Search Results

Search found 13534 results on 542 pages for 'python 2 6'.

Page 371/542 | < Previous Page | 367 368 369 370 371 372 373 374 375 376 377 378  | Next Page >

  • django on appengine

    - by aks
    I am impressed with django.Am am currenty a java developer.I want to make some cool websites for myself but i want to host it in some third pary environmet. Now the question is can i host the django application on appengine?If yes , how?? Are there any site built using django which are already hosted on appengine?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Encoding with url and api

    - by user2950824
    So I have this web app set up and running and it works fine for any username that you request, but when i try http://mrcastelo.pythonanywhere.com/lol/euw/Nazaré, it simply doesnt work - the error that I get on the server is the following: iddata= getJSON(urllolbase+region+urlid+username) #SummonerID UnicodeDecodeError: 'ascii' codec can't decode byte 0xc3 in position 5: ordinal not in range(128) It is annoying me greatly, I've tried some other threads but none of them came to a fix. The api that I am using (www.legendaryapi.com) does accept this because this works. Any idea on how to fix this?

    Read the article

  • Is there a way to control how pytest-xdist runs tests in parallel?

    - by superselector
    I have the following directory layout: runner.py lib/ tests/ testsuite1/ testsuite1.py testsuite2/ testsuite2.py testsuite3/ testsuite3.py testsuite4/ testsuite4.py The format of testsuite*.py modules is as follows: import pytest class testsomething: def setup_class(self): ''' do some setup ''' # Do some setup stuff here def teardown_class(self): '''' do some teardown''' # Do some teardown stuff here def test1(self): # Do some test1 related stuff def test2(self): # Do some test2 related stuff .... .... .... def test40(self): # Do some test40 related stuff if __name__=='__main()__' pytest.main(args=[os.path.abspath(__file__)]) The problem I have is that I would like to execute the 'testsuites' in parallel i.e. I want testsuite1, testsuite2, testsuite3 and testsuite4 to start execution in parallel but individual tests within the testsuites need to be executed serially. When I use the 'xdist' plugin from py.test and kick off the tests using 'py.test -n 4', py.test is gathering all the tests and randomly load balancing the tests among 4 workers. This leads to the 'setup_class' method to be executed every time of each test within a 'testsuitex.py' module (which defeats my purpose. I want setup_class to be executed only once per class and tests executed serially there after). Essentially what I want the execution to look like is: worker1: executes all tests in testsuite1.py serially worker2: executes all tests in testsuite2.py serially worker3: executes all tests in testsuite3.py serially worker4: executes all tests in testsuite4.py serially while worker1, worker2, worker3 and worker4 are all executed in parallel. Is there a way to achieve this in 'pytest-xidst' framework? The only option that I can think of is to kick off different processes to execute each test suite individually within runner.py: def test_execute_func(testsuite_path): subprocess.process('py.test %s' % testsuite_path) if __name__=='__main__': #Gather all the testsuite names for each testsuite: multiprocessing.Process(test_execute_func,(testsuite_path,))

    Read the article

  • Matplotlib autodatelocator custom date formatting?

    - by jawonlee
    I'm using Matplotlib to dynamically generate .png charts from a database. The user may set as the x-axis any given range of datetimes, and I need to account for all of it. While Matplotlib has the dates.AutoDateLocator(), I want the datetime format printed on the chart to be context-specific - e.g. if the user is charting from 3 p.m. to 5 p.m., the year/month/day information doesn't need to be displayed. Right now, I'm manually creating Locator and Formatter objects thusly: def get_ticks(start, end): from datetime import timedelta as td delta = end - start if delta <= td(minutes=10): loc = mdates.MinuteLocator() fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(minutes=30): loc = mdates.MinuteLocator(byminute=range(0,60,5)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(hours=1): loc = mdates.MinuteLocator(byminute=range(0,60,15)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(hours=6): loc = mdates.HourLocator() fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(days=1): loc = mdates.HourLocator(byhour=range(0,24,3)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(days=3): loc = mdates.HourLocator(byhour=range(0,24,6)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(weeks=2): loc = mdates.DayLocator() fmt = mdates.DateFormatter('%b %d') elif delta <= td(weeks=12): loc = mdates.WeekdayLocator() fmt = mdates.DateFormatter('%b %d') elif delta <= td(weeks=52): loc = mdates.MonthLocator() fmt = mdates.DateFormatter('%b') else: loc = mdates.MonthLocator(interval=3) fmt = mdates.DateFormatter('%b %Y') return loc,fmt Is there a better way of doing this?

    Read the article

  • How to generate lots of redundant ajax elements like checkboxes and pulldowns in Django?

    - by iJames
    Hello folks. I've been getting lots of answers from stackoverflow now that I'm in Django just be searching. Now I hope my question will also create some value for everybody. In choosing Django, I was hoping there was some similar mechanism to the way you can do partials in ROR. This was going to help me in two ways. One was in generating repeating indexed forms or form elements, and also in rendering only a piece of the page on the round trip. I've done a little bit of that by using taconite with a simple URL click but now I'm trying to get more advanced. This will focus on the form issue which boils down to how to iterate over a secondary object. If I have a list of photo instances, each of which has a couple of parameters, let's say a size and a quantity. I want to generate form elements for each photo instance separately. But then I have two lists I want to iterate on at the same time. Context: photos : Photo.objects.all() and forms = {} for photo in photos: forms[photo.id] = PhotoForm() In other words we've got a list of photo objects and a dict of forms based on the photo.id. Here's an abstraction of the template: {% for photo in photos %} {% include "photoview.html" %} {% comment %} So here I want to use the photo.id as an index to get the correct form. So that each photo has its own form. I would want to have a different action and each form field would be unique. Is that possible? How can I iterate on that? Thanks! {% endcomment %} Quantity: {{ oi.quantity }} {{ form.quantity }} Dimensions: {{ oi.size }} {{ form.size }} {% endfor %} What can I do about this simple case. And how can I make it where every control is automatically updating the server instead of using a form at all? Thanks! James

    Read the article

  • Django: Is there any way to have "unique for date range"?

    - by tomwolber
    If my model for Items is: class Item(models.Model): name = models.CharField(max_length=500) startDate = models.DateField("Start Date", unique="true") endDate = models.DateField("End Date") Each Item needs to have a unique date range. for example, if i create an Item that has a date range of June 1st to June 8th, how can I keep and Item with a date range of June 3rd to June 5th from being created (or render an error with template logic)?

    Read the article

  • getting global name not defined error

    - by nashr rafeeg
    i have the following class class notify(): def __init__(self,server="localhost", port=23053): self.host = server self.port = port register = gntp.GNTPRegister() register.add_header('Application-Name',"SVN Monitor") register.add_notification("svnupdate",True) growl(register) def svn_update(self, author="Unknown", files=0): notice = gntp.GNTPNotice() notice.add_header('Application-Name',"SVN Monitor") notice.add_header('Notification-Name', "svnupdate") notice.add_header('Notification-Title',"SVN Commit") # notice.add_header('Notification-Icon',"") notice.add_header('Notification-Text',Msg) growl(notice) def growl(data): s = socket.socket(socket.AF_INET, socket.SOCK_STREAM) s.connect((self.host,self.port)) s.send(data) response = gntp.parse_gntp(s.recv(1024)) print response s.close() but when ever i try to use this class via the follwoing code i get 'NameError: global name 'growl' is not defined' from growlnotify import * n = notify() n.svn_update() any one has an idea what is going on here ? cheers nash

    Read the article

  • Increasing figure size in Matplotlib

    - by Anirudh
    I am trying to plot a graph from a distance matrix. The code words fine and gives me a image in 800 * 600 pixels. The image being too small, All the nodes are packed together. I want increase the size of the image. so I added the following line to my code - figure(num=None, figsize=(10, 10), dpi=80, facecolor='w', edgecolor='k') After this all I get is a blank 1000 * 1000 image file. My overall code - import networkx as nx import pickle import matplotlib.pyplot as plt print "Reading from pickle." p_file = open('pickles/names') Names = pickle.load(p_file) p_file.close() p_file = open('pickles/distance') Dist = pickle.load(p_file) p_file.close() G = nx.Graph() print "Inserting Nodes." for n in Names: G.add_node(n) print "Inserting Edges." for i in range(601): for j in range(601): G.add_edge(Names[i],Names[j],weight=Dist[i][j]) print "Drawing Graph." nx.draw(G) print "Saving Figure." #plt.figure(num=None, figsize=(10, 10)) plt.savefig('new.png') print "Success!"

    Read the article

  • Problem with anchor tags in Django after using lighttpd + fastcgi

    - by Drew A
    I just started using lighttpd and fastcgi for my django site, but I've noticed my anchor links are no longer working. I used the anchor links for sorting links on the page, for example I use an anchor to sort links by the number of points (or votes) they have received. For example: the code in the html template: ... {% load sorting_tags %} ... {% ifequal sort_order "points" %} {% trans "total points" %} {% trans "or" %} {% anchor "date" "date posted" %} {% order_by_votes links request.direction %} {% else %} {% anchor "points" "total points" %} {% trans "or" %} {% trans "date posted" %} ... The anchor link on "www.mysite.com/my_app/" for total points will be directed to "my_app/?sort=points" But the correct URL should be "www.mysite.com/my_app/?sort=points" All my other links work, the problem is specific to anchor links. The {% anchor %} tag is taken from django-sorting, the code can be found at http://github.com/directeur/django-sorting Specifically in django-sorting/templatetags/sorting_tags.py Thanks in advance.

    Read the article

  • Getting unpredictable data into a tabular format

    - by Acorn
    The situation: Each page I scrape has <input> elements with a title= and a value= I don't know what is going to be on the page. I want to have all my collected data in a single table at the end, with a column for each title. So basically, I need each row of data to line up with all the others, and if a row doesn't have a certain element, then it should be blank (but there must be something there to keep the alignment). eg. First page has: {animal: cat, colour: blue, fruit: lemon, day: monday} Second page has: {animal: fish, colour: green, day: saturday} Third page has: {animal: dog, number: 10, colour: yellow, fruit: mango, day: tuesday} Then my resulting table should be: animal | number | colour | fruit | day cat | none | blue | lemon | monday fish | none | green | none | saturday dog | 10 | yellow | mango | tuesday Although it would be good to keep the order of the title value pairs, which I know dictionaries wont do. So basically, I need to generate columns from all the titles (kept in order but somehow merged together) What would be the best way of going about this without knowing all the possible titles and explicitly specifying an order for the values to be put in?

    Read the article

  • How to inject a key string to andoid device through ADB?

    - by Nandi
    Hi, Can somebody help me for the following. I want to select a perticular string in the list displayed in android phone. If i take example of phone book. i want to pass a person name to the device using adb interface and that name should get highlighted in the list. I tried all adb commands for this but could pass string and key events to the screen but not able to select the respective string. please help. Thanks in advance.

    Read the article

  • Django and mod_python intermittent error?

    - by Peter
    I have a Django site at http://sm.rutgers.edu/relive/af_api/index/. It is supposed to display "Home of the relive APIs". If you refresh this page many times, you can see different renderings. 1) The expected page. 2) Django "It worked!" page. 3) "ImportError at /index/" page. If you scroll down enough to ROOT_URLCONF part, you will see it says 'relive.urls'. But apparently, it should be 'af_api.urls', which is in my settings.py file. Since these results happen randomly, is it possible that either Django or mod_python is working unstably?

    Read the article

  • How to make Universal Feed Parser only parse feeds?

    - by piquadrat
    I'm trying to get content from external feeds on my Django web site with Universal Feed Parser. I want to have some user error handling, e.g. if the user supplies a URL that is not a feed. When I tried how feedparser responds to faulty input, I was surprised to see that feedparser does not throw any Exceptions at all. E.g. on HTML content, it tries to parse some information from the HTML code, and on non-existing domains, it returns a mostly empty dictionary: {'bozo': 1, 'bozo_exception': URLError(gaierror(-2, 'Name or service not known'),), 'encoding': 'utf-8', 'entries': [], 'feed': {}, 'version': None} Other faulty input manifest themselves in the status_code or the namespaces values in the returned dictionary. So, what's the best approach to have sane error checking without resorting to an endless cascade of if .. elif .. elif ...?

    Read the article

  • Sqlalchemy layout with WSGI application

    - by TheDude
    I'm working on writing a small WSGI application using Bottle and SqlAlchemy and am confused on how the "layout" of my application should be in terms of SqlAlchemy. My confusion is with creating engines and sessions. My understanding is that I should only create one engine with the 'create_engine' method. Should I be creating an engine instance in the global namespace in some sort of singleton pattern and creating sessions based off of it? How have you done this in your projects? Any insight would be appreciated. The examples in the documentation dont seem to make this entirely clear (unless I'm missing something obvious). Any thoughts?

    Read the article

  • pandas read rotated csv files

    - by EricCoding
    Is there any function in pandas that can directly read a rotated csv file? To be specific, the header information in the first col instead of the first row. For example: A 1 2 B 3 5 C 6 7 and I would like the final DataFrame this way A B C 1 3 5 2 5 7 Of corse we can get around this problem using some data wangling techniques like transpose and slicing. I am wondering there should be a quick way in API but I could not find it.

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Search for a String and replace it with a variable

    - by chrissygormley
    Hello, I am trying to use regular expression to search a document fo a UUID number and replace the end of it with a new number. The code I have so far is: read_file = open('test.txt', 'r+') write_file = open('test.txt', 'w') r = re.compile(r'(self.uid\s*=\s*5EFF837F-EFC2-4c32-A3D4\s*)(\S+)') for l in read_file: m1 = r.match(l) if m1: new=(str,m1.group(2)) new?????? This where I get stuck. The file test.txt has the below UUID stored in it: self.uid = '5EFF837F-EFC2-4c32-A3D4-D15C7F9E1F22' I want to replace the part D15C7F9E1F22. I have also tried this: r = re.compile(r'(self.uid\s*=\s*)(\S+)') for l in fp: m1 = r.match(l) new=map(int,m1.group(2).split("-") new[4]='RHUI5345JO' But I cannot seem to match the string. Thanks in advance for any help.

    Read the article

  • converting a treebank of vertical trees to s-expressions

    - by Andreas
    I need to preprocess a treebank corpus of sentences with parse trees. The input format is a vertical representation of trees, like so: S =NP ==(DT +def) the == (N +ani) man =VP ==V walks ...and I need it like: (S (NP (DT the) (N man)) (VP (V walks))) I have code that almost does it, but not quite. There's always a missing paren somewhere. Should I use a proper parser, maybe a CFG? The current code is at http://github.com/andreasvc/eodop/blob/master/arbobanko.py The code also contains real examples from the treebank.

    Read the article

  • Decorator for determining HTTP response from a view

    - by polera
    I want to create a decorator that will allow me to return a raw or "string" representation of a view if a GET parameter "raw" equals "1". The concept works, but I'm stuck on how to pass context to my renderer. Here's what I have so far: from django.shortcuts import render_to_response from django.http import HttpResponse from django.template.loader import render_to_string def raw_response(template): def wrap(view): def response(request,*args,**kwargs): if request.method == "GET": try: if request.GET['raw'] == "1": render = HttpResponse(render_to_string(template,{}),content_type="text/plain") return render except Exception: render = render_to_response(template,{}) return render return response return wrap Currently, the {} is there just as a place holder. Ultimately, I'd like to be able to pass a dict like this: @raw_response('my_template_name.html') def view_name(request): render({"x":42}) Any assistance is appreciated.

    Read the article

< Previous Page | 367 368 369 370 371 372 373 374 375 376 377 378  | Next Page >