Search Results

Search found 29554 results on 1183 pages for 'human computer interface'.

Page 358/1183 | < Previous Page | 354 355 356 357 358 359 360 361 362 363 364 365  | Next Page >

  • How to let the matcher to match the second invocation on mock?

    - by Alex Luya
    I have an interface like this public interface EventBus{ public void fireEvent(GwtEvent<?> event); } and test code(testng method) looks like this: @Test public void testFireEvent(){ EventBus mock=mock(EventBus.class); //when both Event1 and Event2 are subclasses of GwtEvent<?> mock.fireEvent(new Event1()); mock.fireEvent(new Event2()); //then verify(mock).fireEvent(argThat(new Event2Matcher())); } Event2Matcher looks like this: private class Event2Matcher extends ArgumentMatcher<Event2> { @Override public boolean matches(Object arg) { return ((Event2) arg).getSth==sth; } } But get an error indicating that: Event1 can't be cast to Event2 And obviously,the matcher matched the first invoking mock.fireEvent(new Event1()); So,the statement within matcher return ((Event2) arg).getSth==sth; Will throw out this exception.So the question is how to let verify(mock).fireEvent(argThat(new Event2Matcher())); to match the second invoking?

    Read the article

  • Custom SessionListener, name is not bound in this context, javax.naming.NameNotFoundException

    - by mehmet6parmak
    Hi, I am trying to implement HttpSessionListener so that users of this listener can register implementation of ISessionEvent interface to session Events.code is below: public class MySessionListener implements HttpSessionListener{ @Resource ISessionEvent sessionEvent; public ISessionEvent getSessionEvent() { return sessionEvent; } public void setSessionEvent(ISessionEvent sessionEvent) { this.sessionEvent = sessionEvent; } @Override public void sessionCreated(HttpSessionEvent arg0) { sessionEvent.SessionCreated(arg0.getSession()); } @Override public void sessionDestroyed(HttpSessionEvent arg0) { sessionEvent.SessionDestroyed(arg0.getSession()); } } When user implement ISessionEvent and add as a bean, SessionCreated and SessionDestroyed functions of implementation will be called when these events occured. You can ask why dont you just write inside listeners methods, i dont i'm just trying. When i try the code above i got the following error message: javax.naming.NameNotFoundException: Name com.mehmet6parmak.sessionlistener.MySessionListener is not bound in this Context at org.apache.naming.NamingContext.lookup(NamingContext.java:770) at org.apache.naming.NamingContext.lookup(NamingContext.java:153) at org.apache.catalina.util.DefaultAnnotationProcessor.lookupFieldResource(DefaultAnnotationProcessor.java:278) at org.apache.catalina.util.DefaultAnnotationProcessor.processAnnotations(DefaultAnnotationProcessor.java:187) at org.apache.catalina.core.StandardContext.listenerStart(StandardContext.java:4082) at org.apache.catalina.core.StandardContext.start(StandardContext.java:4630) at org.apache.catalina.core.ContainerBase.start(ContainerBase.java:1045) at org.apache.catalina.core.StandardHost.start(StandardHost.java:785) at org.apache.catalina.core.ContainerBase.start(ContainerBase.java:1045) at org.apache.catalina.core.StandardEngine.start(StandardEngine.java:445) at org.apache.catalina.core.StandardService.start(StandardService.java:519) at org.apache.catalina.core.StandardServer.start(StandardServer.java:710) at org.apache.catalina.startup.Catalina.start(Catalina.java:581) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.catalina.startup.Bootstrap.start(Bootstrap.java:289) at org.apache.catalina.startup.Bootstrap.main(Bootstrap.java:414) Resource annotation causes the error but i could not resolve it. Thanks All... Interface and Implementation @Resource public interface ISessionEvent { public void SessionCreated(HttpSession session); public void SessionDestroyed(HttpSession session); } @Resource public class SessionEvent implements ISessionEvent { @Override public void SessionDestroyed(HttpSession session) { System.out.println("From Session Event Callback(Destroy):" + session.getId()); } @Override public void SessionCreated(HttpSession session) { System.out.println("From Session Event Callback(Create):" + session.getId()); } } Bean Definition <context:annotation-config/> <context:component-scan base-package="com.mehmet6parmak"> </context:component-scan> <bean id="sessionEvent" autowire="byName" class="com.mehmet6parmak.sessionlistener.SessionEvent"></bean> Solution:Using the method used in link works.

    Read the article

  • Scroll Gestures not Passed to IScrollInfo implementing panel in Windows Phone 7 CTP

    - by user50088
    I am using a custom panel as a ItemsPanel for a ItemsControl in a with a custom template that provides for a scroll viewer. (See Xaml below.) So long as my panel does not implement IScrollInfo, scrolling works in this scenerio. I implement IScrollInfo and update my viewport and extent sizes in measure override. The scroll bar shows the correct relative size, and if I call the IScrollInfo methods directly, scrolling works as expected. However, the drag and flick gestures no longer scroll the content. Putting a breakpoint on the input of every IScrollInfo method shows that drag and pick are not calling the interface. Removing the IScrollInfo interface declaration restores the scroll on drag and flick behavior. Is there a simple way to restore the flick and pan gestures to ItemControls with panels that implement IScrollInfo?

    Read the article

  • Communicating with all network computers regardless of IP address

    - by Stephen Jennings
    I'm interested in finding a way to enumerate all accessible devices on the local network, regardless of their IP address. For example, in a 192.168.1.X network, if there is a computer with a 10.0.0.X IP address plugged into the network, I want to be able to detect that rogue computer and preferrably communicate with it as well. Both computers will be running this custom software. I realize that's a vague description, and a full solution to the problem would be lengthy, so I'm really looking for help finding the right direction to go in ("Look into using class XYZ and ABC in this manner") rather than a full implementation. The reason I want this is that our company ships imaged computers to thousands of customers, each of which have different network settings (most use the same IP scheme, but a large percentage do not, and most do not have DHCP enabled on their networks). Once the hardware arrives, we have a hard time getting it up on the network, especially if the IP scheme doesn't match, since there is no one technically oriented on-site. Ideally, I want to design some kind of console to be used from their main workstation which looks out on the network, finds all computers running our software, displays their current IP address, and allows you to change the IP. I know it's possible to do this because we sell a couple pieces of custom hardware which have exactly this capability (plug the hardware in anywhere and view it from another computer regardless of IP), but I'm hoping it's possible to do in .NET 2.0, but I'm open to using .NET 3.5 or P/Invoke if I have to.

    Read the article

  • Generic Type constraint in .net

    - by Jose
    Okay I'm looking for some input, I'm pretty sure this is not currently supported in .NET 3.5 but here goes. I want to require a generic type passed into my class to have a constructor like this: new(IDictionary<string,object>) so the class would look like this public MyClass<T> where T : new(IDictionary<string,object>) { T CreateObject(IDictionary<string,object> values) { return new T(values); } } But the compiler doesn't support this, it doesn't really know what I'm asking. Some of you might ask, why do you want to do this? Well I'm working on a pet project of an ORM so I get values from the DB and then create the object and load the values. I thought it would be cleaner to allow the object just create itself with the values I give it. As far as I can tell I have two options: 1) Use reflection(which I'm trying to avoid) to grab the PropertyInfo[] array and then use that to load the values. 2) require T to support an interface like so: public interface ILoadValues { void LoadValues(IDictionary values); } and then do this public MyClass<T> where T:new(),ILoadValues { T CreateObject(IDictionary<string,object> values) { T obj = new T(); obj.LoadValues(values); return obj; } } The problem I have with the interface I guess is philosophical, I don't really want to expose a public method for people to load the values. Using the constructor the idea was that if I had an object like this namespace DataSource.Data { public class User { protected internal User(IDictionary<string,object> values) { //Initialize } } } As long as the MyClass<T> was in the same assembly the constructor would be available. I personally think that the Type constraint in my opinion should ask (Do I have access to this constructor? I do, great!) Anyways any input is welcome.

    Read the article

  • Java Best Practice for type resolution at runtime.

    - by Brian
    I'm trying to define a class (or set of classes which implement the same interface) that will behave as a loosely typed object (like JavaScript). They can hold any sort of data and operations on them depend on the underlying type. I have it working in three different ways but none seem ideal. These test versions only allow strings and integers and the only operation is add. Adding integers results in the sum of the integer values, adding strings concatenates the strings and adding an integer to a string converts the integer to a string and concatenates it with the string. The final version will have more types (Doubles, Arrays, JavaScript-like objects where new properties can be added dynamically) and more operations. Way 1: public interface DynObject1 { @Override public String toString(); public DynObject1 add(DynObject1 d); public DynObject1 addTo(DynInteger1 d); public DynObject1 addTo(DynString1 d); } public class DynInteger1 implements DynObject1 { private int value; public DynInteger1(int v) { value = v; } @Override public String toString() { return Integer.toString(value); } public DynObject1 add(DynObject1 d) { return d.addTo(this); } public DynObject1 addTo(DynInteger1 d) { return new DynInteger1(d.value + value); } public DynObject1 addTo(DynString1 d) { return new DynString1(d.toString()+Integer.toString(value)); } } ...and similar for DynString1 Way 2: public interface DynObject2 { @Override public String toString(); public DynObject2 add(DynObject2 d); } public class DynInteger2 implements DynObject2 { private int value; public DynInteger2(int v) { value = v; } @Override public String toString() { return Integer.toString(value); } public DynObject2 add(DynObject2 d) { Class c = d.getClass(); if(c==DynInteger2.class) { return new DynInteger2(value + ((DynInteger2)d).value); } else { return new DynString2(toString() + d.toString()); } } } ...and similar for DynString2 Way 3: public class DynObject3 { private enum ObjectType { Integer, String }; Object value; ObjectType type; public DynObject3(Integer v) { value = v; type = ObjectType.Integer; } public DynObject3(String v) { value = v; type = ObjectType.String; } @Override public String toString() { return value.toString(); } public DynObject3 add(DynObject3 d) { if(type==ObjectType.Integer && d.type==ObjectType.Integer) { return new DynObject3(Integer.valueOf(((Integer)value).intValue()+((Integer)value).intValue())); } else { return new DynObject3(value.toString()+d.value.toString()); } } } With the if-else logic I could use value.getClass()==Integer.class instead of storing the type but with more types I'd change this to use a switch statement and Java doesn't allow switch to use Classes. Anyway... My question is what is the best way to go about something thike this?

    Read the article

  • Calculate the contentsize of scrollview

    - by neha
    Hi all, I'm having a scrollview as the detailedview of tableview cell. There are multiple views on the detailedview like labels, buttons etc. which I'm creating through interface builder. What I'm creating through interface builder is static. I'm putting everything on a view of height 480. A label on my detailedview is having dynamic text which can extend to any length. The problem is that I need to set the scrollview's content size for which I need its height. How shall I set scrollview's height provided the content is dynamic?

    Read the article

  • textbox, combobox in WPF listview.

    - by RAJ K
    hello everyone, I am porting an application from foxpro to C#.Net. This is a wine shop billing software. Its billing interface screenshot link is here http://picasaweb.google.com/raj.kishor09/RAJK?feat=directlink But my client wants similar interface on WPF too. I think listview can help me in this regard but don't know how to implement. i figured out that each row of listview should have 2 textbox, 1 combobox and few textblock or label. Not only this but cursor should jump from one control to other control using "Enter/Return" key instead of "Tab" key. Please help me with some code lines. Please guys help me......

    Read the article

  • Does collections type conversion util methods already exist in any API?

    - by Delta
    interface TypeConverter<T, E> { T convert(E e); } class CollectionUtil() { public static <E> List<T> convertToList(List<E> fromList, TypeConverter<T, E> conv) { { if(fromList== null) return null; List<T> newList = new ArrayList<T>(fromList.size()) for(E e : fromList) { newList.add(conv.convert(e)); } return newList; } } Above code explains converting from List of String to List of Integer by implementing TypeConverter interface for String, Integer. Are there already any collections conversion utility methods exists in any API like list to set and so on?

    Read the article

  • 3-Tier architecture-layering and the term-mishmash

    - by Rookian
    Hi! I am confused about the different possibilities to express a 3-Tier architecture. Data-Access-Layer Business-Layer Presentation Layer (User Interface) or Database (aka Backend) Business-Layer Presentation Layer (User Interface) Why can you skip the database in the 1st approach? Both use a database! Does the database belong to the layering or not?! What is wrong and what is right? Can someone of you clarify this :)? Thanks in advance!

    Read the article

  • What's the C strategy to "imitate" a C++ template ?

    - by Andrei Ciobanu
    After reading some examples on stackoverflow, and following some of the answers for my previous questions (1), I've eventually come with a "strategy" for this. I've come to this: 1) Have a declare section in the .h file. Here I will define the data-structure, and the accesing interface. Eg.: /** * LIST DECLARATION. (DOUBLE LINKED LIST) */ #define NM_TEMPLATE_DECLARE_LIST(type) \ typedef struct nm_list_elem_##type##_s { \ type data; \ struct nm_list_elem_##type##_s *next; \ struct nm_list_elem_##type##_s *prev; \ } nm_list_elem_##type ; \ typedef struct nm_list_##type##_s { \ unsigned int size; \ nm_list_elem_##type *head; \ nm_list_elem_##type *tail; \ int (*cmp)(const type e1, const type e2); \ } nm_list_##type ; \ \ nm_list_##type *nm_list_new_##type##_(int (*cmp)(const type e1, \ const type e2)); \ \ (...other functions ...) 2) Wrap the functions in the interface inside MACROS: /** * LIST INTERFACE */ #define nm_list(type) \ nm_list_##type #define nm_list_elem(type) \ nm_list_elem_##type #define nm_list_new(type,cmp) \ nm_list_new_##type##_(cmp) #define nm_list_delete(type, list, dst) \ nm_list_delete_##type##_(list, dst) #define nm_list_ins_next(type,list, elem, data) \ nm_list_ins_next_##type##_(list, elem, data) (...others...) 3) Implement the functions: /** * LIST FUNCTION DEFINITIONS */ #define NM_TEMPLATE_DEFINE_LIST(type) \ nm_list_##type *nm_list_new_##type##_(int (*cmp)(const type e1, \ const type e2)) \ {\ nm_list_##type *list = NULL; \ list = nm_alloc(sizeof(*list)); \ list->size = 0; \ list->head = NULL; \ list->tail = NULL; \ list->cmp = cmp; \ }\ void nm_list_delete_##type##_(nm_list_##type *list, \ void (*destructor)(nm_list_elem_##type elem)) \ { \ type data; \ while(nm_list_size(list)){ \ data = nm_list_rem_##type(list, tail); \ if(destructor){ \ destructor(data); \ } \ } \ nm_free(list); \ } \ (...others...) In order to use those constructs, I have to create two files (let's call them templates.c and templates.h) . In templates.h I will have to NM_TEMPLATE_DECLARE_LIST(int), NM_TEMPLATE_DECLARE_LIST(double) , while in templates.c I will need to NM_TEMPLATE_DEFINE_LIST(int) , NM_TEMPLATE_DEFINE_LIST(double) , in order to have the code behind a list of ints, doubles and so on, generated. By following this strategy I will have to keep all my "template" declarations in two files, and in the same time, I will need to include templates.h whenever I need the data structures. It's a very "centralized" solution. Do you know other strategy in order to "imitate" (at some point) templates in C++ ? Do you know a way to improve this strategy, in order to keep things in more decentralized manner, so that I won't need the two files: templates.c and templates.h ?

    Read the article

  • Animating UIImageView iPhone

    - by Fred Dpn
    Hi, i'm having trouble about animating an Image in a UIImageView. I've created an image view in interface builder and linked it to its iboutlet. Here is my code. @interface Game : UIViewController <UIAccelerometerDelegate>{ IBOutlet UIImageView *diying; } @property (nonatomic, retain) UIImageView *diying; In the viewDidLoad method i've written this code NSArray * imageArray = [[NSArray alloc] initWithObjects: [UIImage imageNamed:@"Die1.gif"], [UIImage imageNamed:@"Die2.gif"], [UIImage imageNamed:@"Die3.gif"], [UIImage imageNamed:@"Die4.gif"], nil]; diying.animationImages = imageArray; diying.animationDuration = 1.1; diying.contentMode = UIViewContentModeBottomLeft; [diying startAnimating]; [super viewDidLoad]; which is a adaptation of what i've found here : http://icodeblog.com/2009/07/24/iphone-programming-tutorial-animating-a-game-sprite/ NB : those .gif files are simple images and are not animated. I did the tutorial and it worked fine but i can't figure out why it my adaptation doesn't work !

    Read the article

  • get pure text form odt file in console

    - by naugtur
    I am looking for a small linux tool that would be able to extract text from odt file. It just needs to be human-readable and it can have problems with complicated objects etc. It's almost a duplicate of this question but I need it to be small and have no dependencies on OpenOffice or X server I remember having a 1MB MS-DOS program that could render .doc files quite readibly (with some weird markup getting through from time to time), so i expect it to be possible in the linux world too ;)

    Read the article

  • What's the best software analogy you've heard?

    - by Mantorok
    Hi Quite frequently I have to explain things to Project Managers who sometimes want to know a little bit more about something, and sometimes I try and come up with some analogy that best explains it. Now, I can't really kick this off with a good analagy because mine usually suck, but I would be interested in yours, or some you've heard that have been used to simplify explanations. One analogy that does come up often is when explaining Interfaces (i.e. .Net) to which I usually explain in terms of a vehicle has a driver interface, and all vehicles must implement that interface so that anyone who can drive a vehicle will be able to utilise it. Any more? Would like to hear some, both serious and humourous. Please close if a duplicate.

    Read the article

  • C++ game designing & polymorphism question

    - by Kotti
    Hi! I'm trying to implement some sort of 'just-for-me' game engine and the problem's plot goes the following way: Suppose I have some abstract interface for a renderable entity, e.g. IRenderable. And it's declared the following way: interface IRenderable { // (...) // Suppose that Backend is some abstract backend used // for rendering, and it's implementation is not important virtual void Render(Backend& backend) = 0; }; What I'm doing right now is something like declaring different classes like class Ball : public IRenderable { virtual void Render(Backend& backend) { // Rendering implementation, that is specific for // the Ball object // (...) } }; And then everything looks fine. I can easily do something like std::vector<IRenderable*> items, push some items like new Ball() in this vector and then make a call similiar to foreach (IRenderable* in items) { item->Render(backend); } Ok, I guess it is the 'polymorphic' way, but what if I want to have different types of objects in my game and an ability to manipulate their state, where every object can be manipulated via it's own interface? I could do something like struct GameState { Ball ball; Bonus bonus; // (...) }; and then easily change objects state via their own methods, like ball.Move(...) or bonus.Activate(...), where Move(...) is specific for only Ball and Activate(...) - for only Bonus instances. But in this case I lose the opportunity to write foreach IRenderable* simply because I store these balls and bonuses as instances of their derived, not base classes. And in this case the rendering procedure turns into a mess like ball.Render(backend); bonus.Render(backend); // (...) and it is bad because we actually lose our polymorphism this way (no actual need for making Render function virtual, etc. The other approach means invoking downcasting via dynamic_cast or something with typeid to determine the type of object you want to manipulate and this looks even worse to me and this also breaks this 'polymorphic' idea. So, my question is - is there some kind of (probably) alternative approach to what I want to do or can my current pattern be somehow modified so that I would actually store IRenderable* for my game objects (so that I can invoke virtual Render method on each of them) while preserving the ability to easily change the state of these objects? Maybe I'm doing something absolutely wrong from the beginning, if so, please point it out :) Thanks in advance!

    Read the article

  • Need help with developing a class for my JUnit test

    - by alpdog14
    I have this JUnit test that I need help developing a Interface and Class for, here is the test: Box b1 = new DefaultBox( "abc" ); Box b2 = new DefaultBox( "def" ); Box b3 = new DefaultBox( "" ); assertEquals("abc", b1.contents()); assertEquals("[abc]", b1.toString()); assertTrue(b1.equals(b1)); assertFalse(b1.equals(b2)); assertFalse(b1.equals(null)); assertEquals("cba", b1.flip().contents()); assertEquals("", b3.flip().contents()); can anyone help me in developing a Default box class and a box interface to make these test pass? Any help would be most appreciated.

    Read the article

  • JAXB doesn't unmarshal list of interfaces

    - by Joker_vD
    It seems JAXB can't read what it writes. Consider the following code: interface IFoo { void jump(); } @XmlRootElement class Bar implements IFoo { @XmlElement public String y; public Bar() { y = ""; } public Bar(String y) { this.y = y; } @Override public void jump() { System.out.println(y); } } @XmlRootElement class Baz implements IFoo { @XmlElement public int x; public Baz() { x = 0; } public Baz(int x) { this.x = x; } @Override public void jump() { System.out.println(x); } } @XmlRootElement public class Holder { private List<IFoo> things; public Holder() { things = new ArrayList<>(); } @XmlElementWrapper @XmlAnyElement public List<IFoo> getThings() { return things; } public void addThing(IFoo thing) { things.add(thing); } } // ... try { JAXBContext context = JAXBContext.newInstance(Holder.class, Bar.class, Baz.class); Holder holder = new Holder(); holder.addThing(new Bar("1")); holder.addThing(new Baz(2)); holder.addThing(new Baz(3)); for (IFoo thing : holder.getThings()) { thing.jump(); } StringWriter s = new StringWriter(); context.createMarshaller().marshal(holder, s); String data = s.toString(); System.out.println(data); StringReader t = new StringReader(data); Holder holder2 = (Holder)context.createUnmarshaller().unmarshal(t); for (IFoo thing : holder2.getThings()) { thing.jump(); } } catch (Exception e) { System.err.println(e.getMessage()); } It's a simplified example, of course. The point is that I have to store two very differently implemented classes, Bar and Baz, in one collection. Well, I observed that they have pretty similar public interface, so I created an interface IFoo and made them two to implement it. Now, I want to have tools to save and load this collection to/from XML. Unfortunately, this code doesn't quite work: the collection is saved, but then it cannot be loaded! The intended output is 1 2 3 some xml 1 2 3 But unfortunately, the actual output is 1 2 3 some xml com.sun.org.apache.xerces.internal.dom.ElementNSImpl cannot be cast to testapplication1.IFoo Apparently, I need to use the annotations in a different way? Or to give up on JAXB and look for something else? I, well, can write "XMLNode toXML()" method for all classes I wan't to (de)marshal, but...

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • What's going on with "expected specifier-qualifier-list" error

    - by Tattat
    It is my GameEngine.h: #import <Foundation/Foundation.h> #import "GameArray.h"; @interface GameEngine : NSObject { GameArray *gameButtonsArray; } @property (nonatomic, retain) GameArray *gameButtonsArray; And this is my GameArray.h: #import <Foundation/Foundation.h> #import "MyAppDelegate.h" @interface GameArray : NSObject { NSMutableArray *gameButtonsArray; } @property (nonatomic, retain) NSMutableArray *gameButtonsArray; It keep prompt my "expected specifier-qualifier-list" error i my GameEngine.h, and error said that "expected specifier-qualifier-list before 'GameArray'", what's going on?

    Read the article

  • Starting new transaction in Spring bean

    - by Marcus
    We have: @Transactional(propagation = Propagation.REQUIRED) public class MyClass implementes MyInterface { ... MyInterface has a single method: go(). When go() executes we start a new transaction which commits/rollbacks when the method is complete - this is fine. Now let's say in go() we call a private method in MyClass that has @Transactional(propagation = Propagation.REQUIRES_NEW. It seems that Spring "ignores" the REQUIRES_NEW annotation and does not start a new transaction. I believe this is because Spring AOP operates on the interface level (MyInterface) and does not intercept any calls to MyClass methods. Is this correct? Is there any way to start a new transaction within the go() transaction? Is the only way to call another Spring managed bean that has transactions configured as REQUIRES_NEW? Update: Adding that when clients execute go() they do so via a reference to the interface, not the class: @Autowired MyInterface impl; impl.go();

    Read the article

  • c# Generic overloaded method dispatching ambiguous

    - by sebgod
    Hello, I just hit a situation where a method dispatch was ambiguous and wondered if anyone could explain on what basis the compiler (.NET 4.0.30319) chooses what overload to call interface IfaceA { } interface IfaceB<T> { void Add(IfaceA a); T Add(T t); } class ConcreteA : IfaceA { } class abstract BaseClassB<T> : IfaceB<T> { public virtual T Add(T t) { ... } public virtual void Add(IfaceA a) { ... } } class ConcreteB : BaseClassB<IfaceA> { // does not override one of the relevant methods } void code() { var concreteB = new ConcreteB(); // it will call void Add(IfaceA a) concreteB.Add(new ConcreteA()); } In any case, why does the compiler not warn me or even why does it compile? Thank you very much for any answers.

    Read the article

< Previous Page | 354 355 356 357 358 359 360 361 362 363 364 365  | Next Page >