Search Results

Search found 999 results on 40 pages for 'substring'.

Page 36/40 | < Previous Page | 32 33 34 35 36 37 38 39 40  | Next Page >

  • VS2008: File creation fails randomly in unit testing?

    - by Tim
    I'm working on implementing a reasonably simple XML serializer/deserializer (log file parser) application in C# .NET with VS 2008. I have about 50 unit tests right now for various parts of the code (mostly for the various serialization operations), and some of them seem to be failing mostly at random when they deal with file I/O. The way the tests are structured is that in the test setup method, I create a new empty file at a certain predetermined location, and close the stream I get back. Then I run some basic tests on the file (varying by what exactly is under test). In the cleanup method, I delete the file again. A large portion (usually 30 or more, though the number varies run to run) of my unit tests will fail at the initialize method, claiming they can't access the file I'm trying to create. I can't pin down the exact reason, since a test that will work one run fails the next; they all succeed when run individually. What's the problem here? Why can't I access this file across multiple unit tests? Relevant methods for a unit test that will fail some of the time: [TestInitialize()] public void LogFileTestInitialize() { this.testFolder = System.Environment.GetFolderPath( System.Environment.SpecialFolder.LocalApplicationData ); this.testPath = this.testFolder + "\\empty.lfp"; System.IO.File.Create(this.testPath); } [TestMethod()] public void LogFileConstructorTest() { string filePath = this.testPath; LogFile target = new LogFile(filePath); Assert.AreNotEqual(null, target); Assert.AreEqual(this.testPath, target.filePath); Assert.AreEqual("empty.lfp", target.fileName); Assert.AreEqual(this.testFolder + "\\empty.lfp.lfpdat", target.metaPath); } [TestCleanup()] public void LogFileTestCleanup() { System.IO.File.Delete(this.testPath); } And the LogFile() constructor: public LogFile(String filePath) { this.entries = new List<Entry>(); this.filePath = filePath; this.metaPath = filePath + ".lfpdat"; this.fileName = filePath.Substring(filePath.LastIndexOf("\\") + 1); } The precise error message: Initialization method LogFileParserTester.LogFileTest.LogFileTestInitialize threw exception. System.IO.IOException: System.IO.IOException: The process cannot access the file 'C:\Users\<user>\AppData\Local\empty.lfp' because it is being used by another process..

    Read the article

  • List input and output audio devices in Applet

    - by Jhonny Everson
    I am running a signed applet that needs to provide the ability for the user to select the input and output audio devices ( similar to what skype provides). I borrowed the following code from other thread: import javax.sound.sampled.*; public class SoundAudit { public static void main(String[] args) { try { System.out.println("OS: "+System.getProperty("os.name")+" "+ System.getProperty("os.version")+"/"+ System.getProperty("os.arch")+"\nJava: "+ System.getProperty("java.version")+" ("+ System.getProperty("java.vendor")+")\n"); for (Mixer.Info thisMixerInfo : AudioSystem.getMixerInfo()) { System.out.println("Mixer: "+thisMixerInfo.getDescription()+ " ["+thisMixerInfo.getName()+"]"); Mixer thisMixer = AudioSystem.getMixer(thisMixerInfo); for (Line.Info thisLineInfo:thisMixer.getSourceLineInfo()) { if (thisLineInfo.getLineClass().getName().equals( "javax.sound.sampled.Port")) { Line thisLine = thisMixer.getLine(thisLineInfo); thisLine.open(); System.out.println(" Source Port: " +thisLineInfo.toString()); for (Control thisControl : thisLine.getControls()) { System.out.println(AnalyzeControl(thisControl));} thisLine.close();}} for (Line.Info thisLineInfo:thisMixer.getTargetLineInfo()) { if (thisLineInfo.getLineClass().getName().equals( "javax.sound.sampled.Port")) { Line thisLine = thisMixer.getLine(thisLineInfo); thisLine.open(); System.out.println(" Target Port: " +thisLineInfo.toString()); for (Control thisControl : thisLine.getControls()) { System.out.println(AnalyzeControl(thisControl));} thisLine.close();}}} } catch (Exception e) {e.printStackTrace();}} public static String AnalyzeControl(Control thisControl) { String type = thisControl.getType().toString(); if (thisControl instanceof BooleanControl) { return " Control: "+type+" (boolean)"; } if (thisControl instanceof CompoundControl) { System.out.println(" Control: "+type+ " (compound - values below)"); String toReturn = ""; for (Control children: ((CompoundControl)thisControl).getMemberControls()) { toReturn+=" "+AnalyzeControl(children)+"\n";} return toReturn.substring(0, toReturn.length()-1);} if (thisControl instanceof EnumControl) { return " Control:"+type+" (enum: "+thisControl.toString()+")";} if (thisControl instanceof FloatControl) { return " Control: "+type+" (float: from "+ ((FloatControl) thisControl).getMinimum()+" to "+ ((FloatControl) thisControl).getMaximum()+")";} return " Control: unknown type";} } But what I get: Mixer: Software mixer and synthesizer [Java Sound Audio Engine] Mixer: No details available [Microphone (Pink Front)] I was expecting the get the real list of my devices (My preferences panels shows 3 output devices and 1 Microphone). I am running on Mac OS X 10.6.7. Is there other way to get that info from Java?

    Read the article

  • Ajax doesn't trigger a change-event on a webkit based browser

    - by user319464
    I have adapted a Jquery plugin to for-fill my needs to send GET requests to servers as a way of "pinging" them. I've also added some javascript code to add some fancy features like: depending on the changed value in a that the Jquery plugin changes, it changes the Icon accordingly. To make it all work essentially, I made so that when Ajax gets a "complete" event, it forces a "onChange" event to the span, triggering the javascript validation function to change the status icons. Here is the code of my slightly modified jQuery Plugin: /** * ping for jQuery * * Adapted by Carroarmato0 (to actually work instead of randomly "pinging" nowhere instead of faking * * @auth Jessica * @link http://www.skiyo.cn/demo/jquery.ping/ * */ (function($) { $.fn.ping = function(options) { var opts = $.extend({}, $.fn.ping.defaults, options); return this.each(function() { var ping, requestTime, responseTime ; var target = $(this); var server = target.html(); target.html('<img src="img/loading.gif" alt="loading" />'); function ping() { $.ajax({url: 'http://' + server, type: 'GET', dataType: 'html', timeout: 30000, beforeSend : function() { requestTime = new Date().getTime(); }, complete : function() { responseTime = new Date().getTime(); ping = Math.abs(requestTime - responseTime); if (ping > 2000) { target.text('niet bereikbaar'); } else { target.text(ping + opts.unit); } target.change(); } }); } ping(); opts.interval != 0 && setInterval(ping,opts.interval * 1000); }); }; $.fn.ping.defaults = { interval: 3, unit: 'ms' }; })(jQuery); target.change(); is the code that triggers the "onchange" event in the span: echo " <td class=\"center\"><span id=\"ping$pingNb\" onChange=\"checkServerIcon(this)\" >" .$server['IP'] . "</span></td>"; In Firefox this works, checkServerIcon(this) gets executed and passes the span object to the function. function checkServerIcon(object) { var delayText = object.innerHTML; var delay = delayText.substring(0, delayText.length - 2); if ( isInteger(delay) ) { object.parentNode.previousSibling.parentNode.getElementsByTagName('img')[0].src = 'img/servers/enable_server.png'; } else { if (delay == "bezig.") { object.parentNode.previousSibling.parentNode.getElementsByTagName('img')[0].src = 'img/servers/search_server.png'; } else { object.parentNode.previousSibling.parentNode.getElementsByTagName('img')[0].src = 'img/servers/desable_server.png'; } } } My guess would be that there's something different in WebKit browsers in the way object.parentNode.previousSibling.parentNode. .... works...

    Read the article

  • Xsl mime type problem

    - by savruk
    Hi, I have a busybox with lighttpd running on as http server. My problem is while firefox and opera can get the page with applied xsl, Arora(webkit) can not. Here is the script I use to get it work: <html> <head> <script> function loadXMLDoc(dname) { if (window.XMLHttpRequest) { xhttp=new XMLHttpRequest(); } else { xhttp=new ActiveXObject("Microsoft.XMLHTTP"); } xhttp.open("GET",dname,false); xhttp.send(""); return xhttp.responseXML; } function querySt(ji) { hu = window.location.search.substring(1); gy = hu.split("&"); for (i=0;i<gy.length;i++) { ft = gy[i].split("="); if (ft[0] == ji) { return ft[1]; } } } function displayResult() { xml=loadXMLDoc("sample.xml"); alert(xml)//Gives [object Document] $scan=querySt("scan"); $sub = querySt("sub"); xsl=loadXMLDoc("sample.xsl"); alert(xsl)//Gives Null // code for IE if (window.ActiveXObject) { ex=xml.transformNode(xsl); document.getElementById("example").innerHTML=ex; } // code for Mozilla, Firefox, Opera, etc. else if (document.implementation && document.implementation.createDocument) { xsltProcessor=new XSLTProcessor(); xsltProcessor.importStylesheet(xsl); xsltProcessor.setParameter(null,"scan",$scan) if($sub != ""){ xsltProcessor.setParameter(null,"sub",$sub) } resultDocument = xsltProcessor.transformToFragment(xml,document); document.getElementById("example").appendChild(resultDocument); } } </script> </head> <body onload="displayResult()"> <div id="example" ></div> </body> </html> I tried to see if it load xsl well and put an alert(xsl) but it gives null. Other browser can get xml and xsl files perfectly. What can be the problem? Thanks P.S: It runs well on my local server with all browser.

    Read the article

  • Invalid character in a Base-64 string when Concatenating and Url encoding a string

    - by Rob
    I’m trying to write some encryption code that is passed through a Url. For the sake of the issue I’ve excluded the actual encryption of the data and just shown the code causing the problem. I take a salt value, convert it to a byte array and then convert that to a base64 string. This string I concatenate to another base64 string (which was previously a byte array). These two base64 strings are then Url encoded. Here’s my code... using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Security.Cryptography; using System.IO; using System.Web; class RHEncryption { private static readonly Encoding ASCII_ENCODING = new System.Text.ASCIIEncoding(); private static readonly string SECRET_KEY = "akey"; private static string md5(string text) { return BitConverter.ToString(new MD5CryptoServiceProvider().ComputeHash(ASCII_ENCODING.GetBytes(text))).Replace("-", "").ToLower(); } public string UrlEncodedData; public RHEncryption() { // encryption object RijndaelManaged aes192 = new RijndaelManaged(); aes192.KeySize = 192; aes192.BlockSize = 192; aes192.Mode = CipherMode.CBC; aes192.Key = ASCII_ENCODING.GetBytes(md5(SECRET_KEY)); aes192.GenerateIV(); // convert Ivector to base64 for sending string base64IV = Convert.ToBase64String(aes192.IV); // salt value string s = "maryhadalittlelamb"; string salt = s.Substring(0, 8); // convert to byte array // and base64 for sending byte[] saltBytes = ASCII_ENCODING.GetBytes(salt.TrimEnd('\0')); string base64Salt = Convert.ToBase64String(saltBytes); //url encode concatenated base64 strings UrlEncodedData = HttpUtility.UrlEncode(base64Salt + base64IV, ASCII_ENCODING); } public string UrlDecodedData() { // decode the url encode string string s = HttpUtility.UrlDecode(UrlEncodedData, ASCII_ENCODING); // convert back from base64 byte[] base64DecodedBytes = null; try { base64DecodedBytes = Convert.FromBase64String(s); } catch (FormatException e) { Console.WriteLine(e.Message.ToString()); Console.ReadLine(); } return s; } } If I then call the UrlDecodedData method I get a “Invalid character in a Base-64 string” exception. This is generated because the base64Salt variable contains an invalid character (I’m guessing a line termination) but I can’t seem to strip it off.

    Read the article

  • How to do a search from a list with non-prefix keywords

    - by aNui
    First of all, sorry if my english or my post got any mistakes. I am programming a program to search the name from the list and I need to find them if the keyword is not in front of the names (that's what I mean non-prefix) e.g. if I my list is the music instruments and I type "guit" to the search textbox. It should find the names "Guitar, Guitarrón, Acoustic Guitar, Bass Guitar, ..." or something like this Longdo Dictionary's search suggestion. here is my simple and stupid algorithm (that's all I can do) const int SEARCHROWLIMIT = 30; private string[] DoSearch(string Input, string[] ListToSearch) { List<string> FoundNames = new List<string>(); int max = 0; bool over = false; for (int k = 0; !over; k++) { foreach (string item in ListToSearch) { max = (max > item.Length) ? max : item.Length; if (k > item.Length) continue; if (k >= max) { over = true; break; } if (!Input.Equals("Search") && item.Substring(k, item.Length - k).StartsWith(Input, StringComparison.OrdinalIgnoreCase)) { bool exist = false; int i = 0; while (!exist && i < FoundNames.Count) { if (item.Equals(FoundNames[i])) { exist = true; break; } i++; } if (!exist && FoundNames.Count < SEARCHROWLIMIT) FoundNames.Add(item); else if (FoundNames.Count >= SEARCHROWLIMIT) over = true; } } } return FoundNames.ToArray(); } I think this algorithm is too slow for a large number of names and after several trial-and-error, I decided to add SEARCHROWLIMIT to breaks the operation And I also think there're some readymade methods that can do that. And another problem is I need to search music instruments by a category like strings, percussions, ... and by the country of origins. So I need to search them with filter by type and country. please help me. P.S. Me and my friends are just student from Thailand and developing the project to compete in Microsoft Imagine Cup 2010 and please become fan on our facebook page [KRATIB][3]. And we're so sorry we don't have much information in English but you can talk to us in English.

    Read the article

  • [Java] Send cookie with http request problem

    - by nkr1pt
    I'm trying to get a certain cookie in a java client by creating a series of Http requests. It looks like I'm getting a valid cookie from the server but when I'm sending out a request to the fnal url with the seemingly valid cookie I should get some lines of xml in the response but the response is blank because the cookie isw rong or is invalidated because a session has closed or an other problem which I can't figure out. The cookie handed out by the server expires at the end of the session. It seems to me the cookie is valid because when I do the same calls in firefox, a similar cookie with the same name and starting with the 3 first same letters and of the same length is stored in firefox, also expiring at the end of the session. If I then make a request to the final url with only this particular cookie stored in firefox (removed all other cookies), the xml is nicely rendered on the page. Any ideas about what I am doing wrong in this piece of code? One other thing, when I use the value from the very similar cookie generated and strored in firefox in this piece of code, the last request does give xml feedback in the http response! // Validate url = new URL(URL_VALIDATE); conn = (HttpURLConnection) url.openConnection(); conn.setRequestProperty("Cookie", cookie); conn.connect(); String headerName = null; for (int i = 1; (headerName = conn.getHeaderFieldKey(i)) != null; i++) { if (headerName.equals("Set-Cookie")) { if (conn.getHeaderField(i).startsWith("JSESSIONID")) { cookie = conn.getHeaderField(i).substring(0, conn.getHeaderField(i).indexOf(";")).trim(); } } } // Get the XML url = new URL(URL_XML_TOTALS); conn = (HttpURLConnection) url.openConnection(); conn.setRequestProperty("Cookie", cookie); conn.connect(); // Get the response StringBuffer answer = new StringBuffer(); BufferedReader reader = new BufferedReader(new InputStreamReader(conn.getInputStream())); String line; while ((line = reader.readLine()) != null) { answer.append(line); } reader.close(); //Output the response System.out.println(answer.toString())

    Read the article

  • How to do a search from a list with non-prefix keywords[Solved]

    - by aNui
    The Problem is Solved. Thanks for every answers. First of all, sorry if my english or my post got any mistakes. I am programming a program to search the name from the list and I need to find them even if the keyword is not in front of the names (that's what I mean non-prefix) e.g. if I my list is the music instruments and I type "guit" to the search textbox. It should find the names "Guitar, Guitarrón, Acoustic Guitar, Bass Guitar, ..." or something like this Longdo Dictionary's search suggestion. here is my simple and stupid algorithm (that's all I can do) const int SEARCHROWLIMIT = 30; private string[] DoSearch(string Input, string[] ListToSearch) { List<string> FoundNames = new List<string>(); int max = 0; bool over = false; for (int k = 0; !over; k++) { foreach (string item in ListToSearch) { max = (max > item.Length) ? max : item.Length; if (k > item.Length) continue; if (k >= max) { over = true; break; } if (!Input.Equals("Search") && item.Substring(k, item.Length - k).StartsWith(Input, StringComparison.OrdinalIgnoreCase)) { bool exist = false; int i = 0; while (!exist && i < FoundNames.Count) { if (item.Equals(FoundNames[i])) { exist = true; break; } i++; } if (!exist && FoundNames.Count < SEARCHROWLIMIT) FoundNames.Add(item); else if (FoundNames.Count >= SEARCHROWLIMIT) over = true; } } } return FoundNames.ToArray(); } I think this algorithm is too slow for a large number of names and after several trial-and-error, I decided to add SEARCHROWLIMIT to breaks the operation And I also think there're some readymade methods that can do that. And another problem is I need to search music instruments by a category like strings, percussions, ... and by the country of origins. So I need to search them with filter by type and country. please help me. P.S. Me and my friends are just student from Thailand and developing the project to compete in Microsoft Imagine Cup 2010 and please become fan on our facebook page [KRATIB][3]. And we're so sorry we don't have much information in English but you can talk to us in English.

    Read the article

  • Extending Enums, Overkill?

    - by CkH
    I have an object that needs to be serialized to an EDI format. For this example we'll say it's a car. A car might not be the best example b/c options change over time, but for the real object the Enums will never change. I have many Enums like the following with custom attributes applied. public enum RoofStyle { [DisplayText("Glass Top")] [StringValue("GTR")] Glass, [DisplayText("Convertible Soft Top")] [StringValue("CST")] ConvertibleSoft, [DisplayText("Hard Top")] [StringValue("HT ")] HardTop, [DisplayText("Targa Top")] [StringValue("TT ")] Targa, } The Attributes are accessed via Extension methods: public static string GetStringValue(this Enum value) { // Get the type Type type = value.GetType(); // Get fieldinfo for this type FieldInfo fieldInfo = type.GetField(value.ToString()); // Get the stringvalue attributes StringValueAttribute[] attribs = fieldInfo.GetCustomAttributes( typeof(StringValueAttribute), false) as StringValueAttribute[]; // Return the first if there was a match. return attribs.Length > 0 ? attribs[0].StringValue : null; } public static string GetDisplayText(this Enum value) { // Get the type Type type = value.GetType(); // Get fieldinfo for this type FieldInfo fieldInfo = type.GetField(value.ToString()); // Get the DisplayText attributes DisplayTextAttribute[] attribs = fieldInfo.GetCustomAttributes( typeof(DisplayTextAttribute), false) as DisplayTextAttribute[]; // Return the first if there was a match. return attribs.Length > 0 ? attribs[0].DisplayText : value.ToString(); } There is a custom EDI serializer that serializes based on the StringValue attributes like so: StringBuilder sb = new StringBuilder(); sb.Append(car.RoofStyle.GetStringValue()); sb.Append(car.TireSize.GetStringValue()); sb.Append(car.Model.GetStringValue()); ... There is another method that can get Enum Value from StringValue for Deserialization: car.RoofStyle = Enums.GetCode<RoofStyle>(EDIString.Substring(4, 3)) Defined as: public static class Enums { public static T GetCode<T>(string value) { foreach (object o in System.Enum.GetValues(typeof(T))) { if (((Enum)o).GetStringValue() == value.ToUpper()) return (T)o; } throw new ArgumentException("No code exists for type " + typeof(T).ToString() + " corresponding to value of " + value); } } And Finally, for the UI, the GetDisplayText() is used to show the user friendly text. What do you think? Overkill? Is there a better way? or Goldie Locks (just right)? Just want to get feedback before I intergrate it into my personal framework permanently. Thanks.

    Read the article

  • Performance of SHA-1 Checksum from Android 2.2 to 2.3 and Higher

    - by sbrichards
    In testing the performance of: package com.srichards.sha; import android.app.Activity; import android.os.Bundle; import android.widget.TextView; import java.io.IOException; import java.io.InputStream; import java.security.MessageDigest; import java.security.NoSuchAlgorithmException; import java.util.zip.ZipEntry; import java.util.zip.ZipFile; import com.srichards.sha.R; public class SHAHashActivity extends Activity { /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); TextView tv = new TextView(this); String shaVal = this.getString(R.string.sha); long systimeBefore = System.currentTimeMillis(); String result = shaCheck(shaVal); long systimeResult = System.currentTimeMillis() - systimeBefore; tv.setText("\nRunTime: " + systimeResult + "\nHas been modified? | Hash Value: " + result); setContentView(tv); } public String shaCheck(String shaVal){ try{ String resultant = "null"; MessageDigest digest = MessageDigest.getInstance("SHA1"); ZipFile zf = null; try { zf = new ZipFile("/data/app/com.blah.android-1.apk"); // /data/app/com.blah.android-2.apk } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); } ZipEntry ze = zf.getEntry("classes.dex"); InputStream file = zf.getInputStream(ze); byte[] dataBytes = new byte[32768]; //65536 32768 int nread = 0; while ((nread = file.read(dataBytes)) != -1) { digest.update(dataBytes, 0, nread); } byte [] rbytes = digest.digest(); StringBuffer sb = new StringBuffer(""); for (int i = 0; i< rbytes.length; i++) { sb.append(Integer.toString((rbytes[i] & 0xff) + 0x100, 16).substring(1)); } if (shaVal.equals(sb.toString())) { resultant = ("\nFalse : " + "\nFound:\n" + sb.toString() + "|" + "\nHave:\n" + shaVal); } else { resultant = ("\nTrue : " + "\nFound:\n" + sb.toString() + "|" + "\nHave:\n" + shaVal); } return resultant; } catch (IOException e) { e.printStackTrace(); } catch (NoSuchAlgorithmException e) { e.printStackTrace(); } return null; } } On a 2.2 Device I get average runtime of ~350ms, while on newer devices I get runtimes of 26-50ms which is substantially lower. I'm keeping in mind these devices are newer and have better hardware but am also wondering if the platform and the implementation affect performance much and if there is anything that could reduce runtimes on 2.2 devices. Note, the classes.dex of the .apk being accessed is roughly 4MB. Thanks!

    Read the article

  • Drupal incorrectly escapes tags in javascript

    - by sergdev
    I installed drupal-6.16. I applied the patch from the post http://drupal.org/node/222926#comment-930745. It works correctly in simple cases. But following code of counter is handled incorrectly and counter is now displayed on the page after drupal. Drupal modifies the string "alt='1Gb.ua counter' /><\/a>")</a></script> to "alt='1Gb.ua counter' />&lt;\/a>")</a></script> The full code of counter follows: <br><br> Text <br><br> <!-- counter.1Gb.ua --> <script language="javascript" type="text/javascript"> cgb_js="1.0"; cgb_r=""+Math.random()+"&r="+ escape(document.referrer)+"&pg="+ escape(window.location.href); document.cookie="rqbct=1; path=/"; cgb_r+="&c="+ (document.cookie?"Y":"N"); </script><script language="javascript1.1" type="text/javascript"> cgb_js="1.1";cgb_r+="&j="+ (navigator.javaEnabled()?"Y":"N")</script> <script language="javascript1.2" type="text/javascript"> cgb_js="1.2"; cgb_r+="&wh="+screen.width+ 'x'+screen.height+"&px="+ (((navigator.appName.substring(0,3)=="Mic"))? screen.colorDepth:screen.pixelDepth)</script> <script language="javascript1.3" type="text/javascript"> cgb_js="1.3"</script> <script language="javascript" type="text/javascript">cgb_r+="&js="+cgb_js; document.write("<a href='http://www.1Gb.ua?cnt=1416'>"+ "<img src='http://counter.1Gb.ua/cnt.aspx?"+ "u=1416&"+cgb_r+ "&' border=0 width=88 height=31 "+ "alt='1Gb.ua counter'><\/a>")</script> <noscript><a href='http://www.1Gb.ua?cnt=1416'> <img src="http://counter.1Gb.ua/cnt.aspx?u=1416" border=0 width="88" height="31" alt="1Gb.ua counter"></a> </noscript> <!-- /counter.1Gb.ua --> Does anybody have this code working? How can it be fixed? Thanks a lot in advance!

    Read the article

  • .Net Entity Framework SaveChanges is adding without add method

    - by tmfkmoney
    I'm new to the entity framework and I'm really confused about how savechanges works. There's probably a lot of code in my example which could be improved, but here's the problem I'm having. The user enters a bunch of picks. I make sure the user hasn't already entered those picks. Then I add the picks to the database. var db = new myModel() var predictionArray = ticker.Substring(1).Split(','); // Get rid of the initial comma. var user = Membership.GetUser(); var userId = Convert.ToInt32(user.ProviderUserKey); // Get the member with all his predictions for today. var memberQuery = (from member in db.Members where member.user_id == userId select new { member, predictions = from p in member.Predictions where p.start_date == null select p }).First(); // Load all the company ids. foreach (var prediction in memberQuery.predictions) { prediction.CompanyReference.Load(); } var picks = from prediction in predictionArray let data = prediction.Split(':') let companyTicker = data[0] where !(from i in memberQuery.predictions select i.Company.ticker).Contains(companyTicker) select new Prediction { Member = memberQuery.member, Company = db.Companies.Where(c => c.ticker == companyTicker).First(), is_up = data[1] == "up", // This turns up and down into true and false. }; // Save the records to the database. // HERE'S THE PART I DON'T UNDERSTAND. // This saves the records, even though I don't have db.AddToPredictions(pick) foreach (var pick in picks) { db.SaveChanges(); } // This does not save records when the db.SaveChanges outside of a loop of picks. db.SaveChanges(); foreach (var pick in picks) { } // This saves records, but it will insert all the picks exactly once no matter how many picks you have. //The fact you're skipping a pick makes no difference in what gets inserted. var counter = 1; foreach (var pick in picks) { if (counter == 2) { db.SaveChanges(); } counter++; } There's obviously something going on with the context I don't understand. I'm guessing I've somehow loaded my new picks as pending changes, but even if that's true I don't understand I have to loop over them to save changes. Can someone explain this to me?

    Read the article

  • Static method not called

    - by Smile
    I'm trying to call a static method (printABC()) in this class but it's not working. If I uncomment both of the lines marked T_T (1 and 2), it works! Why does it fail with only one of the lines? import java.util.Scanner; class pro0009 { static Scanner in = new Scanner(System.in); static int A,B,C; static void printABC(){ String ABC = in.nextLine(); ABC=ABC.replace("A"," "+A+" "); ABC=ABC.replace("B"," "+B+" "); ABC=ABC.replace("C"," "+C+" "); //System.out.print(ABC.substring(1)); System.out.print(ABC); } public static void main(String[] args){ int x = in.nextInt(); //1 int y = in.nextInt(); //2 int z = in.nextInt(); //3 if(x<y){//1<2 if(x<z){ //1<3 if(y<z){//x<y<z 2<3 //1<2<3 A=x; B=y; C=z; printABC();//T_T 1 System.out.println("Here"); //pro0009.printABC();//T_T 2 //System.out.println("Here2"); }else{ //x<z<y A=x; B=z; C=y; } }else{//z<x<y A=z; B=x; C=y; } }else{//y<x if(y<z){ if(x<z){//y<x<z A=y; B=x; C=z; }else{//y<z<x A=y; B=z; C=x; } }else{//z<y<x A=z; B=y; C=x; } } } }

    Read the article

  • Java Socket Connection is flooding network OR resulting in high ping

    - by user1461100
    i have a little problem with my java socket code. I'm writing an android client application which is sending data to a java multithreaded socket server on my pc through direct(!) wireless connection. It works fine but i want to improve it for mobile applications as it is very power consuming by now. When i remove two special lines in my code, the cpu usage of my mobile device (htc one x) is totally okay but then my connection seems to have high ping rates or something like that... Here is a server code snippet where i receive the clients data: while(true) { try { .... Object obj = in.readObject(); if(obj != null) { Class clazz = obj.getClass(); String className = clazz.getName(); if(className.equals("java.lang.String")) { String cmd = (String)obj; if(cmd.equals("dc")) { System.out.println("Client "+id+" disconnected!"); Server.connectedClients[id-1] = false; break; } if(cmd.substring(0,1).equals("!")) { robot.keyRelease(PlayerEnum.getKey(cmd,id)); } else { robot.keyPress(PlayerEnum.getKey(cmd,id)); } } } } catch .... Heres the client part, where i send my data in a while loop: private void networking() { try { if(client != null) { .... out.writeObject(sendQueue.poll()); .... } } catch .... when i write it this why, i send data everytime the while loop gets executed.. when sendQueue is empty, a null "Object" will be send. this results in "high" network traffic and in "high" cpu usage. BUT: all send comments are received nearly immediately. when i change the code to following: while(true) ... if(sendQueue.peek() != null) { out.writeObject(sendQueue.poll()); } ... the cpu usage is totally okay but i'm getting some laggs.. the commands do not arrive fast enough.. as i said, it works fine (besides cpu usage) if i'm sending data(with that null objects) every while execution. but i'm sure that this is very rough coding style because i'm kind of flooding the network. any hints? what am i doing wrong?? Thanks for your Help! Sincerly yours, maaft

    Read the article

  • PHP Regex: How to match anything except a pattern between two tags

    - by Ryan
    Hello, I am attempting to match a string which is composed of HTML. Basically it is an image gallery so there is a lot of similarity in the string. There are a lot of <dl> tags in the string, but I am looking to match the last <dl>(.?)+</dl> combo that comes before a </div>. The way I've devised to do this is to make sure that there aren't any <dl's inside the <dl></dl> combo I'm matching. I don't care what else is there, including other tags and line breaks. I decided I had to do it with regular expressions because I can't predict how long this substring will be or anything that's inside it. Here is my current regex that only returns me an array with two NULL indicies: preg_match_all('/<dl((?!<dl).)+<\/dl>(?=<\/div>)/', $foo, $bar) As you can see I use negative lookahead to try and see if there is another <dl> within this one. I've also tried negative lookbehind here with the same results. I've also tried using +? instead of just + to no avail. Keep in mind that there's no pattern <dl><dl></dl> or anything, but that my regex is either matching the first <dl> and the last </dl> or nothing at all. Now I realize . won't match line breaks but I've tried anything I could imagine there and it still either provides me with the NULL indicies or nearly the whole string (from the very first occurance of <dl to </dl></div>, which includes several other occurances of <dl>, exactly what I didn't want). I honestly don't know what I'm doing incorrectly. Thanks for your help! I've spent over an hour just trying to straighten out this one problem and it's about driven me to pulling my hair out.

    Read the article

  • Finding the most frequent subtrees in a collection of (parse) trees

    - by peter.murray.rust
    I have a collection of trees whose nodes are labelled (but not uniquely). Specifically the trees are from a collection of parsed sentences (see http://en.wikipedia.org/wiki/Treebank). I wish to extract the most common subtrees from the collection - performance is not (yet) an issue. I'd be grateful for algorithms (ideally Java) or pointers to tools which do this for treebanks. Note that order of child nodes is important. EDIT @mjv. We are working in a limited domain (chemistry) which has a stylised language so the varirty of the trees is not huge - probably similar to children's readers. Simple tree for "the cat sat on the mat". <sentence> <nounPhrase> <article/> <noun/> </nounPhrase> <verbPhrase> <verb/> <prepositionPhrase> <preposition/> <nounPhrase> <article/> <noun/> </nounPhrase> </prepositionPhrase> </verbPhrase> </sentence> Here the sentence contains two identical part-of-speech subtrees (the actual tokens "cat". "mat" are not important in matching). So the algorithm would need to detect this. Note that not all nounPhrases are identical - "the big black cat" could be: <nounPhrase> <article/> <adjective/> <adjective/> <noun/> </nounPhrase> The length of sentences will be longer - between 15 to 30 nodes. I would expect to get useful results from 1000 trees. If this does not take more than a day or so that's acceptable. Obviously the shorter the tree the more frequent, so nounPhrase will be very common. EDIT If this is to be solved by flattening the tree then I think it would be related to Longest Common Substring, not Longest Common Sequence. But note that I don't necessarily just want the longest - I want a list of all those long enough to be "interesting" (criterion yet to be decided).

    Read the article

  • Android - cant read TXT files from SDcard on real mashine?

    - by JustMe
    Hello! When I run the code bellow in the virtual android (1.5) it works well, TextSwitcher shows first 80 chars from each txt file from /sdcard/documents/ , but when I run it on my Samsung Galaxy i7500 (1.6) there are no contents in TextSwitcher, however in LogCat there are FileNames of txt files. My Code: public void getTxtFiles(){ //Scan /sdcard/documents and put .txt files in array File TxtFiles[] String path = Environment.getExternalStorageDirectory().toString()+"/documents/"; String files; File folder = new File(path); if(folder.exists()==false){if (!folder.mkdirs()) { Log.e("TAG", "Create dir in sdcard failed"); return; }} else{ File listOfFiles[] = folder.listFiles(); for (int i = 0; i < listOfFiles.length; i++) { if (listOfFiles[i].isFile()) { files = listOfFiles[i].getName(); if (files.endsWith(".txt") || files.endsWith(".TXT")) { if((files.length()-1)>i){resizeArray(TxtFiles, files.length()+10);} TxtFiles[i]=listOfFiles[i]; System.out.println(TxtFiles[i]); } } }} } private void updateCounter(int Pozicija) { if(Pozicija<0){Toast.makeText(getApplicationContext(), R.string.LastTxt, 5).show(); mCounter++;} else if(TxtFiles[mCounter]!=null){ TextToShow = getContents(TxtFiles[mCounter]); if(TextToShow.length()>80)TextToShow=TextToShow.substring(0, 80); mSwitcher.setText(TextToShow); System.out.println(Pozicija); } else mCounter--; } static public String getContents(File aFile) { //...checks on aFile are elided StringBuilder contents = new StringBuilder(); try { //use buffering, reading one line at a time //FileReader always assumes default encoding is OK! BufferedReader input = new BufferedReader(new FileReader(aFile)); try { String line = null; //not declared within while loop /* * readLine is a bit quirky : * it returns the content of a line MINUS the newline. * it returns null only for the END of the stream. * it returns an empty String if two newlines appear in a row. */ while (( line = input.readLine()) != null){ contents.append(line); contents.append(System.getProperty("line.separator")); } } finally { input.close(); } } catch (IOException ex){ ex.printStackTrace(); } return contents.toString(); } And I am able to write contents of those files though LogCat! Any ideas?

    Read the article

  • dynamically embedding youtube videos with jquery

    - by danwoods
    Hello all, I'm trying to retrieve a listing of a user's youtube videos and embed them in a page using jQuery. My code looks something like this: $(document).ready(function() { //some variables var fl_obj_template = $('<object width="260" height="140">' + '<param name="movie" value=""></param>' + '<param name="allowFullScreen" value="true"></param>' + '<param name="allowscriptaccess" value="always"></param>' + '<embed src="" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="260" height="140"></embed>' + '</object>'); var video_elm_arr = $('.video'); //hide videos until ready $('.video').addClass('hidden'); //pull video data from youtube $.ajax({ url: 'http://gdata.youtube.com/feeds/api/users/username/uploads?alt=json', dataType: 'jsonp', success: function(data) { $.each(data.feed.entry, function(i,item){ //only take the first 7 videos if(i > 6) return; //give the video element a flash object var cur_flash_obj = fl_obj_template; //assign title $(video_elm_arr[i]).find('.video_title').html(item.title.$t); //clean url var video_url = item.media$group.media$content[0].url; var index = video_url.indexOf("?"); if (index > 0) video_url = video_url.substring(0, index); //and asign it to the player's parameters $(cur_flash_obj).find('object param[name="movie"]').attr('value', video_url); $(cur_flash_obj).find('object embed').attr('src', video_url); //alert(cur_flash_obj); //insert flash object in video element $(video_elm_arr[i]).append(cur_flash_obj); //and show $(video_elm_arr[i]).removeClass('hidden'); }); } }); }); (of course with 'username' being the actual username). The video titles appear correctly but no videos show up. What gives? The target html looks like: <div id="top_row_center" class="video_center video"> <p class="video_title"></p> </div>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • A case-insensitive related implementation problem

    - by Robert
    Hi All, I am going through a final refinement posted by the client, which needs me to do a case-insesitive query. I will basically walk through how this simple program works. First of all, in my Java class, I did a fairly simple webpage parsing: title=(String)results.get("title"); doc = docBuilder.parse("http://" + server + ":" + port + "/exist/rest/db/wb/xql/media_lookup.xql?" + "&title=" + title); This Java statement references an XQuery file "media_lookup.xql" which is stored on localhost, and the only parameter we are passing is the string "title". Secondly, let's take at look at that XQuery file: $title := request:get-parameter('title',""), $mediaNodes := doc('/db/wb/portfolio/media_data.xml'), $query := $mediaNodes//media[contains(title,$title)], Then it will evaluate that query. This XQuery will get the "title" parameter that are passes from our Java class, and query the "media_data" xml file stored in the database, which contains a bunch of media nodes with a 'title' element node. As you may expect, this simple query will just match those media nodes whose 'title' element contains a substring of what the value of string 'title' is. So if our 'title' is "Chi", it will return media nodes whose title may be "Chicago" or "Chicken". The refinment request posted by the client is that there should be NO case-sensitivity. The very intuitive way is to modify the XQuery statement by using a lower-case funtion in it, like: $query := $mediaNodes//media[contains(lower-case(title/text(),lower-case($title))], However, the question comes: this modified query will run my machine into memory overflow. Since my "media_data.xml" is quite huge and contains thouands of millions of media nodes, I assume the lower-case() function will run on each of the entries, thus causing the machine to crash. I've talked with some experienced XQuery programmer, and they think I should use an index to solve this problem, and I will definitely research into that. But before that, I am just posting this problem here to get other ideas or any suggestions, do you think any other way may help? for example, could I tweak the Java parse statement to realize the case-insensitivity? Since I think I saw some people did some string concatination by using "contains." in Java before passing it to the server. Any idea or help is welcomed, thanks in advance.

    Read the article

  • Drupal incorrectly espaces tags in javascript

    - by sergdev
    I installed drupal-6.16. I applied the patch from the post http://drupal.org/node/222926#comment-930745. It works correctly in simple cases. But for following code for counter is handled incorrectly: <br><br> Text <br><br> <!-- counter.1Gb.ua --> <script language="javascript" type="text/javascript"> cgb_js="1.0"; cgb_r=""+Math.random()+"&r="+ escape(document.referrer)+"&pg="+ escape(window.location.href); document.cookie="rqbct=1; path=/"; cgb_r+="&c="+ (document.cookie?"Y":"N"); </script><script language="javascript1.1" type="text/javascript"> cgb_js="1.1";cgb_r+="&j="+ (navigator.javaEnabled()?"Y":"N")</script> <script language="javascript1.2" type="text/javascript"> cgb_js="1.2"; cgb_r+="&wh="+screen.width+ 'x'+screen.height+"&px="+ (((navigator.appName.substring(0,3)=="Mic"))? screen.colorDepth:screen.pixelDepth)</script> <script language="javascript1.3" type="text/javascript"> cgb_js="1.3"</script> <script language="javascript" type="text/javascript">cgb_r+="&js="+cgb_js; document.write("<a href='http://www.1Gb.ua?cnt=1416'>"+ "<img src='http://counter.1Gb.ua/cnt.aspx?"+ "u=1416&"+cgb_r+ "&' border=0 width=88 height=31 "+ "alt='1Gb.ua counter'><\/a>")</script> <noscript><a href='http://www.1Gb.ua?cnt=1416'> <img src="http://counter.1Gb.ua/cnt.aspx?u=1416" border=0 width="88" height="31" alt="1Gb.ua counter"></a> </noscript> <!-- /counter.1Gb.ua --> It modifies the string "alt='1Gb.ua counter' /><\/a>")</a></script> to "alt='1Gb.ua counter' />&lt;\/a>")</a></script> Does anybody have this code working? If so how this can be fixed? Thanks a lot in advance!

    Read the article

  • ASP.NET Repeater Control Not Working in FireFox

    - by Robert Hyland
    everyone: I have an ASP.NET Application that uses a Repeater control to display a thumbnail gallery. When the user mouses over one of the thumbnails, the main image will present that thumbnail. It uses a Repeater control in a UserControl like this: <asp:Image ID="pictureImage" runat="server" Visible="true" Width="200px" /> <asp:Repeater ID="rpProductImages" runat="server" Visible="false"> <ItemTemplate> <div> <div style="float: left" id="smallImage" runat="server"> <div class="smallAltImage" onmouseover="showImage();" style="border: 1px solid #999999; margin: 5px 5px 5px 4px; width: 45px; height: 45px; background-position: center; background-repeat: no-repeat; background-image: url('<%#ResolveClientUrl(productImagesPath)%><%# String.Format("{0}", DataBinder.Eval(Container.DataItem, "ImageName")) %>');"> </div> <asp:Label ID="lblImageName" runat="server" Visible="false"><%# Eval("ImageName")%></asp:Label> </div> </div> </ItemTemplate> </asp:Repeater> Then, in a javascript file, this: function showImage(){ // Get thumbnail path. var img = (this.style.backgroundImage).substring(4, (this.style.backgroundImage).length - 1); $('#ctl00_ContentPlaceHolder1_ProductDetails1_pictureImage').attr('src', img); } It works fine in IE9, displaying the fully-qualified path for the image. In FireFox8, however, the img src looks like this: ""ProductImages/K42JY_500.jpg"" ... with two-sets of quotes! I think that the Repeater control is the central cause of the problem but I Googled and Googled again and could not find anyone that has experienced this similar situation! In fact, I'll PayPal anyone who can help me solve this with $50.00 (can't you tell I'm in the XMAS spirit, here?!) Any help is appreciated and "Thank You" in advance!

    Read the article

  • Listfield layout question - blackberry

    - by Kai
    I'm having an interesting anomaly when displaying a listfield on the blackberry simulator: The top item is the height of a single line of text (about 12 pixels) while the rest are fine. Does anyone know why only the top item is being drawn this way? Also, when I add an empty venue in position 0, it still displays the first actual venue this way (item in position 1). Not sure what to do. Thanks for any help. The layout looks like this: ----------------------------------- | *part of image* | title | ----------------------------------- | | title | | * full image * | address | | | city, zip | ----------------------------------- The object is called like so: listField = new ListField( venueList.size() ); listField.setCallback( this ); listField.setSelectedIndex(-1); _middle.add( listField ); Here is the drawListRow code: public void drawListRow( ListField listField, Graphics graphics, int index, int y, int width ) { listField.setRowHeight(90); Hashtable item = (Hashtable) venueList.elementAt( index ); String venue_name = (String) item.get("name"); String image_url = (String) item.get("image_url"); String address = (String) item.get("address"); String city = (String) item.get("city"); String zip = (String) item.get("zip"); EncodedImage img = null; try { String filename = image_url.substring( image_url.indexOf("crop/") + 5, image_url.length() ); FileConnection fconn = (FileConnection) Connector.open( "file:///SDCard/Blackberry/project1/" + filename, Connector.READ); if ( !fconn.exists() ) { } else { InputStream input = fconn.openInputStream(); byte[] data = new byte[(int)fconn.fileSize()]; input.read(data); input.close(); if(data.length > 0) { EncodedImage rawimg = EncodedImage.createEncodedImage(data, 0, data.length); int dw = Fixed32.toFP(Display.getWidth()); int iw = Fixed32.toFP(rawimg.getWidth()); int sf = Fixed32.div(iw, dw); img = rawimg.scaleImage32(sf * 4, sf * 4); } else { } } } catch(IOException ef) { } graphics.drawText( venue_name, 140, y, 0, width ); graphics.drawText( address, 140, y + 15, 0, width ); graphics.drawText( city + ", " + zip, 140, y + 30, 0, width ); if(img != null) { graphics.drawImage(0, y, img.getWidth(), img.getHeight(), img, 0, 0, 0); } }

    Read the article

  • Google Maps API - Marker not showing

    - by popnbrown
    I'm trying to add markers for every single row from a table, that sits on the page. The page is http://www.sravanks.com/first/2013ftcmap.php This is the JS code that's loading the markers: $(document).ready(function() { var mapOptions = { center: new google.maps.LatLng(39.740, -89.503), zoom: 7 }; var map = new google.maps.Map(document.getElementById("map-canvas"), mapOptions); var infowindow = new google.maps.InfoWindow(); /* City Markers */ var cityCircle = new Array(); var i = 0; $.each($('.events tr'), function(index, value) { var name = $(this).find('td:first()').html(); var address = $(this).find('.address').html(); var linkUrl = "http://www.sravanks.com/first/geocode.php?address=" + address; $.ajax({ url: linkUrl }).done(function(data){ var json = $.parseJSON(data.substring(0, data.length-1)); lat = json.results[0].geometry.location.lat; lng = json.results[0].geometry.location.lng; var latlng = new google.maps.LatLng(lat, lng); var marker = new google.maps.Marker({ position: latlng, map: map, icon: 'map-pointer-medium.gif' }); google.maps.event.addListener(marker, 'click', function() { infowindow.setContent(name); infowindow.open(map, marker); cityCircle[i] = new google.maps.Circle({strokeColor: '#00FF00', strokeOpacity: 0.8, strokeWeight: 2, fillColor: '#00FF00', fillOpacity: 0.35, map: map, center: latlng, radius: 144841}); i++; }); }); }); /*Team Markers*/ var markers = {}; var teamName, teamNumber, lat, lng, content; $.each($('.list tr'), function(index, value) { teamName = $(this).find('td.name').html(); teamNumber = $(this).find('td.number').html(); markers[teamNumber] = {}; lat = parseFloat($(this).find('td.lat').html()); lng = parseFloat($(this).find('td.lng').html()); content = "Name: " + teamName + "<br />Number: " + teamNumber; markers[teamNumber]['latlng'] = new google.maps.LatLng(lat, lng); markers[teamNumber]['marker'] = new google.maps.Marker({ position: markers[teamNumber]['latlng'], map: map }); google.maps.event.addListener(markers[teamNumber]['marker'], 'click', function() { infowindow.setContent(content); infowindow.open(map, markers[teamNumber]['marker']); }); }); google.maps.event.addListener(infowindow, 'closeclick', function() { for(var i=0;i<cityCircle.length;i++){ cityCircle[i].setMap(null); } }); }); I've got no errors, but the Team Markers do not show up. The strange thing is that the City Markers do show up. Some more info, the City Markers ajax call is just to a proxy that calls the google geocoding api. Again the link's at http://www.sravanks.com/first/2013ftcmap.php

    Read the article

  • Using hidden values with jQuery (and ASP.NET MVC) -- not working?

    - by SlackerCoder
    Im using a couple of JSON calls to render data, etc etc. In order to keep the proper key value, I am storing it in a tag. I have this in several places in my code, none of which cause an issue like this one is. Here is the jQuery: The call that "sets" the value: $("a[id^='planSetupAddNewPlan']").live('click', function() { var x = $(this).attr('id'); x = x.substring(19); $("#hidPlanSetupCurrentGroupKey").val(x); $.getJSON("/GroupSetup/PlanSetupAddNewList", { GroupKey: x }, function(data) { $("#planSetupAddNew").html('' + data.TableResult + ''); alert('First Inside 2 ' + x); $.blockUI({ message: $("#planSetupAddNew") }); }); }); The call that "gets" the value: $("#ddlPlanSetupAddNewProduct").live('change', function() { var a = $("#hidPlanSetupCurrentGroupKey").val(); var prod = $(this).val(); alert(a); $.getJSON("/GroupSetup/PlanSetupChangePlanList", { GroupKey: a, Product: prod }, function(data) { if (data.Message == "Success") { $("#planSetupAddNewPlan").html('' + data.TableResult + ''); } else if (data.Message == "Error") { //Do something } }); }); Here is the html in question: <div id="planSetupAddNew" style="display:none; cursor: default;"> <input type="hidden" id="hidPlanSetupCurrentGroupKey" /> <div id="planSetupAddNewData"> </div> </div> In the first section, the alert ('First Inside 2 ' + x) returns what I expect (where x = the key value), and if I add a line to display the contents of the hidden field, that works as well: ie. var key = $("#hidPlanSetupCurrentGroupKey").val(); alert(key); In the "alert(a);" call, I am getting "undefined". I have looked at the other code in the same view and it is the same and it works. I must be missing something, or have some sort of mistype that I havent caught. Just an overview of the controller events: The first call (/GroupSetup/PlanSetupAddNewList) will return an html string building a "form" for users to enter information into. The second call (/GroupSetup/PlanSetupChangePlanList) just changes a second dropdown based on the first dropdown selection (overwriting the html in the div). If you need more info, let me know! Any thoughts/tips/pointers/suggestions?!?! Thanks for all your help :)

    Read the article

< Previous Page | 32 33 34 35 36 37 38 39 40  | Next Page >