Search Results

Search found 76075 results on 3043 pages for 'file path'.

Page 351/3043 | < Previous Page | 347 348 349 350 351 352 353 354 355 356 357 358  | Next Page >

• 503 (Server Unavailable) WebException when loading local XHTML file

  - by kcoppock

  Hello! So I'm currently working on an ePub reader application, and I've been reading through a bunch of regular XML files just fine with System.Xml and XmlDocument: XmlDocument xmldoc = new XmlDocument(); xmldoc.Load(Path.Combine(Directory.GetCurrentDirectory(), "META-INF/container.xml")); XmlNodeList xnl = xmldoc.GetElementsByTagName("rootfile"); However, now I'm trying to open the XHTML files that contain the actual book text, and they're XHTML files. Now I don't really know the difference between the two, but I'm getting the following error with this code (in the same document, using the same XmlDocument and XmlNodeList variable) xmldoc.Load(Path.Combine(Directory.GetCurrentDirectory(), "OEBPS/part1.xhtml")); "WebException was unhandled: The remote server returned an error: (503) Server Unavailable" It's a local document, so I'm not understanding why it's giving this error? Any help would be greatly appreciated. :) I've got the full source code here if it helps: http://drop.io/epubtest (I know the ePubConstructor.ParseDocument() method is horribly messy, I'm just trying to get it working at the moment before I split it into classes)

  Read the article

• AccessControlException: access denied - caller function failed to load properties file

  - by Michael Mao

  Hi all: I am having a jar archive environment which is gonna call my class in a folder like this: java -jar "emarket.jar" ../tournament 100 My compiled class is deployed into the ../tournament folder, this command runs well. After I changed my code to load a properties file, it gets the following exception message: Exception in thread "main" java.security.AccessControlException: access denied (java.io.FilePermission agent.properties read) at java.security.AccessControlContext.checkPermission(Unknown Source) at java.security.AccessController.checkPermission(Unknown Source) at java.lang.SecurityManager.checkPermission(Unknown Source) at java.lang.SecurityManager.checkRead(Unknown Source) at java.io.FileInputStream.<init>(Unknown Source) at java.io.FileInputStream.<init>(Unknown Source) at Agent10479475.getPropertiesFromConfigFile(Agent10479475.java:110) at Agent10479475.<init>(Agent10479475.java:100) at sun.reflect.NativeConstructorAccessorImpl.newInstance0(Native Method) at sun.reflect.NativeConstructorAccessorImpl.newInstance(Unknown Source) at sun.reflect.DelegatingConstructorAccessorImpl.newInstance(Unknown Source) at java.lang.reflect.Constructor.newInstance(Unknown Source) at java.lang.Class.newInstance0(Unknown Source) at java.lang.Class.newInstance(Unknown Source) at emarket.client.EmarketSandbox.instantiateClientObjects(EmarketSandbox.java:92) at emarket.client.EmarketSandbox.<init>(EmarketSandbox.java:27) at emarket.client.EmarketSandbox.main(EmarketSandbox.java:166) I am wondering why this security checking will fail. I issue the getPropertitiesFromConfigFile() function inside my class's default constructor, like this: public class Agent10479475 extends AbstractClientAgent { //default constructor public Agent10479475() { //set all properties to their default values in constructor FT_THRESHOLD = 400; FT_THRESHOLD_MARGIN = 50; printOut("Now loading properties from a config file...", ""); getPropertiesFromConfigFile(); printOut("Finished loading",""); } private void getPropertiesFromConfigFile() { Properties props = new Properties(); try { props.load(new FileInputStream("agent.properties")); FT_THRESHOLD = Long.parseLong(props.getProperty("FT_THRESHOLD")); FT_THRESHOLD_MARGIN = Long.parseLong(props.getProperty("FT_THRESHOLD_MARGIN ")); } catch(java.io.FileNotFoundException fnfex) { printOut("CANNOT FIND PROPERTIES FILE :", fnfex); } catch(java.io.IOException ioex) { printOut("IOEXCEPTION OCCURED :", ioex); } } } My class is loading its own .properties file under the same folder. why would the Java environment complains about such a denial of access? Must I config the emarket.client.EmarketSandbox class, which is not written by me and stored inside the emarket.jar, to access my agent.properties file? Any hints or suggestions is much appreciated. Many thanks in advance.

  Read the article

• Joomla - Force File Download / CSV Export

  - by lautaro.dragan

  I'm in need of help... this is my first time asking a question in SO, so please be kind :) I'm trying to force-download a file from php, so when the user hits a certain button, he gets a file download. The file is a csv (email, username) of all registered users. I decided to add this button to the admin users screen, as you can see in this screenshot. So I added the following code to the addToolbar function in administrator/components/com_users/views/users/view.html.php: JToolBarHelper::custom('users.export', 'export.png', 'export_f2.png', 'Exportar', false); This button is mapped to the following function in the com_users\controller\users.php controller: public function exportAllUsers() { ob_end_clean(); $app = JFactory::getApplication(); header("Content-type: text/csv"); header("Content-Disposition: attachment; filename=ideary_users.csv"); header("Pragma: no-cache"); header("Expires: 0"); echo "email,name\n"; $model = $this->getModel("Users"); $users = $model->getAllUsers(); foreach ($users as $user) { echo $user->email . ", " . ucwords(trim($user->name)) . "\r\n"; } $app->close(); } Now, this is actually working perfectly fine. The issue here is that after I download a file, if I hit any button in the admin that causes a POST, instead of it performing the action it should, it just downloads the file over again! For example: I hit the "Export" button "users.csv" downloads Then, I hit the "search" button "users.csv" downloads... what the hell? I'm guessing that when I hit the export button, a JS gets called and sets a form's action attribute to an URL... and expects a response or something, and then other button's are prevented from re-setting the form's action attribute. I can't think of any real solution for this, but I'd rather avoid hacks if possible. So, what would be the standard, elegant solution that joomla offers in this case?

  Read the article

• In MVC view page javascript file url not resolving

  - by Ashwani K

  Hello All: I have one MVC view page in which I show different links and I am using ThickBox to show a different page when ever one of these links is clicked. In these pages, I am using jQuery functions to do some changes, but I am not able to resolve the jquery file path on the view pages. I need to give absolute path something like "http://test.com/js/jquery.js". But is there any way to make it relative? I also tried getting the host url and using <%=% and <%# % but none is working. Any help? Thanks Ashwani

  Read the article

• PHP uploads file - enctype="multipart/form-data" issue

  - by user147685

  Hi all, I have this upload code. there are no problem running it individually, but when i try to add into my other codes, it did not get the $_files parameter. Im guessing it was becoz of enctype="multipart/form-data" in the form tag, based on this post: http://stackoverflow.com/questions/1695246/why-file-upload-didnt-work-without-enctype the enctype is needed. SO my problem is, how can i do upload files without concern to this? can we juz change the code structure so that it will be compatible with other codes? if($_POST['check']){ $faillampiran=$_POST['faillampiran']; $file=$_FILES['faillampiran']["name"]; $fileSize = $_FILES['faillampiran']['size']; $fileType = $_FILES['faillampiran']['type']; if ($_FILES["faillampiran"]["error"] > 0 ) { echo "Return Code: " . $_FILES["faillampiran"]["error"] . "<br />"; } else { move_uploaded_file($_FILES["faillampiran"]["tmp_name"],"upload/" . $_FILES["faillampiran"]["name"]); echo '<table align = "center">'; echo "<tr><td>"; echo "Your file has been successfully stored."; echo "</td></tr>"; echo '</table>'; } } ?> <form method="post" name="form1" id="form1" enctype="multipart/form-data"> <tr><td></td><td><input type="hidden" name="MAX_FILE_SIZE" value=""> </td> </tr> <tr><td> Please choose a file</td><td>:</td></tr> <tr> <input type="file" size="50" name="faillampiran" alt="faillampiran" id="faillampiran" 1value= "<?=$faillampiran;?>" /> <tr align = "center"><td colspan = "3"><input type="submit" value="Hantar" name="check"/></td></tr> </tr></form> thank you.

  Read the article

• How can I limit the cache used by copying so there is still memory available for other cache?

  - by Peter

  Basic situation: I am copying some NTFS disks in openSuSE. Each one is 2TB. When I do this, the system runs slow. My guesses: I believe it is likely due to caching. Linux decides to discard useful cache (eg. kde4 bloat, virtual machine disks, LibreOffice binaries, Thunderbird binaries, etc.) and instead fill all available memory (24 GB total) with stuff from the copying disks, which will be read only once, then written and never used again. So then any time I use these apps (or kde4), the disk needs to be read again, and reading the bloat off the disk again makes things freeze/hiccup. Due to the cache being gone and the fact that these bloated applications need lots of cache, this makes the system horribly slow. Since it is USB,the disk and disk controller are not the bottleneck, so using ionice does not make it faster. I believe it is the cache rather than just the motherboard going too slow, because if I stop everything copying, it still runs choppy for a while until it recaches everything. And if I restart the copying, it takes a minute before it is choppy again. But also, I can limit it to around 40 MB/s, and it runs faster again (not because it has the right things cached, but because the motherboard busses have lots of extra bandwidth for the system disks). I can fully accept a performance loss from my motherboard's IO capability being completely consumed (which is 100% used, meaning 0% wasted power which makes me happy), but I can't accept that this caching mechanism performs so terribly in this specific use case. # free total used free shared buffers cached Mem: 24731556 24531876 199680 0 8834056 12998916 -/+ buffers/cache: 2698904 22032652 Swap: 4194300 24764 4169536 I also tried the same thing on Ubuntu, which causes a total system hang instead. ;) And to clarify, I am not asking how to leave memory free for the "system", but for "cache". I know that cache memory is automatically given back to the system when needed, but my problem is that it is not reserved for caching of specific things. Question: Is there some way to tell these copy operations to limit memory usage so some important things remain cached, and therefore any slowdowns are a result of normal disk usage and not rereading the same commonly used files? For example, is there a setting of max memory per process/user/file system allowed to be used as cache/buffers?

  Read the article

• How to play small sound file continuously in Silverlight?

  - by ash

  Hello, I have two questions regarding Silverlight's SoundPlay action and properties. My scenario is like: I have two story board: The first story board has an image and a sound file; when the silverlight application gets loaded, the sound starts to play automatically, but if someone clicks the image, the sound file will stop and the second storyboard will start with a new sound file. 1) My first question is how to stop the first sound file of first story board when the second story board starts with the second sound file. 2) My second question is how to play a sound file continuously; for example, in Silverlight we can play a story board continuously with RepeatBehavior="Forever"; but I cannot find a way to play my 10 second sound file forever or continuously. Note: I have attached a small XAML file to show what I am talking about; I am also stating that if instead of an image file, if there were a button, then I can stop the first music file after I click the button and start my second story board with a new sound file, but I would like to use image file instead of a button. Is it possible? If it is, how to do it? Therefore, please answer my following two questions or give big hint or website tutorial links on 1) How to stop the first sound file of first story board when the second story board starts with the second sound file ( When the clickable element is an image instead of a button) 2) How to play a 10 second sound file continuously? ............Code Snippet...................... XAML ............ <Grid x:Name="LayoutRoot" Background="Red"> <Button HorizontalAlignment="Left" Margin="212,0,0,111" VerticalAlignment="Bottom" Width="75" Content="Button" Click="onClick"/> <MediaElement x:Name="sound2_mp3" Height="0" HorizontalAlignment="Left" Margin="105,230,0,0" VerticalAlignment="Top" Width="0" Source="/sound2.mp3" Stretch="Fill"/> <MediaElement x:Name="sound1_mp1" Height="0" HorizontalAlignment="Left" Margin="190,164,0,0" VerticalAlignment="Top" Width="0" Source="/sound1.mp3" Stretch="Fill" AutoPlay="False"/> </Grid> ..................................................................................................................................................................................................................... using System; using System.Windows; using System.Windows.Controls; using System.Windows.Documents; using System.Windows.Ink; using System.Windows.Input; using System.Windows.Media; using System.Windows.Media.Animation; using System.Windows.Shapes; namespace testPrj { public partial class MainPage : UserControl { public MainPage() { // Required to initialize variables InitializeComponent(); } private void onClick(object sender, System.Windows.RoutedEventArgs e) { Storyboard1.Stop(); sound2_mp3.Stop(); sound1_mp1.Play(); } } } ...................................................................................................

  Read the article

• Assembly.CodeBase: when is it no file-URI?

  - by Marc Wittke

  Assembly.Location gives a plain path to the assembly. Unfortunately this is empty when running in a shadowed environment, such as unit test or ASP.NET. Hovever, the Codebase property is available and provides a URI that can be used instead. In which cases it returns no URI starting with file:///? Or in other words: what are the cases in which this won't work or will return unusable results? Assembly assembly = GetType().Assembly; Uri codeBaseUri = new Uri(assembly.CodeBase); string path = codeBaseUri.LocalPath;

  Read the article

• Binary file reading problem

  - by ScReYm0

  Ok i have problem with my code for reading binary file... First i will show you my writing code: void book_saving(char *file_name, struct BOOK *current) { FILE *out; BOOK buf; out = fopen(file_name, "wb"); if(out != NULL) { printf_s("Writting to file..."); do { if(current != NULL) { strcpy(buf.catalog_number, current->catalog_number); strcpy(buf.author, current->author); buf.price = current->price; strcpy(buf.publisher, current->publisher); strcpy(buf.title, current->title); buf.price = current->year_published; fwrite(&buf, sizeof(BOOK), 1, out); } current = current->next; }while(current != NULL); printf_s("Done!\n"); fclose(out); } } and here is my "version" for reading it back: int book_open(struct BOOK *current, char *file_name) { FILE *in; BOOK buf; BOOK *vnext; int count; int i; in = fopen("west", "rb"); printf_s("Reading database from %s...", file_name); if(!in) { printf_s("\nERROR!"); return 1; } i = fread(&buf,sizeof(BOOK), 1, in); while(!feof(in)) { if(current != NULL) { current = malloc(sizeof(BOOK)); current->next = NULL; } strcpy(current->catalog_number, buf.catalog_number); strcpy(current->title, buf.title); strcpy(current->publisher, buf.publisher); current->price = buf.price; current->year_published = buf.year_published; fread(&buf, 1, sizeof(BOOK), in); while(current->next != NULL) current = current->next; fclose(in); } printf_s("Done!"); return 0; } I just need to save my linked list in binary file and to be able to read it back ... please help me. The program just don't read it or its crash every time different situation ...

  Read the article

• Playing audio from a wav file in iPhone SpeakHere example

  - by Mo

  I'm working with the iPhone SpeakHere example, and I would like to be able to play audio from either the mic (as in the example) or from a wav file. I have working code to play from a particular wav file, which looks like this: NSString *path = [[NSBundle mainBundle] pathForResource:@"basketBall" ofType:@"wav"]; AVAudioPlayer* theAudio=[[AVAudioPlayer alloc] initWithContentsOfURL:[NSURL fileURLWithPath:path] error:NULL]; theAudio.delegate = self; [theAudio play]; So I'm fine with actually getting the wav to play in the application (I can hook it up to a button, etc.) but I would like it to also behave the same way pushing the "Play" button does after recorded speech, in that it should be connected to the same visualization (which I have modified quite a bit, but essentially shows the current volume, among other things). Thanks for your help!

  Read the article

• How do I make the directories in a zip file relative to the target directory instead of my working directory

  - by Nathan

  I'm calling the zip command from a script where I cannot change directory. I need to make a zip file of the stuff in data/kit123/ from the directory which data resides in, but I want the contents of the zip to only be the contents of kit123, with paths relative to kit123. This is the directory structure myworkingdir data kit123 kitpart1 file.xcf anotherfile.xcf kitpart2 ... kit124 ... My script runs in myworkingdir and cannot change directories. If I call zip -r kit123.zip data/kit123 then the structure in the zip file will be data kit123 kitpart1 file.xcf anotherfile.xcf kitpart2 but I want it to be kit123 kitpart1 file.xcf anotherfile.xcf kitpart2 Is there a zip option I can use to accomplish this? It seems odd that it should depend on my working directory I know it's not -j. that one destroys the structure within kit123

  Read the article

• Database file is inexplicably locked during SQLite commit

  - by sweeney

  Hello, I'm performing a large number of INSERTS to a SQLite database. I'm using just one thread. I batch the writes to improve performance and have a bit of security in case of a crash. Basically I cache up a bunch of data in memory and then when I deem appropriate, I loop over all of that data and perform the INSERTS. The code for this is shown below: public void Commit() { using (SQLiteConnection conn = new SQLiteConnection(this.connString)) { conn.Open(); using (SQLiteTransaction trans = conn.BeginTransaction()) { using (SQLiteCommand command = conn.CreateCommand()) { command.CommandText = "INSERT OR IGNORE INTO [MY_TABLE] (col1, col2) VALUES (?,?)"; command.Parameters.Add(this.col1Param); command.Parameters.Add(this.col2Param); foreach (Data o in this.dataTemp) { this.col1Param.Value = o.Col1Prop; this. col2Param.Value = o.Col2Prop; command.ExecuteNonQuery(); } } this.TryHandleCommit(trans); } conn.Close(); } } I now employ the following gimmick to get the thing to eventually work: private void TryHandleCommit(SQLiteTransaction trans) { try { trans.Commit(); } catch (Exception e) { Console.WriteLine("Trying again..."); this.TryHandleCommit(trans); } } I create my DB like so: public DataBase(String path) { //build connection string SQLiteConnectionStringBuilder connString = new SQLiteConnectionStringBuilder(); connString.DataSource = path; connString.Version = 3; connString.DefaultTimeout = 5; connString.JournalMode = SQLiteJournalModeEnum.Persist; connString.UseUTF16Encoding = true; using (connection = new SQLiteConnection(connString.ToString())) { //check for existence of db FileInfo f = new FileInfo(path); if (!f.Exists) //build new blank db { SQLiteConnection.CreateFile(path); connection.Open(); using (SQLiteTransaction trans = connection.BeginTransaction()) { using (SQLiteCommand command = connection.CreateCommand()) { command.CommandText = DataBase.CREATE_MATCHES; command.ExecuteNonQuery(); command.CommandText = DataBase.CREATE_STRING_DATA; command.ExecuteNonQuery(); //TODO add logging } trans.Commit(); } connection.Close(); } } } I then export the connection string and use it to obtain new connections in different parts of the program. At seemingly random intervals, though at far too great a rate to ignore or otherwise workaround this problem, I get unhandled SQLiteException: Database file is locked. This occurs when I attempt to commit the transaction. No errors seem to occur prior to then. This does not always happen. Sometimes the whole thing runs without a hitch. No reads are being performed on these files before the commits finish. I have the very latest SQLite binary. I'm compiling for .NET 2.0. I'm using VS 2008. The db is a local file. All of this activity is encapsulated within one thread / process. Virus protection is off (though I think that was only relevant if you were connecting over a network?). As per Scotsman's post I have implemented the following changes: Journal Mode set to Persist DB files stored in C:\Docs + Settings\ApplicationData via System.Windows.Forms.Application.AppData windows call No inner exception Witnessed on two distinct machines (albeit very similar hardware and software) Have been running Process Monitor - no extraneous processes are attaching themselves to the DB files - the problem is definitely in my code... Does anyone have any idea whats going on here? I know I just dropped a whole mess of code, but I've been trying to figure this out for way too long. My thanks to anyone who makes it to the end of this question! brian UPDATES: Thanks for the suggestions so far! I've implemented many of the suggested changes. I feel that we are getting closer to the answer...however... The code above technically works however it is non-deterministic! It is not guaranteed to do anything aside from spin in neutral forever. In practice it seems to work somewhere between the 1st and 10th iteration. If i batch my commits at a reasonable interval damage will be mitigated but I really do not want to leave things in this state... More suggestions welcome!

  Read the article

• Missing prop-base file problem

  - by Tony

  I am using Eclipse and SVNSubversion as a repository for a Java project. After updating the local repository and starting Eclipse, an error (in the Problems tab) appeared stating that a specific prop-base file was missing from the build path. Being inexperienced, I have accidentally deleted the prop-base file icon from the project build-path library section. Since then the numbers of errors have grown exponentially... What should I do? Updating the local repository and/or starting a new Eclipse project from the same source did not solve the problem, does anyone have an idea?

  Read the article

• using .htaccess to redirect from friendly url to actual file

  - by Kohalza

  I have the following RewriteRule in my .htaccess to redirect from a friendly url to my main application file: RewriteRule ^\/(.*).html$ home/www/page.php?p=$1 [L] This should send any url that points to a html page to page.php with the url as a parameter that will be parsed by the app. This works for urls that look like http://www.example.com/hello.html The problem is that I get a 404 error when the url contains a directory path, for example: http://www.example.com/category/hello.html The error reads: "File does not exist: /home/www/category" Seems it is first looking for the 'category' path instead of processing the .htaccess Any ideas how to solve this?

  Read the article

• How can I read JSON file from disk and store to array in Swift

  - by Ezekiel Elin

  I want to read a file from Disk in a swift file. It can be a relative or direct path, that doesn't matter. How can I do that? I've been playing with something like this let classesData = NSData .dataWithContentsOfMappedFile("path/to/classes.json"); And it finds the file (i.e. doesn't return nil) but I don't know how to manipulate and convert to JSON, the data returned. It isn't in a string format and String() isn't working on it.

  Read the article

• How to change icons of specific file types on Ubuntu 11.10?

  - by Curious Apprentice

  I want to change file icons of some specific file types like- .html, .css etc. I have tried using "File Type Editor (assogiate)" which is not working. I have also tried using "Gnome Tweak Tool" using icon themes. But that also does not worked properly (Though I can change folder icons , dash menu icons but not file icons). Please suggest me a way so that I can change file icons properly. I have read some of the articles saying about some mime type changes. I could not get proper guide from any of those articles. If there is such a way then please write in detail. Many Many Thanks in Advance :)

  Read the article

• Server Error Message: No File Access

  - by iMayne

  Hello. Im having an issues but dont know where to solve it. My template works great in xampp but not on the host server. I get this message: Warning: file_get_contents() [function.file-get-contents]: URL file-access is disables in the server configuration in homepage/......./twitter.php. The error is on line 64. <?php /* For use in the "Parse Twitter Feeds" code below */ define("SECOND", 1); define("MINUTE", 60 * SECOND); define("HOUR", 60 * MINUTE); define("DAY", 24 * HOUR); define("MONTH", 30 * DAY); function relativeTime($time) { $delta = time() - $time; if ($delta < 2 * MINUTE) { return "1 min ago"; } if ($delta < 45 * MINUTE) { return floor($delta / MINUTE) . " min ago"; } if ($delta < 90 * MINUTE) { return "1 hour ago"; } if ($delta < 24 * HOUR) { return floor($delta / HOUR) . " hours ago"; } if ($delta < 48 * HOUR) { return "yesterday"; } if ($delta < 30 * DAY) { return floor($delta / DAY) . " days ago"; } if ($delta < 12 * MONTH) { $months = floor($delta / DAY / 30); return $months <= 1 ? "1 month ago" : $months . " months ago"; } else { $years = floor($delta / DAY / 365); return $years <= 1 ? "1 year ago" : $years . " years ago"; } } /* Parse Twitter Feeds */ function parse_cache_feed($usernames, $limit, $type) { $username_for_feed = str_replace(" ", "+OR+from%3A", $usernames); $feed = "http://twitter.com/statuses/user_timeline.atom?screen_name=" . $username_for_feed . "&count=" . $limit; $usernames_for_file = str_replace(" ", "-", $usernames); $cache_file = dirname(__FILE__).'/cache/' . $usernames_for_file . '-twitter-cache-' . $type; if (file_exists($cache_file)) { $last = filemtime($cache_file); } $now = time(); $interval = 600; // ten minutes // check the cache file if ( !$last || (( $now - $last ) > $interval) ) { // cache file doesn't exist, or is old, so refresh it $cache_rss = file_get_contents($feed); (this is line 64) Any help on how to give this access on my host server?

  Read the article

• Java regex replace multiple file paths in a large String

  - by Joe Goble

  So a Regex pro I am not, and I'm looking for a good way to do this. I have a large string which contains a variable number <img> tags. I need to change the path on all of these images to images/. The large string also contains other stuff not just these img's. <img src='http://server.com/stuff1/img1.jpg' /> <img src='http://server.com/stuff2/img2.png' /> Replacing the server name with a ReplaceAll() I could do, it's the variable path in the middle I'm clueless on how to include. It doesn't necessarily need to be a regex, but looping through the entire string just seems wasteful.

  Read the article

• running a batch file from oracle forms 6i using host

  - by user176217

  I am trying to run a batch file. the file is located here: C:\Program Files\Java\jre6\bin\getfile.bat I use this in oracle forms 6i: first i assign this path to a variable: tmp_msg := 'C:\Program Files\Java\jre6\bin\getfile.bat' then I use the host command: host( 'cmd /c' || tmp_msg, no_screen); This is exactly as I have it. It doesn't give me an error, but I don't get the result that I'm expecting. I'm actually executing java code in the batch file like so: java -classpath path;addedpackage.jar myClass I hope someone can help me with this. Thank you.

  Read the article

• Is it possible to mod_rewrite BASED on the existence of a file/directory and uniqueID?

  - by JM4

  My site currently forces all non www. pages to use www. Ultimately, I am able to handle all unique subdomains and parse correctly but I am trying to achieve the following: (ideally with mod_rewrite): when a consumer visits www.site.com/john4, the server processes that request as: www.site.com?Agent=john4 Our requirements are: The URL should continue to show www.site.com/john4 even though it was redirected to www.site.com?index.php?Agent=john4 If a file (of any extension OR a directory) exists with the name, the entire process stops an it tries to pull that file instead: for example: www.site.com/file would pull up (www.site.com/file.php if file.php existed on the server. www.site.com/pages would go to www.site.com/pages/index.php if the pages directory exists). Thank you ahead of time. I am completely at a crapshot right now.

  Read the article

• Is there a way to recover a file that I have deleted but is still open somewhere?

  - by George Edison

  This question is related to How to recover deleted files? but it is slightly different in nature. Suppose I have a file named ~/something open in a text editor. Further suppose that I open a terminal and run the following command while the file is still open in the text editor: rm ~/something This will delete the file. Now suppose that I changed my mind and wanted to get the file back. The file is still open in the text editor, so it hasn't been removed from the disk or filesystem yet. Is there any way to recover it?

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• A question about making a C# class persistent during a file load

  - by Adam

  Apologies for the indescriptive title, however it's the best I could think of for the moment. Basically, I've written a singleton class that loads files into a database. These files are typically large, and take hours to process. What I am looking for is to make a method where I can have this class running, and be able to call methods from within it, even if it's calling class is shut down. The singleton class is simple. It starts a thread that loads the file into the database, while having methods to report on the current status. In a nutshell it's al little like this: public sealed class BulkFileLoader { static BulkFileLoader instance = null; int currentCount = 0; BulkFileLoader() public static BulkFileLoader Instance { // Instanciate the instance class if necessary, and return it } public void Go() { // kick of 'ProcessFile' thread } public void GetCurrentCount() { return currentCount; } private void ProcessFile() { while (more rows in the import file) { // insert the row into the database currentCount++; } } } The idea is that you can get an instance of BulkFileLoader to execute, which will process a file to load, while at any time you can get realtime updates on the number of rows its done so far using the GetCurrentCount() method. This works fine, except the calling class needs to stay open the whole time for the processing to continue. As soon as I stop the calling class, the BulkFileLoader instance is removed, and it stops processing the file. What I am after is a solution where it will continue to run independently, regardless of what happens to the calling class. I then tried another approach. I created a simple console application that kicks off the BulkFileLoader, and then wrapped it around as a process. This fixes one problem, since now when I kick off the process, the file will continue to load even if I close the class that called the process. However, now the problem I have is that cannot get updates on the current count, since if I try and get the instance of BulkFileLoader (which, as mentioned before is a singleton), it creates a new instance, rather than returning the instance that is currently in the executing process. It would appear that singletons don't extend into the scope of other processes running on the machine. In the end, I want to be able to kick off the BulkFileLoader, and at any time be able to find out how many rows it's processed. However, that is even if I close the application I used to start it. Can anyone see a solution to my problem?

  Read the article

• Run batch file when argument contains quotes and spaces (from .NET framework)

  - by turtle

  I have a bat file which sets some environment variables, and then executes a command on the command line. I want to replace the hard coded command with one passed in via a parameter. So: :: Set up the required environment SET some_var=a SET another_var=b CALL some.bat :: Now call the command passed into this batch file %1 The problem is that the command is complex, and doesn't escape cleanly. It looks like this: an.exe -p="path with spaces" -t="some text" -f="another path with spaces" I'm trying to call the .bat from a .NET framework app, using: Dim cmd as String = "the cmd" System.Diagnostics.Process.Start( thebat.exe, cmd ) but I can't seem to get the escapes to work correctly. Can someone tell me how the string cmd should be entetered to get the command passed into the bat file as an argument correctly?

  Read the article

• Use matching value of a RegExp to name the output file.

  - by fx42

  I have this file "file.txt" which I want to split into many smaller ones. Each line of the file has an id field which looks like "id:1" for a line belonging to id 1. For each id in the file, I like to create a file named idid.txt and put all lines that belong to this id in that file. My brute force bash script solution reads as follows. count=1 while [ $count -lt 19945 ] do cat file.txt | grep "id:$count " >> ./sets/id$count.txt count='expr $count + 1' done Now this is very inefficient as I have do read through the file about 20.000 times. Is there a way to do the same operation with only one pass through the file? - What I'm probably asking for is a way to use the value that matches for a regular expression to name the associated output file.

  Read the article

< Previous Page | 347 348 349 350 351 352 353 354 355 356 357 358  | Next Page >