Search Results

Search found 28775 results on 1151 pages for 'line'.

Page 357/1151 | < Previous Page | 353 354 355 356 357 358 359 360 361 362 363 364  | Next Page >

• Python Importing object that originates in one module from a different module into a third module

  - by adewinter

  I was reading the sourcode for a python project and came across the following line: from couchexport.export import Format (source: https://github.com/wbnigeria/couchexport/blob/master/couchexport/views.py#L1 ) I went over to couchexport/export.py to see what Format was (Class? Dict? something else?). Unfortunately Format isn't in that file. export.py does however import a Format from couchexport.models where there is a Format class (source: https://github.com/wbnigeria/couchexport/blob/master/couchexport/models.py#L11). When I open up the original file in my IDE and have it look up the declaration, in line I mentioned at the start of this question, it leads directly to models.py. What's going on? How can an import from one file (export.py) actually be an import from another file (models.py) without being explicitly stated?

  Read the article

• Having issue with OpenGL 1.0 for HP slate 7

  - by Roy Coder

  I have issue with HP slate when i am trying to draw Line in OpenGL Draw method. But working in other devices. In Hp Slate Green line not drawn properly as like in another device. My Code is: gl.glPushMatrix(); gl.glEnableClientState(GL10.GL_VERTEX_ARRAY); gl.glVertexPointer(2, GL10.GL_FLOAT, 0, vertexFloatBuffer); gl.glColorMask(true, true, true, true); gl.glDepthMask(true); gl.glLineWidth(8.0f); setColor(gl); gl.glDrawArrays(GL10.GL_LINES, 0, fPoints.length / 2); gl.glDisableClientState(GL10.GL_VERTEX_ARRAY); gl.glPopMatrix(); Suggest me at which place i am wrong or missing something? UpdateImage

  Read the article

• C: Incompatible types?

  - by Airjoe

  #include <stdlib.h> #include <stdio.h> struct foo{ int id; char *bar; char *baz[6]; }; int main(int argc, char **argv){ struct foo f; f.id=1; char *qux[6]; f.bar=argv[0]; f.baz=qux; // Marked line return 1; } This is just some test code so ignore that qux doesn't actually have anything useful in it. I'm getting an error on the marked line, incompatible types when assigning to type ‘char *[6]’ from type ‘char **’ but both of the variables are defined as char *[6] in the code. Any insight?

  Read the article

• update table in gtk

  - by ali

  I have window that contains a table on screen, now I want to attach a widget to that table I use gtk_table_attach(GTK_TABLE(table), label, ...) the function is correct and it runs without any error but table does not respond to that line I mean there is no change on my table, I think I need something to tell that table update it self but how? note= that line is inside a callback of a signal and I am sure that signal runs note2= I do not want to destroy window for that note3= I use gtk+ and pygtk note4= I am sure I attach that widget to a correct position ( it is free)

  Read the article

• Sending message from one server to another in Twisted

  - by Casey Patton

  I've implemented my servers in the following way: def makeServer(application, port): factory = protocol.ServerFactory() factory.protocol = MyChat factory.clients = [] internet.TCPServer(port, factory).setServiceParent(application) application = service.Application("chatserver") server1 = makeServer(application, port=1025) server2 = makeServer(application, port=1026) server3 = makeServer(application, port=1027) Note that MyChat is an event handling class that has a "receiveMessage" action: def lineReceived(self, line): print "received", repr(line) for c in self.factory.clients: c.transport.write(message + '\n') I want server1 to be able to pass messages to server2. Rather, I want server1 to be treated as a client of server2. If server1 receives the message "hi" then I want it to send that same exact message to server2. How can I accomplish this?

  Read the article

• Does .NET have a linker?

  - by Water Cooler v2

  From Jon Skeet's blog: What does the following comment mean? // The line below only works when linked rather than // referenced, as otherwise you need a cast. // The compiler treats it as if it both takes and // returns a dynamic value. string value = com.MakeMeDynamic(10); I understand what referencing an assembly is. You may reference it when compiling the program files either using the /ref: switch at the command line or you may add a statically reference to the assembly in Visual Studio. But how do you link to an assembly in .NET? Does he mean, load the assembly using Reflection (Assembly.LoadFile())? Or, the Win32 API LoadLibrary()? Or, does .NET have a linker that I have never heard of?

  Read the article

• How to set maxLines and ellipsesize of a TextView at the same time.

  - by michael

  I want to limit my text view to have maximum of 6 lines, so I did: <TextView android:id="@+id/toptext" android:layout_width="fill_parent" android:layout_height="wrap_content" android:maxLines="6"/> But when I try to configure it to add '...' when the text is truncated, I add android:ellipsize="end". I do see the ... but then my TextView only has a max line of 2, instead of 6. Can you please how can I make the text view of maximum line of 6 and add '...' when it get truncated? Thank you.

  Read the article

• Can I test for the end of the content of a text/plain file with Selenium or javascript?

  - by fool4jesus

  I have a page that results in a text/plain file being displayed in the browser that looks like this: ... Admin Site Administration 2010-04-21 22:26:34 [email protected] Test Site Bob Smith 2010-04-21 22:27:09 [email protected] Admin Site Administration 2010-04-21 22:29:26 [email protected] I am trying to write a Selenium test against this that verifies the last line of the file has "[email protected]" at the end. How would you do this? I can't depend on the date/time as this is a login report that is constantly getting updated - all I want is to ensure that the last line ends with that email address. And I can't figure out how to do it using Selenium expressions, DOM, or XPath.

  Read the article

• Netbeans PHP require_once() problem

  - by mawg

  I'm stumped! In PHP in Netbeans (6.8), a project has two files, file1.php and file2.php file1.php starts require_once('file2.php'); and I get Warning: require_once(query_form.php): failed to open stream: No such file or directory in C:\xampp\htdocs\my_project\file1.php on line 3 Call Stack: 0.0741 322920 1. {main}() C:\xampp\htdocs\my_project\file1.php:0 Fatal error: require_once(): Failed opening required 'file2.php' (include_path='.;\xampp\php\PEAR') in C:\xampp\htdocs\my_project\file1.php on line 3 Call Stack: 0.0741 322920 1. {main}() C:\xampp\htdocs\my_project\file1.php:0 I tried require_once('./file2.php'); and require_once('.\file2.php'); since it is windows. I even added C:\xampp\htdocs\my_project\ to the projects include path and it shows up as such on the prject view and see file1.php and file2.php It doesn't show up on this error report, but possibly because Netbeans (or PHP ]) knows that C:\xampp\htdocs\my_project\ === . Any suggestions? Btw, I am new to Netbeans, so it i sprobably something very obvious.

  Read the article

• Can eclipse be used to fully replace ant?

  - by user198729

  I don't want to build the files manually with command line, is it possible for eclipse to do the equivalent for tomcat automatically?

  Read the article

• Finding rank of the student -Sql Compact

  - by Jankhana

  I have a table like this : Name Mar1 Mar2 Mar3 Total xxx 80 80 80 240 yyy 60 70 50 180 aaa 85 65 75 225 I wanted to find the rank of the student based on total. I using SQL Compact 3.5 . As we have rank() function in sql server do we have something with which we can find the students rank??? When I used "select Total,rank() over (order by total desc) i1 from stmarks " it's giving error as " Major Error 0x80040E14, Minor Error 25501 select Total,rank() over (order by total desc) i1 from stmarks There was an error parsing the query. [ Token line number = 1,Token line offset = 21,Token in error = over ] " Do Sql Compact support rank() over or is there any another way???

  Read the article

• UIViewController is popped from view stack and NSURLConnection crashes the application

  - by rickharrison

  I am pushing a UIViewController onto a UINavigationController. This view controller immediately starts a download of an xml feed and then parses it. However, if you hit the back button before it is done downloading, and crashes with EXC_BAD_ACCESS. The line that is crashing it is in parserDidEndDocument and is this line: if (self.delegate && [self.delegate conformsToProtocol:@protocol(ModelDelegate)]) [self.delegate modelDidFinishParsing:self]; I assume it is crashing because it is trying to access self.delegate which is not assigned anymore. How do I get around this? Also, I would release the model object in the modelDidFinishParsing method. How would I release this model if it never reaches this method.

  Read the article

• Is it hard problem?

  - by Lukasz Lew

  I can't solve it: You are given 8 integers: A, B, C representing a line on a plane with equation A*x + B*y = C a, b, c representing another line x, y representing a point on a plane The two lines are not parallel therefore divide plane into 4 pieces. Point (x, y) lies inside of one these pieces. Problem: Write a fast algorithm that will find a point with integer coordinates in the same piece as (x,y) that is closest to the cross point of the two given lines. Note: This is not a homework, this is old Euler-type task that I have absolutely no idea how to approach.

  Read the article

• ASP.NET Treeview Control not expanding on click

  - by Scott Vercuski

  I having an issue with the ASP.NET Treeview control. I create the treeview just fine but the nodes will not expand or collapse. I see there is a javascript error but it is for line 1 character 0 of the webpage, there is nothing at line 1 character 0. I am using the ASP:Treeview control in conjunction with the Telerik controls, but I'm not sure if that is an issue. I saw there was a similar question here but the answer is not pertinent to my site. Has anyone run into this issue before? I've tried searching Google and tried a number of proposed solutions but so far none have worked. Thank you,

  Read the article

• How to compare if string has a enter key in the end using jquery/javascript?

  - by user144842

  I have a string value from a user input box. I have to figure out if last char is a enter key (line feed). Thats the code. Here I am checking if last char has a whitespace. Now I also have to check if last char is enter key (carriage return or line feed). How can i do this? var txt = $get("<%= txtUserText.ClientID %>"); if (txt.value.substring(txt.value.length -1) !== ' ' || <checkifLastCharIsEnterKey>) //my code to take action **I don't think i need a keypress or keyup event because this above piece of code is not invoked at the time of user input.

  Read the article

• HASHREF in Perl

  - by Uri

  I'm trying to decrypt a Perl code which I'm not familiar with, somehow related to HashRef. I'm using Amazon::S3, but my question is a general Perl question. See the code below: use Amazon::S3; my $s3 = Amazon::S3-new( ... ); my $response = $s3-buckets; Documentation (here) sais, about s3-buckets: Returns undef on error, else HASHREF of results The following line is working for me, but I don't understand why: for $b in ( @ { $response-{buckets} } ) { print "bucket: " . $b-bucket . "\n"; } I'm buzzled by each operator on the first line. What type exactly are $response, $respone-{bucket}. Looks like the expression within the 'for' is an array, but I don't understand this syntax: @{ ... }?

  Read the article

• Same-directory includes failing on a Fedora server with PHP.

  - by JimmySawczuk

  I have a couple files that look like this: index.php: <?php include('includes/header.php'); ... includes/header.php: <?php include('config.php'); ... The error I get is Warning: require(config.php) [function.require]: failed to open stream: No such file or directory in [dir]/includes/header.php on line 2 Fatal error: require() [function.require]: Failed opening required 'config.php' (include_path='.:/usr/share/pear:/usr/share/php') in [dir]/includes/header.php on line 2 I did some further debugging: when I add the call system('pwd'); to includes/header.php, it shows [dir], where it should say [dir]/includes. Adding the 'includes/' to the include path works, but isn't desirable because that would fail on the production server. The above code works on a production server, and worked fine on my development Fedora server, until I tried to change my development environment so that the Fedora server's document root is a mounted CIFS share. Any ideas? Thanks.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• NSURLConnection shown as leaking in instruments

  - by Gyozo Kudor

  Hello another stupid question regarding leaks and also NSURLConnection. How do i release it? Is it enough if i release in the following 2 methods? (void)connection:(NSURLConnection *)connection didFailWithError:(NSError *)error (void)connectionDidFinishLoading:(NSURLConnection *)connection Because in instruments it shows me the line where I alloc my connection as the source of leaking. OK I don't get it. After the following code my urlConnection has a retain count of 2. WTF? NSURLConnection *urlConnection = [[NSURLConnection alloc] initWithRequest: urlRequest delegate: self]; This is the line that instruments points me to. I find this very weird.

  Read the article

• consts and other animals

  - by bks

  Hello i have a cpp code wich i'm having trouble reading. a class B is defined now, i understand the first two lines, but the rest isn't clear enough. is the line "B const * pa2 = pa1" defines a const variable of type class B? if so, what does the next line do? B a2(2); B *pa1 = new B(a2); B const * pa2 = pa1; B const * const pa3 = pa2; also, i'm having trouble figuring out the difference between these two: char const *cst = “abc”; const int ci = 15; thank you

  Read the article

• how to show the right word in my code, my code is : os.urandom(64)

  - by zjm1126

  My code is: print os.urandom(64) which outputs: > "D:\Python25\pythonw.exe" "D:\zjm_code\a.py" \xd0\xc8=<\xdbD' \xdf\xf0\xb3>\xfc\xf2\x99\x93 =S\xb2\xcd'\xdbD\x8d\xd0\\xbc{&YkD[\xdd\x8b\xbd\x82\x9e\xad\xd5\x90\x90\xdcD9\xbf9.\xeb\x9b>\xef#n\x84 which isn't readable, so I tried this: print os.urandom(64).decode("utf-8") but then I get: > "D:\Python25\pythonw.exe" "D:\zjm_code\a.py" Traceback (most recent call last): File "D:\zjm_code\a.py", line 17, in <module> print os.urandom(64).decode("utf-8") File "D:\Python25\lib\encodings\utf_8.py", line 16, in decode return codecs.utf_8_decode(input, errors, True) UnicodeDecodeError: 'utf8' codec can't decode bytes in position 0-3: invalid data What should I do to get human-readable output?

  Read the article

• Kerning problems when drawing text character by character

  - by shekel

  I'm trying to draw strings character by character to add lighting effects to shapes composed of text. while (i != line.length()) { c = line.substring(i, i + 1); cWidth = g.getFontMetrics().stringWidth(c); g.drawString(c, xx += cWidth, yy); i++; } The problem is, the width of a character isn't the actual distance it's drawn from another character when those two characters are printed as a string. Is there any way to get the correct distance in graphics2d?

  Read the article

• Template class implicit copy constructor issues

  - by Nate

  Stepping through my program in gdb, line 108 returns right back to the calling function, and doesn't call the copy constructor in class A, like (I thought) it should: template <class S> class A{ //etc... A( const A & old ){ //do stuff... } //etc... }; template <class T> class B{ //etc... A<T> ReturnsAnA(){ A<T> result; // do some stuff with result return result; //line 108 } //etc... }; Any hints? I've banged my head against the wall about this for 4 hours now, and can't seem to come up with what's happening here.

  Read the article

• how to manage formating of text when read a save file?

  - by moon

  hello i have a java applet application in which i use rich text area . i write URDU the national language of PAKISTAN. i managed to do so with uni codes. the problem is, when i write urdu in text area and select a font and color for each line it do all of this but when i save this file using UTF-8 encoding and then open it again it shows all text formatted as i choose format of last line. my requirement is to open file as it is saved. i mean each file should have same formatting as i done before saving.

  Read the article

• HD Crash SQL server -> DBCC - consistency errors in table 'sysindexes'

  - by Julian de Wit

  Hello A client of mine has had an HD crash an a SQL DB got corrupt : They did not make backups so they have a big problem. When I tried (an ultimate measure) to DBCC-repair I got the following message. Can anybody help me with this ? Server: Msg 8966, Level 16, State 1, Line 1 Could not read and latch page (1:872) with latch type SH. sysindexes failed. Server: Msg 8944, Level 16, State 1, Line 1 Table error: Object ID 2, index ID 0, page (1:872), row 11. Test (columnOffsets->IsComplex (varColumnNumber) && (ColumnId == COLID_HYDRA_TEXTPTR || ColumnId == COLID_INROW_ROOT || ColumnId == COLID_BACKPTR)) failed. Values are 2 and 5. The repair level on the DBCC statement caused this repair to be bypassed. CHECKTABLE found 0 allocation errors and 1 consistency errors in table 'sysindexes' (object ID 2). DBCC execution completed. If DBCC printed error messages, contact your system administrator.

  Read the article

< Previous Page | 353 354 355 356 357 358 359 360 361 362 363 364  | Next Page >