions ? Currently we have an integration test which fails based on the non existing of the file (filter.txt under a buildroot folder?)

  Read the article

• How to unblock outgoing HTTP and HTTPS traffic in iptables?

  - by EApubs

  With the following iptable rules, I was unable to do an apt update and ping a website. Whats wrong with the rules? How to fix it? What is the exact rule to fix it? Chain INPUT (policy ACCEPT) target prot opt source destination ACCEPT tcp -- anywhere anywhere tcp dpt:325 DROP all -- anywhere anywhere Chain FORWARD (policy DROP) target prot opt source destination Chain OUTPUT (policy ACCEPT) target prot opt source destination

  Read the article

• Kernel Logging disabled?

  - by Tiffany Walker

  uname -a Linux host 2.6.32-279.9.1.el6.i686 #1 SMP Tue Sep 25 20:26:47 UTC 2012 i686 i686 i386 GNU/Linux And start ups: ls /etc/init.d/ abrt-ccpp certmonger dovecot irqbalance matahari-broker mdmonitor nfs proftpd rpcbind single ypbind abrtd cgconfig functions kdump matahari-host messagebus nfslock psacct rpcgssd smartd abrt-oops cgred haldaemon killall matahari-network mysqld ntpd qpidd rpcidmapd sshd acpid cpuspeed halt ktune matahari-rpc named ntpdate quota_nld rpcsvcgssd sssd atd crond httpd lfd ma tahari-service netconsole oddjobd rdisc rsyslog sysstat auditd csf ip6tables lvm2-lvmetad matahari-sysconfig netfs portreserve restorecond sandbox tuned autofs cups iptables lvm2-monitor matahari-sysconfig-console network postfix rngd saslauthd udev-post But when I installed CSF/LFD I am getting nothing. LFD does not create lfd.log and nor are any blocks being logged in /var/log/messages either from the firewall. This is not natural. I looked for klogd but maybe I am looking in the wrong place for it to see if it is enabled? ls /etc/init.d/syslog ls: cannot access /etc/init.d/syslog: No such file or directory Also noticed no syslog? Also noticed this: csf -d 84.113.21.201 Adding 84.113.21.201 to csf.deny and iptables DROP... iptables: No chain/target/match by that name. iptables: No chain/target/match by that name. I've never seen this before and this is a dedicated box. Also: ./csftest.pl Testing ip_tables/iptable_filter...OK Testing ipt_LOG...OK Testing ipt_multiport/xt_multiport...OK Testing ipt_REJECT...OK Testing ipt_state/xt_state...OK Testing ipt_limit/xt_limit...OK Testing ipt_recent...OK Testing xt_connlimit...OK Testing ipt_owner/xt_owner...OK Testing iptable_nat/ipt_REDIRECT...OK Testing iptable_nat/ipt_DNAT...OK RESULT: csf should function on this server iptables -L Chain INPUT (policy ACCEPT) target prot opt source destination Chain FORWARD (policy ACCEPT) target prot opt source destination Chain OUTPUT (policy ACCEPT) target prot opt source destination

  Read the article

• Nginx proxy cache (proxy_pass $request_uri;)

  - by imastar

  I need to create proxy web using nginx. If I access http://myweb.com/http://www.target.com/ the proxy_pass should be http://www.target.com/ Here is my configuration: location / { proxy_pass $request_uri; proxy_cache_methods GET; proxy_set_header Referer "$request_uri"; proxy_redirect off; proxy_set_header X-Real-IP $remote_addr; proxy_set_header X-Forwarded-For $proxy_add_x_forwarded_for; proxy_ignore_headers Cache-Control; proxy_hide_header Pragma; proxy_hide_header Set-Cookie; proxy_set_header Cache-Control Public; proxy_cache cache; proxy_cache_valid 200 10h; proxy_cache_valid 301 302 1h; proxy_cache_valid any 1h; } Here is the log error 2013/02/05 12:58:51 [error] 2118#0: *8 invalid URL prefix in "/http://www.target.com/", client: 108.59.8.83, server: myweb.com, request: "HEAD /http://www.target.com/ HTTP/1.1", host: "myweb.com"

  Read the article

• KVM + Cloudmin + IpTables

  - by Alex

  I have a KVM virtualization on a machine. I use Ubuntu Server + Cloudmin (in order to manage virtual machine instances). On a host system I have four network interfaces: ebadmin@saturn:/var/log$ ifconfig br0 Link encap:Ethernet HWaddr 10:78:d2:ec:16:38 inet addr:192.168.0.253 Bcast:192.168.0.255 Mask:255.255.255.0 inet6 addr: fe80::1278:d2ff:feec:1638/64 Scope:Link UP BROADCAST RUNNING MULTICAST MTU:1500 Metric:1 RX packets:589337 errors:0 dropped:0 overruns:0 frame:0 TX packets:334357 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:0 RX bytes:753652448 (753.6 MB) TX bytes:43385198 (43.3 MB) br1 Link encap:Ethernet HWaddr 6e:a4:06:39:26:60 inet addr:192.168.10.1 Bcast:192.168.10.255 Mask:255.255.255.0 inet6 addr: fe80::6ca4:6ff:fe39:2660/64 Scope:Link UP BROADCAST RUNNING MULTICAST MTU:1500 Metric:1 RX packets:16995 errors:0 dropped:0 overruns:0 frame:0 TX packets:13309 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:0 RX bytes:2059264 (2.0 MB) TX bytes:1763980 (1.7 MB) eth0 Link encap:Ethernet HWaddr 10:78:d2:ec:16:38 UP BROADCAST RUNNING MULTICAST MTU:1500 Metric:1 RX packets:610558 errors:0 dropped:0 overruns:0 frame:0 TX packets:332382 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:1000 RX bytes:769477564 (769.4 MB) TX bytes:44360402 (44.3 MB) Interrupt:20 Memory:fe400000-fe420000 lo Link encap:Local Loopback inet addr:127.0.0.1 Mask:255.0.0.0 inet6 addr: ::1/128 Scope:Host UP LOOPBACK RUNNING MTU:16436 Metric:1 RX packets:239632 errors:0 dropped:0 overruns:0 frame:0 TX packets:239632 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:0 RX bytes:50738052 (50.7 MB) TX bytes:50738052 (50.7 MB) tap0 Link encap:Ethernet HWaddr 6e:a4:06:39:26:60 inet6 addr: fe80::6ca4:6ff:fe39:2660/64 Scope:Link UP BROADCAST RUNNING MULTICAST MTU:1500 Metric:1 RX packets:17821 errors:0 dropped:0 overruns:0 frame:0 TX packets:13703 errors:0 dropped:0 overruns:0 carrier:0 collisions:0 txqueuelen:500 RX bytes:2370468 (2.3 MB) TX bytes:1782356 (1.7 MB) br0 is connected to a real network, br1 is used to create a private network shared between guest systems. Now I need to configure iptables for network access. First of all I allow ssh sessions on port 8022 on the host system, then I allow all connections in state RELATED, ESTABLISHED. This is working ok. I install another system as guest, it's IP address is 192.168.10.2, and now I have two problems: I want to allow the access from this host to the outside world, cannot accomplish this. I can ssh from the host. I want to be able to ssh to the guest from the outside world using 8023 port. Cannot accomplish this. Full iptables configuration is following: ebadmin@saturn:/var/log$ sudo iptables --list [sudo] password for ebadmin: Chain INPUT (policy DROP) target prot opt source destination ACCEPT all -- anywhere anywhere ACCEPT tcp -- anywhere anywhere tcp dpt:8022 ACCEPT all -- anywhere anywhere state RELATED,ESTABLISHED LOG all -- anywhere anywhere LOG level warning Chain FORWARD (policy ACCEPT) target prot opt source destination LOG all -- anywhere anywhere LOG level warning Chain OUTPUT (policy ACCEPT) target prot opt source destination LOG all -- anywhere anywhere LOG level warning ebadmin@saturn:/var/log$ sudo iptables -t nat --list Chain PREROUTING (policy ACCEPT) target prot opt source destination DNAT tcp -- anywhere anywhere tcp spt:8023 to:192.168.10.2:22 Chain INPUT (policy ACCEPT) target prot opt source destination Chain OUTPUT (policy ACCEPT) target prot opt source destination Chain POSTROUTING (policy ACCEPT) target prot opt source destination The worst of all is that I don't know how to interpret iptables logs. I don't see the final decision of the firewall. Need help urgently.

  Read the article

• SQL 2000 and group names

  - by Nasa

  I have a SQL 2000 server which has databases, under user section of the database object, I have some NT 4.0 groups. These groups were migrated over to Active Directory some time ago using ADMT with SID history. The original source domain groups have since been deleted. The access shown is olddomain\groupname. I don't know why, if they were ntfs permissions they would update automatically to target\groupname. The users in the AD domain still have access to the database as they are a member of the migrated group (Target\groupname). I was wondering 1) Why does the old group (source\groupname) show up as it doesn't exist anymore. But access is still granted to the target group? 2) Is there any easy way to update the group name from source\groupname to target\groupname? Thanks for any help.

  Read the article

• iptables not writing rules.

  - by Darkmage

  im running these two rules as root, but when doing a iptables -L it dosent show any rules, any one have an idea of what the problem can be? iptables -A PREROUTING -t nat -i eth0 -p tcp --dport 80 --source 84.244.145.135 -j REDIRECT --to-port 1222 iptables -A PREROUTING -t nat -i eth0 -p tcp --dport 80 --source 243.134.97.194 -j REDIRECT --to-port 1222 duno@Virtual-Box:/home/glennwiz# iptables -L Chain INPUT (policy ACCEPT) target prot opt source destination Chain FORWARD (policy ACCEPT) target prot opt source destination Chain OUTPUT (policy ACCEPT) target prot opt source destination

  Read the article

• How can I slightly delay the pop up of the task bar?

  - by Xavierjazz

  Windows XP SP3 Many times as I head to the bottom of my desktop, I will slightly overshoot the target at the bottom and the task bar will pop up, hiding the target. I then have to move the cursor out of it so it retreats and then again try to access the target. Is there a way to add an interval, say, 1 second, to the task bar popping up so I can adjust to the target before the task bar covers it? EDIT: as per my answer below, "What I ended up doing is just docking it on the LH side of the screen. There is no change in response but I don't go to that location so often so it's much better.".

  Read the article

< Previous Page | 31 32 33 34 35 36 37 38 39 40 41 42  | Next Page >