Search Results

Search found 25180 results on 1008 pages for 'post processing'.

Page 365/1008 | < Previous Page | 361 362 363 364 365 366 367 368 369 370 371 372  | Next Page >

  • HTTP Error: 400 when sending msmq message over http

    - by dontera
    I am developing a solution which will utilize msmq to transmit data between two machines. Due to the seperation of said machines, we need to use HTTP transport for the messages. In my test environment I am using a Windows 7 x64 development machine, which is attempting to send messages using a homebrew app to any of several test machines I have control over. All machines are either windows server 2003 or server 2008 with msmq and msmq http support installed. For any test destination, I can use the following queue path name with success: FORMATNAME:DIRECT=TCP:[machine_name_or_ip]\private$\test_queue But for any test destination, the following always fails FORMATNAME:DIRECT=HTTP://[machine_name_or_ip]/msmq/private$/test_queue I have used all permutations of machine names/ips available. I have created mappings using the method described at this blog post. All result in the same HTTP Error: 400. The following is the code used to send messages: MessageQueue mq = new MessageQueue(queuepath); System.Messaging.Message msg = new System.Messaging.Message { Priority = MessagePriority.Normal, Formatter = new XmlMessageFormatter(), Label = "test" }; msg.Body = txtMessageBody.Text; msg.UseDeadLetterQueue = true; msg.UseJournalQueue = true; msg.AcknowledgeType = AcknowledgeTypes.FullReachQueue | AcknowledgeTypes.FullReceive; msg.AdministrationQueue = new MessageQueue(@".\private$\Ack"); if (SendTransactional) mq.Send(msg, MessageQueueTransactionType.Single); else mq.Send(msg); Additional Information: in the IIS logs on the destination machines I can see each message I send being recorded as a POST with a status code of 200. I am open to any suggestions.

    Read the article

  • Ajax.BeginForm driving me crazy

    - by Fabio Milheiro
    ASP.NET MVC3 I have a partial view that is initially rendered inside a div. The following is the partial code: @model Venue.Models.Validation.CustomerRequestModel <script src="@Url.Content("~/Scripts/jquery-1.4.4.min.js")" type="text/javascript"></script> <script src="@Url.Content("~/Scripts/jquery.validate.min.js")" type="text/javascript"></script> <script src="@Url.Content("~/Scripts/jquery.validate.unobtrusive.min.js")" type="text/javascript"></script> <script type="text/javascript" src="/Scripts/MicrosoftAjax.js"></script> <script type="text/javascript" src="/Scripts/MicrosoftMvcAjax.js"></script> <script type="text/javascript" src="/Scripts/MicrosoftMvcValidation.js"></script> @{ Html.RenderPartial("Message"); } @Html.ValidationSummary() @using (Ajax.BeginForm( "Customer", "Service", null, new AjaxOptions() { HttpMethod = "post", InsertionMode = InsertionMode.Replace, LoadingElementDuration = 100, LoadingElementId = "loading-customer", OnBegin = "hideSubmitButton", OnSuccess = "hideForm", OnComplete = "showSubmitButton", OnFailure = "showErrorMessage", UpdateTargetId = "formclientes", }, new { id = "customer-form" })) { // Fields are all type="text" although some are numbers. <input type="text" name="Address" class="clientes_form" /> } The action: [AcceptVerbs(HttpVerbs.Post)] public ActionResult Customer(CustomerRequestModel customer) { // ... } In the immediate window, this is what I get: this.Request.IsAjaxRequest() false Why?!

    Read the article

  • Explanation of WCF application life cycle in IIS 6 hosting environment.

    - by David Christiansen
    Hi all and thanks for reading, I have a delay issue where my application takes a long time to start up when first called after an determinate period since the last call. The web application is a WCF service and we are talking about a delay of ~18seconds before the actual processing starts. Now, I believe I know how to reduce this delay so that is not my question (it's more a stackoverflow deal anyway) My question is, Can anyone explain to me why is it that despite me disabling worker process shutdown, and worker process recycling the application still 'winds down' after a indeterminate period of time of inactivity? To understand this I need to know more about the innerworkings of WCF services hosted in IIS. I fully expect there to be a straight forward answer to this. Thank you v. much for any help you may offer, DC

    Read the article

  • Rails RJS template displays code instead of the html page

    - by Anand
    After having Googled and hurting my brain for hours on this, I finally decided to post this question. Here's the code... view1.html.erb -------------- <%=link_to_remote_redbox "Link", :url => {:action => :action1, :id => @some.id} some_controller.rb ------------------ def action1 render :layout => false end def action2 do some processing end action1.html.erb -------------------- <form onsubmit="new Ajax.Request('/some_controller/action2', {asynchronous:true, evalScripts:true, onComplete:function(request){RedBox.close(); return false;}, parameters:Form.serialize(this)}); return false;}" method="post" action="/some_controller/action2"> <input type=text name='username'> <input type='submit' value='submit'> </form> action2.rjs ----------- page.replace_html("some_div", (render(:partial => "some_partial"))) with that code in place when action2.rjs kicks in it should display the html page instead I am getting this Element.update("some_div", "<style type=\"text/css\">\n\n.............. As suggested on other posts I read, they say its caused because of the ":update = some_div" in the link_to_remote_redbox function but clearly my code doesn't have that. Help is always appreciated. Many Thanks

    Read the article

  • JsonParseException on Valid JSON

    - by user2909602
    I am having an issue calling a RESTful service from my client code. I have written the RESTful service using CXF/Jackson, deployed to localhost, and tested using RESTClient successfully. Below is a snippet of the service code: @POST @Produces("application/json") @Consumes("application/json") @Path("/set/mood") public Response setMood(MoodMeter mm) { this.getMmDAO().insert(mm); return Response.ok().entity(mm).build(); } The model class and dao work successfully and the service itself works fine using RESTClient. However, when I attempt to call this service from Java Script, I get the error below on the server side: Caused by: org.codehaus.jackson.JsonParseException: Unexpected character ('m' (code 109)): expected a valid value (number, String, array, object, 'true', 'false' or 'null') I have copied the client side code below. To make sure it has nothing to do with the JSON data itself, I used a valid JSON string (which works using RESTClient, JSON.parse() method, and JSONLint) in the vars 'json' (string) and 'jsonData' (JSON). Below is the Java Script code: var json = '{"mood_value":8,"mood_comments":"new comments","user_id":5,"point":{"latitude":37.292929,"longitude":38.0323323},"created_dtm":1381546869260}'; var jsonData = JSON.parse(json); $.ajax({ url: 'http://localhost:8080/moodmeter/app/service/set/mood', dataType: 'json', data: jsonData, type: "POST", contentType: "application/json" }); I've seen the JsonParseException a number of times on other threads, but in this case the JSON itself appears to be valid (and tested). Any thoughts are appreciated.

    Read the article

  • Securely wiping a file on a tmpfs

    - by Nanzikambe
    I have a script that decrypts some data to a tmpfs, the directory is secure (permissions), the machine's swap is encrypted (random key on boot) and when the script is done it does a 35 pass wipe (Peter Gutmann) of the cleartext on the tmpfs . I do this because I'm aware wiping files on a journaling file system is insecure, data may be recovered. For discussion, here're the relevant bits extracted: # make the tmpfs mkdir /mnt/tmpfs chmod 0700 /mnt/tmpfs mount -t tmpfs -o size=1M tmpfs /mnt/tmpfs cd /mnt/tmpfs # decrypt the data gpg -o - <crypted_input_file> | \ tar -xjpf - # do processing stuff # wipe contents find . -type f -exec bcwipe -I {} ';' # nuke the tmpfs cd .. umount -f /mnt/tmpfs rm -fR /mnt/tmpfs So, my question, assuming for the moment that nobody is able to read the cleartext in the tmpfs while it exists (I use umask to set cleartext to 0600), is there any way any trace of the cleartext could remain either in memory or on disk after the snippet above completes?

    Read the article

  • Optimized Publish/Subcribe JMS Broker Cluster and Conflicting Posts on StackOverFlow for the Answer

    - by Gene
    Hi, I am looking to build a publish/subscribe distributed messaging framework that can manage huge volumes of message traffic with some intelligence at the broker level. I don't know if there's a topology that describes this, but this is the model I'm going after: EXAMPLE MODEL A A) There are two running message brokers (ideally all on localhost if possible, for easier demo-ing) : Broker-A Broker-B B) Each broker will have 2 listeners and 1 publisher. Example Figure [subscriber A1, subscriber A2, publisher A1] <-- BrokerA <-- BrokerB <-- [publisher B1, subscriber B1, subscriber B2] IF a message-X is published to broker A and there no subscribers for it among the listeners on Broker-B (via criteria in Message Selectors or Broker routing rules), then that message-X will never be published to Broker-B. ELSE, broker A will publish the message to broker B, where one of the broker B listeners/subscribers/services is expecting that message based on the subscription criteria. Is Clustering the Correct Approach? At first, I concluded that the "Broker Clustering" concept is what I needed to support this. However, as I have come to understand it, the typical use of clustering entails either: message redundancy across all brokers ... or Competing Consumers pattern ... and neither of these satisfy the requirement in the EXAMPLE MODEL A. What is the Correct Approach? My question is, does anyone know of a JMS implementation that supports the model I described? I scanned through all the stackoverflow post titles for the search: JMS and Cluster. I found these two informative, but seemingly conflicting posts: Says the EXAMPLE MODEL A is/should-be implicitly supported: http://stackoverflow.com/questions/2255816/jms-consumer-with-activemq-network-of-brokers " this means you pick a broker, connect to it, and let the broker network sort it out amongst themselves. In theory." Says the EXAMPLE MODEL A IS NOT suported: http://stackoverflow.com/questions/2017520/how-does-a-jms-topic-subscriber-in-a-clustered-application-server-recieve-message "All the instances of PropertiesSubscriber running on different app servers WILL get that message." Any suggestions would be greatly appreciated. Thanks very much for reading my post, Gene

    Read the article

  • Database OR Array

    - by rezoner
    What is the exact point of using external database system if I have simple relations (95% querries are dependant on ID). I am storing users and their stats. Why would I use external database if I can have neat constructions like: db.users[32] = something Array of 500K users is not that big effort for RAM Pros are: no problematic asynchronity (instant results) easy export/import dealing with database like with a native object LITERALLY ps. and considerations: Would it be faster or slower to do collection[3] than db.query("select ... I am going to store it as a file/s There is only ONE application/process accessing this data, and the code is executed line by line - please don't elaborate about locking. Please don't answer with database propositions but why to use external DB over native array/object - I have experience in a few databases - that's not the case. What I am building is a client/gateway/server(s) game. Gateway deals with all users data, processing, authenticating, writing statistics e.t.c No other part of software needs to access directly to this data/database.

    Read the article

  • Render a Form from an XSLT file

    - by Russ Clark
    I've generated the following XSLT file, and have created a Form that will post to an ASP.Net MVC action called Home/ProcessRequest: <?xml version="1.0" encoding="utf-8"?> <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:msxsl="urn:schemas-microsoft-com:xslt" exclude-result-prefixes="msxsl" > <xsl:output method="html" indent="yes"/> <xsl:template match="/"> <html> <body> <xsl:value-of select="Employee/Name"/> <br /> <xsl:value-of select="Employee/ID"/> <form method="post" action="/Home/ProcessRequest?id=42"> <input id="Action" name="Action" type="radio" value="Approved"></input> Approved <br /> <input id="Action" name="Action" type="radio" value="Rejected"></input> Rejected <br /> <input type="submit" value="Submit"></input> </form> </body> </html> Here is my XML File: <Employee xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:xsd="http://www.w3.org/2001/XMLSchema"> <Name>Russ</Name> <ID>42</ID> </Employee> This works fine the way it is, but I need to change the id parameter in my from from a hard coded integer, to use the ID element from my XML file. Does anyone know how to do this?

    Read the article

  • Problem retrieving values from Zend_Form_SubForms - no values returned

    - by anu iyer
    I have a Zend_Form that has 4 or more subforms. /** Code Snippet **/ $bigForm = new Zend_Form(); $littleForm1 = new Form_LittleForm1(); $littleForm1->setMethod('post'); $littleForm2 = new Form_LittleForm2(); $littleForm2->setMethod('post'); $bigForm->addSubForm($littleForm1,'littleForm1',0); $bigForm->addSubForm($littleForm2,'littleForm2',0); On clicking the 'submit' button, I'm trying to print out the values entered into the forms, like so: /** Code snippet, currently not validating, just printing **/ if($this-_request-getPost()){ $formData = array(); foreach($bigForm->getSubForms() as $subForm){ $formData = array_merge($formData, $subForm->getValues()); } /* Testing */ echo "<pre>"; print_r($formData); echo "</pre>"; } The end result is that - all the elements in the form do get printed, but the values entered before posting the form don't get printed. Any thoughts are appreciated...I have run around circles working on this! Thanks in advance!

    Read the article

  • Django QuerySet API: How do I join iexact and icontains?

    - by Zeynel
    Hello, I have this join: lawyers = Lawyer.objects.filter(last__iexact=last_name).filter(first__icontains=first_name) This is the site If you try Last Name: Abbas and First Name: Amr it tells you that amr abbas has 1 schoolmates. But if you try First name only it says that there are no lawyers in the database called amr (obviously there is). If I change (last__iexact=last_name) to (last__icontains=last_name) then leaving Last Name blank works fine and amr is found. But with last__icontains=last_name if you search for "collin" you also get "collins" and "collingwood" which is not what I want. Do you know how I can use iexact and also have it ignored if it is blank? Thanks This is the view function: def search_form(request): if request.method == 'POST': search_form = SearchForm(request.POST) if search_form.is_valid(): last_name = search_form.cleaned_data['last_name'] first_name = search_form.cleaned_data['first_name'] lawyers = Lawyer.objects.filter(last__iexact=last_name).filter(first__icontains=first_name) if len(lawyers)==0: form = SearchForm() return render_to_response('not_in_database.html', {'last': last_name, 'first': first_name, 'form': form}) if len(lawyers)>1: form = SearchForm(initial={'last_name': last_name}) return render_to_response('more_than_1_match.html', {'lawyers': lawyers, 'last': last_name, 'first': first_name, 'form': form}) q_school = Lawyer.objects.filter(last__icontains=last_name).filter(first__icontains=first_name).values_list('school', flat=True) q_year = Lawyer.objects.filter(last__icontains=last_name).filter(first__icontains=first_name).values_list('year_graduated', flat=True) lawyers1 = Lawyer.objects.filter(school__iexact=q_school[0]).filter(year_graduated__icontains=q_year[0]).exclude(last__icontains=last_name) form = SearchForm() return render_to_response('search_results.html', {'lawyers': lawyers1, 'last': last_name, 'first': first_name, 'form': form}) else: form = SearchForm() return render_to_response('search_form.html', {'form': form, })

    Read the article

  • x-dom-event-stream in Opera 10 Only Working on First Event

    - by Brad
    I have a python script (in the CherryPy framework) that sends Event: and data: text as this Opera blog post describes to a client browser. The javascript that recieves the x-dom-event-stream content is almost identical to what they show in the blog post. However, the browser displays only the first event sent. Anyone know what I'm missing? I tried a few older versions of Opera and found that it works in Opera 9.52 but not in any newer versions. What did they change? Here is the python code: class dumpData(object): def index(self): cherrypy.response.headers['Content-Type'] = "application/x-dom-event-stream" def yieldData(): i = 0 while 1: yield "Event: count\n" yield "data: " yield i yield "\n\n" i = i + 1 time.sleep(3); return yieldData() index._cp_config = {'response.stream': True} index.exposed = True And here is the javascript/html. Making a request to /data/ runs the python function above. <head> <script> onload = function() { document.getElementById("count").addEventListener("cout", cout, false); } function count(e) { document.getElementById("stream").firstChild.nodeValue = e.data; } </script> <event-source id="count" src="/data/"> </head> <body> <div id="stream"></div> </body> Opening the direct /data/ url in Firefox saves the stream to a file. So I know the output is in the correct format and that the stream works at all.

    Read the article

  • Non RBAC User Roles and Permissions System: checking the user's City

    - by micha12
    We are currently designing a User Roles and Permissions System in our web application (ASP.NET), and it seems that we have several cases that do no fit within the classical Role-Based Access Control (RBAC). I will post several questions, each devoted to a particular case, this being the first post. We have the following case: not to allow a user view a certain page if the user lives in a particular city. This is a simple case that is coded in the following way: if (User.City == “Moscow”) // Allow the user to view the page. else // Do not allow the user to view this page. Though this case is very simple and straightforward, it has nothing to do with the RBAC. On StackOverflow, someone called this an Attribute-based Access Control. Under the classical RBAC, it seems that this case should be designed like this: introduce a permission “City where the person lives”, this permission will have a property City. Then create a role, add a permission of type “City = Moscow” to it and the assign the role to the user. Looks extremely cumbersome. The question is whether it is acceptable to introduce such non-RBAC approaches to our permissions system – does that break the design or not? This might seem a primitive question, but we found that most applications use pure RBAC, and we started to think that we might be doing something wrong. Thank you.

    Read the article

  • Unable to call RESTful web services methods

    - by Alessandro
    Hello, I'm trying to dive into the RESTful web services world and have started with the following template: [ServiceContract] [AspNetCompatibilityRequirements(RequirementsMode = AspNetCompatibilityRequirementsMode.Allowed)] [ServiceBehavior(InstanceContextMode = InstanceContextMode.PerCall)] public class Test { // TODO: Implement the collection resource that will contain the SampleItem instances [WebGet(UriTemplate = ""), OperationContract] public List<SampleItem> GetCollection() { // TODO: Replace the current implementation to return a collection of SampleItem instances return new List<SampleItem>() {new SampleItem() {Id = 1, StringValue = "Hello"}}; } [WebInvoke(UriTemplate = "", Method = "POST"), OperationContract] public SampleItem Create(SampleItem instance) { // TODO: Add the new instance of SampleItem to the collection throw new NotImplementedException(); } [WebGet(UriTemplate = "{id}"), OperationContract] public SampleItem Get(string id) { // TODO: Return the instance of SampleItem with the given id throw new NotImplementedException(); } [WebInvoke(UriTemplate = "{id}", Method = "PUT"), OperationContract] public SampleItem Update(string id, SampleItem instance) { return new SampleItem { Id = 99, StringValue = "Done" }; } [WebInvoke(UriTemplate = "{id}", Method = "DELETE"), OperationContract] public void Delete(string id) { // TODO: Remove the instance of SampleItem with the given id from the collection throw new NotImplementedException(); } } I am able to perform the GET operation but I am unable to perform PUT, POST or DELETE requests. Can anyone explain me how to perform these operations and how to create the correct URLs? Best regards Alessandro

    Read the article

  • Why does VIM say there is trailing whitespace on this command?

    - by Jesse Atkinson
    I am trying to write a beautify CSS command in vim that sorts and alphabetizes all of the CSS properties as well as checks to see if there is not a space after the colon and inserts one. Here is my code: nnoremap <leader>S :g#\({\n\)\@<=#.,/}/sort | %s/:\(\S\)/: \1/g<CR> :command! SortCSSBraceContents :g#\({\n\)\@<=#.,/}/sort | %s/:\(\S\)/: \1/g These work independently. However, I am trying to pipe them into one command. On save VIM says: Error detected while processing /var/home/jesse-atkinson/.vimrc: line 196: E488: Trailing characters Any ideas?

    Read the article

  • How do I debug a HTTP 502 error?

    - by Bialecki
    I have a Python Tornado server sitting behind a nginx frontend. Every now and then, but not every time, I get a 502 error. I look in the nginx access log and I see this: 127.0.0.1 - - [02/Jun/2010:18:04:02 -0400] "POST /a/question/updates HTTP/1.1" 502 173 "http://localhost/tagged/python" "Mozilla/5.0 (X11; U; Linux i686; en-US; rv:1.9.2.3) Gecko/20100401 Firefox/3.6.3" and in the error log: 2010/06/02 18:04:02 [error] 14033#0: *1700 connect() failed (111: Connection refused) while connecting to upstream, client: 127.0.0.1, server: _, request: "POST /a/question/updates HTTP/1.1", upstream: "http://127.0.0.1:8888/a/question/updates", host: "localhost", referrer: "http://localhost/tagged/python" I don't think any errors show up in the Tornado log. How would you go about debugging this? Is there something I can put in the Tornado or nginx configuration to help debug this? EDIT: In addition, I get a fair number of 504, gateway timeout errors. Is it possible that the Tornado instance is just busy or something?

    Read the article

  • form with multiple upload but allow no upload on edit problems

    - by minus4
    hiya i have a section that when created takes in images, however when you edit this item i dont want them to re-upload none changes images just to change a description or name. i have created this that deals with uploading files: public void UploadFiles(string currentFileName, FormCollection form) { // loop through all files in form post foreach (string file in Request.Files) { HttpPostedFileBase hpf = Request.Files[file]; // if no file is uploaded, we could be editing so set to current value if (hpf.ContentLength == 0) { form[file] = currentFileName; } else { //rename the file unique so we dont clash with names var filename = hpf.FileName.Replace(" ", "_").Replace(".", DateTime.Now.Date.Ticks + "."); UploadFileName = filename; hpf.SaveAs(Server.MapPath("~/Content/custom/" + filename)); // set the name of the file in our post to the new name form[file] = UploadFileName; } } // ensure value is still sent when no files are uploaded on edit if(Request.Files.Count <= 0) { UploadFileName = currentFileName; } } all works fine when only one image is required (CurrentFileName), however there is now a new image available taking it to a total of 2 images in the database therefor currentFileName is obsolete. has anyone tackled this and how as i have hit a wall with this one. thought of string[] currentFiles but cant see how to match this into string file in Request.Files. if it helps i am also working with models for the form so i could pass over the model but i dont think your able to do model.file without some kind of reflection. help much appreciated. thanks

    Read the article

  • Why won't .attr('checked','checked') set?

    - by Jason
    I have the following snippet of code (I'm using jQuery 1.4.2): $.post('/Ads/GetAdStatsRow/', { 'ad_id': id }, function(result) { $('#edit_ads_form tbody').prepend(result); $(result).find('td.select-ad input').attr('checked','checked').click(); }); Assume that the post works correctly and returns a correct pre-built <tr> with some <td>s. Here's the weirdness: the $(result).find() line finds the correct input (which is a checkbox, as it's the only input in the cell) and runs the chained click() function correctly, but it REFUSES to set the box as checked, which I need to happen. Here's a crazy twist, too... when I get super specific and change the $(result).find() line to this (the id of the checkbox): $('#ad_' + id).click(); It checks the box, but doesn't run the click() function! If I set it to $('#ad_' + id).attr('checked','checked').click(); it runs the click function as though the box were checked, but the box remains unchecked, and if I do $('#ad_' + id).click().attr('checked','checked'); it does nothing at all. What in the world could be the matter with this? I'm running out of hair.... Thanks!

    Read the article

  • Possible bug in ASP.net UpdatePanel control?

    - by Ben Robinson
    I have come across what seems to be an annoying bug with asp.net UpdatePanels in 2 seperate projects. If you have some kind of autopostback enabled control that can cause all of the controls in the update panel to have visible=false set, resulting in an empty update panel. When you change the autopostback control back to the postion that would re enable all of the controls in the update panel, it simply does not make a call back to the server and the update panel does not update. If you do anything else that makes a call back on the same page, then the update panel contents magically appear. It is as if asp.net has decided the update panel is empty so there is no point maikng a callback, even though making the call back would fill the updatepanel with content. The only way round this is to add a style of display:none to the controls instead of setting visible=false property. Then it works fine. Has anyone else encountered this problem? Is it a bug as i suspect or is it likely i am doing soemthing wrong? I haven't got time to post example code at the moment as the code i am using is too wrapped up in other unrealted things, if people think it would help i will create a simple example and post it when I get time.

    Read the article

  • Using embedded standard HTML forms with ASP.NET

    - by RM
    I have a standard aspx page with which I need to add another standard HTML form into and have it submit to another location (external site), however whenever I press the submit button the page seems to do a post back rather than using the sub-forms action url. A mock up of what the form relationships is below. Note in the real deployment the form will be part of a content area of a master page layout, so the form needs to submit independantly from the master page form. <html xmlns="http://www.w3.org/1999/xhtml" > <head runat="server"> <title>Untitled Page</title> </head> <body> <form id="form1" runat="server"> <div> <form id="subscribe_form" method="post" action="https://someothersite.com" name="em_subscribe_form" > <input type="text" id="field1" name="field1" /> <input id="submitsubform" type="submit" value="Submit" /> </form> </div> </form> </body> </html>

    Read the article

  • Website (jQuery) consistently crashes Internet Explorer (REALLY STUCK!)

    - by Bradley Bell
    Hey Guys. I posted this question yesterday, but haven't had a response. Basically, I'm totally stuck and clueless over crashing in Internet Explorer. The website now works fine in all browsers except internet explorer. The website is heavily reliant on jQuery and as far as I'm aware, I cant spot anything wrong with the script. Internet Explorer displays no errors and I don't know what I can possibly change. It displays fine, which would suggest that its nothing up with the CSS or HTML? I'm fairly sure it has to be the script, because it only crashes when you hover over one of the mouseover links. I'm already over the deadline and time is ticking! Its driving me crazy. I've uploaded it onto a test directory here: www.openyourheart.org.uk/test/index.html (I'll add the script/css links below as a comment, It wont let me post more than one here!) I would reaaly, really appreciate any help on this. I can also send the website compressed and post scripts here if required/preferred. Thanks in advance, Bradley

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Remove SID with ICACLS

    - by chris
    I am trying to remove an obsolete SID (the account was apparently deleted). I've tried to run the following on the server (win2003) and a client (win7): icacls c:\path /remove *S-1-5-21-1883347182-1220252494-433279356-1095 /T But I always get the output Successfully processed 0 files; Failed processing 0 files without it doing anything. How can I get it to work? Update: I've used AccessEnum to get the SID because icacls only says "No mapping between account names and security IDs was done." but doesn't show the sid. The output from AccessEnum is: "Path" "Read" "Write" "Deny" "c:\path" "Administrators, S-1-5-21-1883347182-1220252494-433279356-1095, ..." "Administrators, S-1-5-21-1883347182-1220252494-433279356-1095, ..." ""

    Read the article

  • jQuery - Not sure which method to use, closest() and parent() don't work.

    - by Nike
    Hello, again. :) God i feel like i'm spamming stackoverflow, this is my 3rd post for today. Sorry, heh. I even posted a question regarding this before, kind of, but i've changed the code a bit since so i thought it was better to post a new question. $('.pmlist ul li h4 .toggle').click(function() { $(this).closest('.meddel').toggle(250); }); That's what i've got now. The reason why the closest() method isn't working is because the div .meddel is just next to the h4 element. And closest() only crawls right up the DOM tree, ignoring other child elements. Right? parent() works almost the same and doesn't work either. And as i only want to toggle the closest .meddel div in the element, i need something that, yeah justs grabs the nearest one, and not all of them. To clear it up a bit, here's the HTML for one list item: <li class="item"> <h4><a class="toggle">ämne</a><small>2010-04-17 kl 12:54 by <u>nike1</u></small></h4> <div class="meddel"> <span> <img style="max-width: 70%; min-height: 70%;" src="profile-images/nike1.jpg" alt="" /> <a href="account.php?usr=47">nike1</a> </span> <p>text</p> </div> </li> I have several items like that, and if i click one toggle link, i just want the nearest .meddel to be toggled, as mentioned before. Thanks. -Nike

    Read the article

  • ASP.net AppendHeader not working in ASP MVC

    - by Chao
    I'm having problems getting AppendHeader to work properly if I am also using an authorize filter. I'm using an actionfilter for my AJAX actions that applies Expires, Last-Modified, Cache-Control and Pragma (though while testing I have tried including it in the action method itself with no change in results). If I don't have an authorize filter the headers work fine. Once I add the filter the headers I tried to add get stripped. The headers I want to add Response.AppendHeader("Expires", "Sun, 19 Nov 1978 05:00:00 GMT"); Response.AppendHeader("Last-Modified", String.Format("{0:r}", DateTime.Now)); Response.AppendHeader("Cache-Control", "no-store, no-cache, must-revalidate"); Response.AppendHeader("Cache-Control", "post-check=0, pre-check=0"); Response.AppendHeader("Pragma", "no-cache"); An example of the headers from a correct page: Server ASP.NET Development Server/9.0.0.0 Date Mon, 14 Jun 2010 17:22:24 GMT X-AspNet-Version 2.0.50727 X-AspNetMvc-Version 2.0 Pragma no-cache Expires Sun, 19 Nov 1978 05:00:00 GMT Last-Modified Mon, 14 Jun 2010 18:22:24 GMT Cache-Control no-store, no-cache, must-revalidate, post-check=0, pre-check=0 Content-Type text/html; charset=utf-8 Content-Length 352 Connection Close And from an incorrect page: Server ASP.NET Development Server/9.0.0.0 Date Mon, 14 Jun 2010 17:27:34 GMT X-AspNet-Version 2.0.50727 X-AspNetMvc-Version 2.0 Pragma no-cache, no-cache Cache-Control private, s-maxage=0 Content-Type text/html; charset=utf-8 Content-Length 4937 Connection Close

    Read the article

< Previous Page | 361 362 363 364 365 366 367 368 369 370 371 372  | Next Page >