Search Results

Search found 29554 results on 1183 pages for 'human computer interface'.

Page 358/1183 | < Previous Page | 354 355 356 357 358 359 360 361 362 363 364 365  | Next Page >

  • How can I push a string from one client connected to a WCF service to another connected as well?

    - by Sergio Tapia
    Here's what I have so far: IService: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.ServiceModel; namespace ServiceLibrary { [ServiceContract(SessionMode = SessionMode.Allowed, CallbackContract = typeof(IServiceCallback))] public interface IService { [OperationContract(IsOneWay = false, IsInitiating = true, IsTerminating = false)] void Join(string userName); } interface IServiceCallback { [OperationContract(IsOneWay = true)] void UserJoined(string senderName); } } Service: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.ServiceModel; namespace ServiceLibrary { [ServiceBehavior(InstanceContextMode = InstanceContextMode.PerSession, ConcurrencyMode = ConcurrencyMode.Multiple)] public class Service:IService { IServiceCallback callback = null; public void Join(string userName) { callback = OperationContext.Current.GetCallbackChannel<IServiceCallback>(); } } } Just a simple string passed from one client to another.

    Read the article

  • An appropriate C API for inspecting attribute values

    - by uk82
    There are two obvious ways in C to provide outside access to internal attribute values (A) provide a generic interface that accepts a list of attributes that changes over time (some added / some die) or (B) a specific interface for each and every attribute. Example A: int x_get_attribute_value(ATT att) { if (a) return a_val; if (b) return b_val; } Example B: A_Enum x_get_a_type_attribute() {} B_Enum x_get_b_type_attribute() {} I recall that Eclipse's API is very much like A (I could be wrong). What I can't do is come up with a compelling argument against either. A is clean - any user will no where to go to find out a property value. It can evolve cleanly without leaving dead interfaces around. B has type checking to a degree - this is C enums! Is there a big hitter argument that pushes the balance away from opinion?

    Read the article

  • What are the pros/cons to these 2 ways of defining parameters for a web service method

    - by Antony Scott
    I have an existing web service I need to expand, but it has not gone into production yet. So, I am free to change the contracts as I see fit. But I am not sure of the best way to define the methods. I am leaning towards Method 2 for no other reason than I cannot think of good names to give the parameters classes! Are there any major disadvantages to using Method 2 over Method 1? Method 1 [DataContract(Namespace = Constants.ServiceNamespace)] public class MyParameters { [DataMember(Order = 1, IsRequired = true)] public int CompanyID { get; set; } [DataMember(Order = 2, IsRequired = true)] public string Filter { get; set; } } [ServiceContract(Namespace = Constants.ServiceNamespace)] public interface IMyService { [OperationContract, FaultContract(MyServiceFault)] MyResult MyMethod(MyParameters params); } Method 2 public interface IMyService { [OperationContract, FaultContract(MyServiceFault)] MyResult MyMethod(int companyID, string filter); }

    Read the article

  • 3-Tier architecture-layering and the term-mishmash

    - by Rookian
    Hi! I am confused about the different possibilities to express a 3-Tier architecture. Data-Access-Layer Business-Layer Presentation Layer (User Interface) or Database (aka Backend) Business-Layer Presentation Layer (User Interface) Why can you skip the database in the 1st approach? Both use a database! Does the database belong to the layering or not?! What is wrong and what is right? Can someone of you clarify this :)? Thanks in advance!

    Read the article

  • AJAX XML reply node value iteration

    - by XpiritO
    Hi there, guys. I would really appreciate to get your help on this, as I can't seem to detect and solve the problem I'm having with an AJAX functionality on a site that I'm currently developing. I have a webform that makes an asynchronous call to a handler (.ashx) that delivers a XML response that is later processed by a Javascript client-side function that places it's contents into the user-interface. I'm attaching an example of the response generated by my handler, and what I would like to know is how can I get all the <body> element innerHTML (with the text and child nodes) contents to append it to a <span> element on the user-interface. Can anyone help me out with this? XML Response returned by the handler (checked via Firebug): <message> <content> <messageId>2</messageId> <from>Barack Obama</from> <fromMail>[email protected]</fromMail> <subject>Yes, we can... get World Peace</subject> <body>Hello, dear citizen. I'm sending you this message to invite you to join us! <a href="http://www.whitehouse.gov">Test link</a> Thank you for your time.</body> </content> </message> Client-side Javascript function to affect the user-interface innerHTML property with the data returned via AJAX: function GetMessageContentsCallback(args, resp) { //XML Parser try { //Internet Explorer xmlDoc = new ActiveXObject("Microsoft.XMLDOM"); xmlDoc.async = "false"; xmlDoc.loadXML(resp); } catch (e) { parser = new DOMParser(); xmlDoc = parser.parseFromString(resp, "text/xml"); } var msgReply = xmlDoc.getElementsByTagName('message')[0]; var ajaxRespondeBodyInnerHTML = msgReply.getElementsByTagName(body)[0].firstChild.nodeValue; //this currently only delivers inner text content, without the <a href... bit and subsequent text document.getElementById("bodySpan").innerHTML = ajaxRespondeBodyInnerHTML; }

    Read the article

  • What's the C strategy to "imitate" a C++ template ?

    - by Andrei Ciobanu
    After reading some examples on stackoverflow, and following some of the answers for my previous questions (1), I've eventually come with a "strategy" for this. I've come to this: 1) Have a declare section in the .h file. Here I will define the data-structure, and the accesing interface. Eg.: /** * LIST DECLARATION. (DOUBLE LINKED LIST) */ #define NM_TEMPLATE_DECLARE_LIST(type) \ typedef struct nm_list_elem_##type##_s { \ type data; \ struct nm_list_elem_##type##_s *next; \ struct nm_list_elem_##type##_s *prev; \ } nm_list_elem_##type ; \ typedef struct nm_list_##type##_s { \ unsigned int size; \ nm_list_elem_##type *head; \ nm_list_elem_##type *tail; \ int (*cmp)(const type e1, const type e2); \ } nm_list_##type ; \ \ nm_list_##type *nm_list_new_##type##_(int (*cmp)(const type e1, \ const type e2)); \ \ (...other functions ...) 2) Wrap the functions in the interface inside MACROS: /** * LIST INTERFACE */ #define nm_list(type) \ nm_list_##type #define nm_list_elem(type) \ nm_list_elem_##type #define nm_list_new(type,cmp) \ nm_list_new_##type##_(cmp) #define nm_list_delete(type, list, dst) \ nm_list_delete_##type##_(list, dst) #define nm_list_ins_next(type,list, elem, data) \ nm_list_ins_next_##type##_(list, elem, data) (...others...) 3) Implement the functions: /** * LIST FUNCTION DEFINITIONS */ #define NM_TEMPLATE_DEFINE_LIST(type) \ nm_list_##type *nm_list_new_##type##_(int (*cmp)(const type e1, \ const type e2)) \ {\ nm_list_##type *list = NULL; \ list = nm_alloc(sizeof(*list)); \ list->size = 0; \ list->head = NULL; \ list->tail = NULL; \ list->cmp = cmp; \ }\ void nm_list_delete_##type##_(nm_list_##type *list, \ void (*destructor)(nm_list_elem_##type elem)) \ { \ type data; \ while(nm_list_size(list)){ \ data = nm_list_rem_##type(list, tail); \ if(destructor){ \ destructor(data); \ } \ } \ nm_free(list); \ } \ (...others...) In order to use those constructs, I have to create two files (let's call them templates.c and templates.h) . In templates.h I will have to NM_TEMPLATE_DECLARE_LIST(int), NM_TEMPLATE_DECLARE_LIST(double) , while in templates.c I will need to NM_TEMPLATE_DEFINE_LIST(int) , NM_TEMPLATE_DEFINE_LIST(double) , in order to have the code behind a list of ints, doubles and so on, generated. By following this strategy I will have to keep all my "template" declarations in two files, and in the same time, I will need to include templates.h whenever I need the data structures. It's a very "centralized" solution. Do you know other strategy in order to "imitate" (at some point) templates in C++ ? Do you know a way to improve this strategy, in order to keep things in more decentralized manner, so that I won't need the two files: templates.c and templates.h ?

    Read the article

  • Is it possible to programmatically edit a sound file based on frequency?

    - by K-RAN
    Just wondering if it's possible to go through a flac, mp3, wav, etc file and edit portions, or the entire file by removing sections based on a specific frequency range? So for example, I have a recording of a friend reciting a poem with a few percussion instruments in the background. Could I write a C program that goes through the entire file and cuts out everything except the vocals (human voice frequency ranges from 85-255 Hz, from what I've been reading)? Thanks in advance for any ideas!

    Read the article

  • Custom SessionListener, name is not bound in this context, javax.naming.NameNotFoundException

    - by mehmet6parmak
    Hi, I am trying to implement HttpSessionListener so that users of this listener can register implementation of ISessionEvent interface to session Events.code is below: public class MySessionListener implements HttpSessionListener{ @Resource ISessionEvent sessionEvent; public ISessionEvent getSessionEvent() { return sessionEvent; } public void setSessionEvent(ISessionEvent sessionEvent) { this.sessionEvent = sessionEvent; } @Override public void sessionCreated(HttpSessionEvent arg0) { sessionEvent.SessionCreated(arg0.getSession()); } @Override public void sessionDestroyed(HttpSessionEvent arg0) { sessionEvent.SessionDestroyed(arg0.getSession()); } } When user implement ISessionEvent and add as a bean, SessionCreated and SessionDestroyed functions of implementation will be called when these events occured. You can ask why dont you just write inside listeners methods, i dont i'm just trying. When i try the code above i got the following error message: javax.naming.NameNotFoundException: Name com.mehmet6parmak.sessionlistener.MySessionListener is not bound in this Context at org.apache.naming.NamingContext.lookup(NamingContext.java:770) at org.apache.naming.NamingContext.lookup(NamingContext.java:153) at org.apache.catalina.util.DefaultAnnotationProcessor.lookupFieldResource(DefaultAnnotationProcessor.java:278) at org.apache.catalina.util.DefaultAnnotationProcessor.processAnnotations(DefaultAnnotationProcessor.java:187) at org.apache.catalina.core.StandardContext.listenerStart(StandardContext.java:4082) at org.apache.catalina.core.StandardContext.start(StandardContext.java:4630) at org.apache.catalina.core.ContainerBase.start(ContainerBase.java:1045) at org.apache.catalina.core.StandardHost.start(StandardHost.java:785) at org.apache.catalina.core.ContainerBase.start(ContainerBase.java:1045) at org.apache.catalina.core.StandardEngine.start(StandardEngine.java:445) at org.apache.catalina.core.StandardService.start(StandardService.java:519) at org.apache.catalina.core.StandardServer.start(StandardServer.java:710) at org.apache.catalina.startup.Catalina.start(Catalina.java:581) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.catalina.startup.Bootstrap.start(Bootstrap.java:289) at org.apache.catalina.startup.Bootstrap.main(Bootstrap.java:414) Resource annotation causes the error but i could not resolve it. Thanks All... Interface and Implementation @Resource public interface ISessionEvent { public void SessionCreated(HttpSession session); public void SessionDestroyed(HttpSession session); } @Resource public class SessionEvent implements ISessionEvent { @Override public void SessionDestroyed(HttpSession session) { System.out.println("From Session Event Callback(Destroy):" + session.getId()); } @Override public void SessionCreated(HttpSession session) { System.out.println("From Session Event Callback(Create):" + session.getId()); } } Bean Definition <context:annotation-config/> <context:component-scan base-package="com.mehmet6parmak"> </context:component-scan> <bean id="sessionEvent" autowire="byName" class="com.mehmet6parmak.sessionlistener.SessionEvent"></bean> Solution:Using the method used in link works.

    Read the article

  • How to let the matcher to match the second invocation on mock?

    - by Alex Luya
    I have an interface like this public interface EventBus{ public void fireEvent(GwtEvent<?> event); } and test code(testng method) looks like this: @Test public void testFireEvent(){ EventBus mock=mock(EventBus.class); //when both Event1 and Event2 are subclasses of GwtEvent<?> mock.fireEvent(new Event1()); mock.fireEvent(new Event2()); //then verify(mock).fireEvent(argThat(new Event2Matcher())); } Event2Matcher looks like this: private class Event2Matcher extends ArgumentMatcher<Event2> { @Override public boolean matches(Object arg) { return ((Event2) arg).getSth==sth; } } But get an error indicating that: Event1 can't be cast to Event2 And obviously,the matcher matched the first invoking mock.fireEvent(new Event1()); So,the statement within matcher return ((Event2) arg).getSth==sth; Will throw out this exception.So the question is how to let verify(mock).fireEvent(argThat(new Event2Matcher())); to match the second invoking?

    Read the article

  • Animating UIImageView iPhone

    - by Fred Dpn
    Hi, i'm having trouble about animating an Image in a UIImageView. I've created an image view in interface builder and linked it to its iboutlet. Here is my code. @interface Game : UIViewController <UIAccelerometerDelegate>{ IBOutlet UIImageView *diying; } @property (nonatomic, retain) UIImageView *diying; In the viewDidLoad method i've written this code NSArray * imageArray = [[NSArray alloc] initWithObjects: [UIImage imageNamed:@"Die1.gif"], [UIImage imageNamed:@"Die2.gif"], [UIImage imageNamed:@"Die3.gif"], [UIImage imageNamed:@"Die4.gif"], nil]; diying.animationImages = imageArray; diying.animationDuration = 1.1; diying.contentMode = UIViewContentModeBottomLeft; [diying startAnimating]; [super viewDidLoad]; which is a adaptation of what i've found here : http://icodeblog.com/2009/07/24/iphone-programming-tutorial-animating-a-game-sprite/ NB : those .gif files are simple images and are not animated. I did the tutorial and it worked fine but i can't figure out why it my adaptation doesn't work !

    Read the article

  • textbox, combobox in WPF listview.

    - by RAJ K
    hello everyone, I am porting an application from foxpro to C#.Net. This is a wine shop billing software. Its billing interface screenshot link is here http://picasaweb.google.com/raj.kishor09/RAJK?feat=directlink But my client wants similar interface on WPF too. I think listview can help me in this regard but don't know how to implement. i figured out that each row of listview should have 2 textbox, 1 combobox and few textblock or label. Not only this but cursor should jump from one control to other control using "Enter/Return" key instead of "Tab" key. Please help me with some code lines. Please guys help me......

    Read the article

  • get pure text form odt file in console

    - by naugtur
    I am looking for a small linux tool that would be able to extract text from odt file. It just needs to be human-readable and it can have problems with complicated objects etc. It's almost a duplicate of this question but I need it to be small and have no dependencies on OpenOffice or X server I remember having a 1MB MS-DOS program that could render .doc files quite readibly (with some weird markup getting through from time to time), so i expect it to be possible in the linux world too ;)

    Read the article

  • Calculate the contentsize of scrollview

    - by neha
    Hi all, I'm having a scrollview as the detailedview of tableview cell. There are multiple views on the detailedview like labels, buttons etc. which I'm creating through interface builder. What I'm creating through interface builder is static. I'm putting everything on a view of height 480. A label on my detailedview is having dynamic text which can extend to any length. The problem is that I need to set the scrollview's content size for which I need its height. How shall I set scrollview's height provided the content is dynamic?

    Read the article

  • C++ game designing & polymorphism question

    - by Kotti
    Hi! I'm trying to implement some sort of 'just-for-me' game engine and the problem's plot goes the following way: Suppose I have some abstract interface for a renderable entity, e.g. IRenderable. And it's declared the following way: interface IRenderable { // (...) // Suppose that Backend is some abstract backend used // for rendering, and it's implementation is not important virtual void Render(Backend& backend) = 0; }; What I'm doing right now is something like declaring different classes like class Ball : public IRenderable { virtual void Render(Backend& backend) { // Rendering implementation, that is specific for // the Ball object // (...) } }; And then everything looks fine. I can easily do something like std::vector<IRenderable*> items, push some items like new Ball() in this vector and then make a call similiar to foreach (IRenderable* in items) { item->Render(backend); } Ok, I guess it is the 'polymorphic' way, but what if I want to have different types of objects in my game and an ability to manipulate their state, where every object can be manipulated via it's own interface? I could do something like struct GameState { Ball ball; Bonus bonus; // (...) }; and then easily change objects state via their own methods, like ball.Move(...) or bonus.Activate(...), where Move(...) is specific for only Ball and Activate(...) - for only Bonus instances. But in this case I lose the opportunity to write foreach IRenderable* simply because I store these balls and bonuses as instances of their derived, not base classes. And in this case the rendering procedure turns into a mess like ball.Render(backend); bonus.Render(backend); // (...) and it is bad because we actually lose our polymorphism this way (no actual need for making Render function virtual, etc. The other approach means invoking downcasting via dynamic_cast or something with typeid to determine the type of object you want to manipulate and this looks even worse to me and this also breaks this 'polymorphic' idea. So, my question is - is there some kind of (probably) alternative approach to what I want to do or can my current pattern be somehow modified so that I would actually store IRenderable* for my game objects (so that I can invoke virtual Render method on each of them) while preserving the ability to easily change the state of these objects? Maybe I'm doing something absolutely wrong from the beginning, if so, please point it out :) Thanks in advance!

    Read the article

  • What's the best software analogy you've heard?

    - by Mantorok
    Hi Quite frequently I have to explain things to Project Managers who sometimes want to know a little bit more about something, and sometimes I try and come up with some analogy that best explains it. Now, I can't really kick this off with a good analagy because mine usually suck, but I would be interested in yours, or some you've heard that have been used to simplify explanations. One analogy that does come up often is when explaining Interfaces (i.e. .Net) to which I usually explain in terms of a vehicle has a driver interface, and all vehicles must implement that interface so that anyone who can drive a vehicle will be able to utilise it. Any more? Would like to hear some, both serious and humourous. Please close if a duplicate.

    Read the article

  • Starting new transaction in Spring bean

    - by Marcus
    We have: @Transactional(propagation = Propagation.REQUIRED) public class MyClass implementes MyInterface { ... MyInterface has a single method: go(). When go() executes we start a new transaction which commits/rollbacks when the method is complete - this is fine. Now let's say in go() we call a private method in MyClass that has @Transactional(propagation = Propagation.REQUIRES_NEW. It seems that Spring "ignores" the REQUIRES_NEW annotation and does not start a new transaction. I believe this is because Spring AOP operates on the interface level (MyInterface) and does not intercept any calls to MyClass methods. Is this correct? Is there any way to start a new transaction within the go() transaction? Is the only way to call another Spring managed bean that has transactions configured as REQUIRES_NEW? Update: Adding that when clients execute go() they do so via a reference to the interface, not the class: @Autowired MyInterface impl; impl.go();

    Read the article

  • Does collections type conversion util methods already exist in any API?

    - by Delta
    interface TypeConverter<T, E> { T convert(E e); } class CollectionUtil() { public static <E> List<T> convertToList(List<E> fromList, TypeConverter<T, E> conv) { { if(fromList== null) return null; List<T> newList = new ArrayList<T>(fromList.size()) for(E e : fromList) { newList.add(conv.convert(e)); } return newList; } } Above code explains converting from List of String to List of Integer by implementing TypeConverter interface for String, Integer. Are there already any collections conversion utility methods exists in any API like list to set and so on?

    Read the article

  • What is your favorite way to read XML files?

    - by stacker
    Let's take this xml structure as example: <?xml version="1.0" encoding="utf-8"?> <Configuration-content> <XFile Name="file name 1" /> <XFile Name="name2" /> <XFile Name="name3" /> <XFile Name="name4" /> </Configuration-content> C# interface to implement: public class Configuration { public XFile[] Files { get; set; } } public interface IConfigurationRipository { Configuration Get(); void Save(Configuration entity); } I wonder what's the best way to do that. The task is to implement IConfigurationRipository using your favorite approach.

    Read the article

  • c# Generic overloaded method dispatching ambiguous

    - by sebgod
    Hello, I just hit a situation where a method dispatch was ambiguous and wondered if anyone could explain on what basis the compiler (.NET 4.0.30319) chooses what overload to call interface IfaceA { } interface IfaceB<T> { void Add(IfaceA a); T Add(T t); } class ConcreteA : IfaceA { } class abstract BaseClassB<T> : IfaceB<T> { public virtual T Add(T t) { ... } public virtual void Add(IfaceA a) { ... } } class ConcreteB : BaseClassB<IfaceA> { // does not override one of the relevant methods } void code() { var concreteB = new ConcreteB(); // it will call void Add(IfaceA a) concreteB.Add(new ConcreteA()); } In any case, why does the compiler not warn me or even why does it compile? Thank you very much for any answers.

    Read the article

  • Need help with developing a class for my JUnit test

    - by alpdog14
    I have this JUnit test that I need help developing a Interface and Class for, here is the test: Box b1 = new DefaultBox( "abc" ); Box b2 = new DefaultBox( "def" ); Box b3 = new DefaultBox( "" ); assertEquals("abc", b1.contents()); assertEquals("[abc]", b1.toString()); assertTrue(b1.equals(b1)); assertFalse(b1.equals(b2)); assertFalse(b1.equals(null)); assertEquals("cba", b1.flip().contents()); assertEquals("", b3.flip().contents()); can anyone help me in developing a Default box class and a box interface to make these test pass? Any help would be most appreciated.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • What's going on with "expected specifier-qualifier-list" error

    - by Tattat
    It is my GameEngine.h: #import <Foundation/Foundation.h> #import "GameArray.h"; @interface GameEngine : NSObject { GameArray *gameButtonsArray; } @property (nonatomic, retain) GameArray *gameButtonsArray; And this is my GameArray.h: #import <Foundation/Foundation.h> #import "MyAppDelegate.h" @interface GameArray : NSObject { NSMutableArray *gameButtonsArray; } @property (nonatomic, retain) NSMutableArray *gameButtonsArray; It keep prompt my "expected specifier-qualifier-list" error i my GameEngine.h, and error said that "expected specifier-qualifier-list before 'GameArray'", what's going on?

    Read the article

  • Multi language CMS?

    - by Adam
    Is there any CMS such as expression engine or wordpress that allows a user to click a button and convert all the text to another language (it would have to be human generated otherwise it has too many mistakes probably). I'd like to know if there are any good solutions out there that work for real world use, in like business company websites.

    Read the article

< Previous Page | 354 355 356 357 358 359 360 361 362 363 364 365  | Next Page >