Search Results

Search found 13534 results on 542 pages for 'python 2 6'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 367/542 | < Previous Page | 363 364 365 366 367 368 369 370 371 372 373 374  | Next Page >

  • Returning Database Blobs in TurboGears 2.x / FCGI / Lighttpd extremely slow

    - by Tom
    Hey everyone, I am running a TG2 App on lighttpd via flup/fastcgi. We are reading images (~30kb each) from BlobFields in a MySQL database and return those images with a custom mime type via a controller method. Caching these images on the hard disk makes no sense because they change with every request, the only reason we cache these in the DB is that creating these images is quite expensive and the data used to create the images is also present in plain text on the website. Now to the problem itself: When returning such an image, things get extremely slow. The code runs totally fine on paster itself with no visible delay, but as soon as its running via fcgi/lighttpd the described phenomenon happens. I profiled the method of my controller that returns my blob, and the entire method runs in a few miliseconds, but when "return" executes, the entire app hangs for roughly 10 seconds. We could not reproduce the same error with PHP on FCGI. This only seems to happen with Turbogears or Pylons. Here for your consideration the concerned piece of source code: @expose(content_type=CUSTOM_CONTENT_TYPE) def return_img(self, img_id): """ Return a DB persisted image when requested """ img = model.Images.by_id(img_id) #get image from DB response.headers['content-type'] = 'image/png' return img.data # this causes the app to hang for 10 seconds

    Read the article

  • basic unique ModelForm field for Google App Engine

    - by Alexander Vasiljev
    I do not care about concurrency issues. It is relatively easy to build unique form field: from django import forms class UniqueUserEmailField(forms.CharField): def clean(self, value): self.check_uniqueness(super(UniqueUserEmailField, self).clean(value)) def check_uniqueness(self, value): same_user = users.User.all().filter('email', value).get() if same_user: raise forms.ValidationError('%s already_registered' % value) so one could add users on-the-fly. Editing existing user is tricky. This field would not allow to save user having other user email. At the same time it would not allow to save a user with the same email. What code do you use to put a field with uniqueness check into ModelForm?

    Read the article

  • [Django] How to find out whether a model's column is a foreign key?

    - by codethief
    I'm dynamically storing information in the database depending on the request: // table, id and column are provided by the request table_obj = getattr(models, table) record = table_obj.objects.get(pk=id) setattr(record, column, request.POST['value']) The problem is that request.POST['value'] sometimes contains a foreign record's primary key (i.e. an integer) whereas Django expects the column's value to be an object of type ForeignModel: Cannot assign "u'122'": "ModelA.b" must be a "ModelB" instance. Now, is there an elegant way to dynamically check whether b is a column containing foreign keys and what model these keys are linked to? (So that I can load the foreign record by it's primary key and assign it to ModelA?) Or doesn't Django provide information like this to the programmer so I really have to get my hands dirty and use isinstance() on the foreign-key column?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • I am currently serving my static files in Django. How do I use Apache2 to do this?

    - by alex
    (r'^media/(?P<path>.*)$', 'django.views.static.serve',{'document_root': settings.MEDIA_ROOT}), As you can see, I have a directory called "media" under my Django project. I would like to delete this line in my urls.py and instead us Apache to serve my static files. What do I do to my Apache configs (which files do I change) in order to do this? By the way, I installed Apache2 like normal: sudo aptitude install apache2

    Read the article

  • Url open encoding

    - by badc0re
    I have the following code for urllib and BeautifulSoup: getSite = urllib.urlopen(pageName) # open current site getSitesoup = BeautifulSoup(getSite.read()) # reading the site content print getSitesoup.originalEncoding for value in getSitesoup.find_all('link'): # extract all <a> tags defLinks.append(value.get('href')) The result of it: /usr/lib/python2.6/site-packages/bs4/dammit.py:231: UnicodeWarning: Some characters could not be decoded, and were replaced with REPLACEMENT CHARACTER. "Some characters could not be decoded, and were " And when i try to read the site i get: ?7?e????0*"I??G?H????F??????9-??????;??E?YÞBs????????????4i???)?????^W?????`w?Ke??%??*9?.'OQB???V??@?????]???(P??^??q?$?S5???tT*?Z

    Read the article

  • Django: Applying Calculations To A Query Set

    - by TheLizardKing
    I have a QuerySet that I wish to pass to a generic view for pagination: links = Link.objects.annotate(votes=Count('vote')).order_by('-created')[:300] This is my "hot" page which lists my 300 latest submissions (10 pages of 30 links each). I want to now sort this QuerySet by an algorithm that HackerNews uses: (p - 1) / (t + 2)^1.5 p = votes minus submitter's initial vote t = age of submission in hours Now because applying this algorithm over the entire database would be pretty costly I am content with just the last 300 submissions. My site is unlikely to be the next digg/reddit so while scalability is a plus it is required. My question is now how do I iterate over my QuerySet and sort it by the above algorithm? For more information, here are my applicable models: class Link(models.Model): category = models.ForeignKey(Category, blank=False, default=1) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) modified = models.DateTimeField(auto_now=True) url = models.URLField(max_length=1024, unique=True, verify_exists=True) name = models.CharField(max_length=512) def __unicode__(self): return u'%s (%s)' % (self.name, self.url) class Vote(models.Model): link = models.ForeignKey(Link) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) def __unicode__(self): return u'%s vote for %s' % (self.user, self.link) Notes: I don't have "downvotes" so just the presence of a Vote row is an indicator of a vote or a particular link by a particular user.

    Read the article

  • twisted reactor stops too early

    - by pygabriel
    I'm doing a batch script to connect to a tcp server and then exiting. My problem is that I can't stop the reactor, for example: cmd = raw_input("Command: ") # custom factory, the protocol just send a line reactor.connectTCP(HOST,PORT, CommandClientFactory(cmd) d = defer.Deferred() d.addCallback(lambda x: reactor.stop()) reactor.callWhenRunning(d.callback,None) reactor.run() In this code the reactor stops before that the tcp connection is done and the cmd is passed. How can I stop the reactor after that all the operation are finished?

    Read the article

  • How small is *too small* for an opensource project?

    - by Adam Lewis
    I have a fair number of smaller projects / libraries that I have been using over the past 2 years. I am thinking about moving them to Google Code to make it easier to share with co-workers and easier to import them into new projects on my own environments. The are things like a simple FSMs, CAN (Controller Area Network) drivers, and GPIB drivers. Most of them are small (less than 500 lines), so it makes me wonder are these types of things too small for a stand alone open-source project? Note that I would like to make it opensource because it does not give me, or my company, any real advantage.

    Read the article

  • Web2py controllers with parameters?

    - by nickfranceschina
    I am building an app using Web2py framework... I don't want to have to use the request object to get all of the querystring parameters, instead I'd like to build my controller with named parameters and have the router unpack the querystring (or form data) dictionary into the named parameters and call my controller. so instead of a controller method of create_user(): where I would use the global request() object and look through the vars list... I would prefer instead to have create_user(first_name, last_name, email): like I see in other MVC platforms. is this possible in Web2py already? or is there a plugin for it? or do I need to add that myself?

    Read the article

  • Preserving the dimensions of a slice from a Numpy 3d array

    - by Brendan
    I have a 3d array, a, of shape say a.shape = (10, 10, 10) When slicing, the dimensions are squeezed automatically i.e. a[:,:,5].shape = (10, 10) I'd like to preserve the number of dimensions but also ensure that the dimension that was squeezed is the one that shows 1 i.e. a[:,:,5].shape = (10, 10, 1) I have thought of re-casting the array and passing ndmin but that just adds the extra dimensions to the start of the shape tuple regardless of where the slice came from in the array a.

    Read the article

  • Tkinter Packing Strangeness: Buttons packed above others

    - by Parand
    I'm sure I'm doing something obvious wrong here, but I can't see it. I end up with the "Should be on top" label packed at the bottom instead of at the top. What am I doing wrong? from Tkinter import * class SelectAction(Frame): buttons = {} def callback(self): print "Callback" def createWidgets(self): logo_label = Label(text="Should be on top").pack(fill=X) for name, text, callback in ( ('setup_account', 'Account Settings', self.callback), ('do_action', 'Do Something', self.callback), ): self.buttons[name] = Button(self, text=text, command=callback).pack(fill=X) def __init__(self, master=None): Frame.__init__(self, master) self.pack() self.createWidgets() if __name__ == "__main__": root = Tk() app = SelectAction(master=root) app.mainloop() root.destroy()

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • PyParsing: Not all tokens passed to setParseAction()

    - by Rosarch
    I'm parsing sentences like "CS 2110 or INFO 3300". I would like to output a format like: [[("CS" 2110)], [("INFO", 3300)]] To do this, I thought I could use setParseAction(). However, the print statements in statementParse() suggest that only the last tokens are actually passed: >>> statement.parseString("CS 2110 or INFO 3300") Match [{Suppress:("or") Re:('[A-Z]{2,}') Re:('[0-9]{4}')}] at loc 7(1,8) string CS 2110 or INFO 3300 loc: 7 tokens: ['INFO', 3300] Matched [{Suppress:("or") Re:('[A-Z]{2,}') Re:('[0-9]{4}')}] -> ['INFO', 3300] (['CS', 2110, 'INFO', 3300], {'Course': [(2110, 1), (3300, 3)], 'DeptCode': [('CS', 0), ('INFO', 2)]}) I expected all the tokens to be passed, but it's only ['INFO', 3300]. Am I doing something wrong? Or is there another way that I can produce the desired output? Here is the pyparsing code: from pyparsing import * def statementParse(str, location, tokens): print "string %s" % str print "loc: %s " % location print "tokens: %s" % tokens DEPT_CODE = Regex(r'[A-Z]{2,}').setResultsName("DeptCode") COURSE_NUMBER = Regex(r'[0-9]{4}').setResultsName("CourseNumber") OR_CONJ = Suppress("or") COURSE_NUMBER.setParseAction(lambda s, l, toks : int(toks[0])) course = DEPT_CODE + COURSE_NUMBER.setResultsName("Course") statement = course + Optional(OR_CONJ + course).setParseAction(statementParse).setDebug()

    Read the article

  • Conditional operator in Mako using Pylons

    - by Antoine Leclair
    In PHP, I often use the conditional operator to add an attribute to an html element if it applies to the element in question. For example: <select name="blah"> <option value="1"<?= $blah == 1 ? ' selected="selected"' : '' ?>> One </option> <option value="2"<?= $blah == 2 ? ' selected="selected"' : '' ?>> Two </option> </select> I'm starting a project with Pylons using Mako for the templating. How can I achieve something similar? Right now, I see two possibilities that are not ideal. Solution 1: <select name="blah"> % if blah == 1: <option value="1" selected="selected">One</option> % else: <option value="1">One</option> % endif % if blah == 2: <option value="2" selected="selected">Two</option> % else: <option value="2">Two</option> % endif </select> Solution 2: <select name="blah"> <option value="1" % if blah == 1: selected="selected" % endif >One</option> <option value="2" % if blah == 2: selected="selected" % endif >Two</option> </select> In this particular case, the value is equal to the variable tested (value="1" = blah == 1), but I use the same pattern in other situations, like <?= isset($variable) ? ' value="$variable" : '' ?>. I am looking for a clean way to achieve this using Mako.

    Read the article

  • Auto filling polymorphic table on save or on delete in django

    - by Mo J. Mughrabi
    Hi, Am working on an project in which I made an app "core" it will contain some of the reused models across my projects, most of those are polymorphic models (Generic content types) and will be linked to different models. Example below am trying to create audit model and will be linked to several models which may require auditing. This is the polls/models.py from django.db import models from django.contrib.auth.models import User from core.models import * from django.contrib.contenttypes import generic class Poll(models.Model): ## TODO: Document question = models.CharField(max_length=300) question_slug=models.SlugField(editable=False) start_poll_at = models.DateTimeField(null=True) end_poll_at = models.DateTimeField(null=True) is_active = models.BooleanField(default=True) audit_obj=generic.GenericRelation(Audit) def __unicode__(self): return self.question class Choice(models.Model): ## TODO: Document choice = models.CharField(max_length=200) poll=models.ForeignKey(Poll) audit_obj=generic.GenericRelation(Audit) class Vote(models.Model): ## TODO: Document choice=models.ForeignKey(Choice) Ip_Address=models.IPAddressField(editable=False) vote_at=models.DateTimeField("Vote at", editable=False) here is the core/modes.py from django.db import models from django.contrib.auth.models import User from django.contrib.contenttypes.models import ContentType from django.contrib.contenttypes import generic class Audit(models.Model): ## TODO: Document # Polymorphic model using generic relation through DJANGO content type created_at = models.DateTimeField("Created at", auto_now_add=True) created_by = models.ForeignKey(User, db_column="created_by", related_name="%(app_label)s_%(class)s_y+") updated_at = models.DateTimeField("Updated at", auto_now=True) updated_by = models.ForeignKey(User, db_column="updated_by", null=True, blank=True, related_name="%(app_label)s_%(class)s_y+") content_type = models.ForeignKey(ContentType) object_id = models.PositiveIntegerField(unique=True) content_object = generic.GenericForeignKey('content_type', 'object_id') and here is polls/admin.py from django.core.context_processors import request from polls.models import Poll, Choice from core.models import * from django.contrib import admin class ChoiceInline(admin.StackedInline): model = Choice extra = 3 class PollAdmin(admin.ModelAdmin): inlines = [ChoiceInline] admin.site.register(Poll, PollAdmin) Am quite new to django, what am trying to do here, insert a record in audit when a record is inserted in polls and then update that same record when a record is updated in polls.

    Read the article

  • Google App Engine with local Django 1.1 gets Intermittent Failures

    - by Jon Watte
    I'm using the Windows Launcher development environment for Google App Engine. I have downloaded Django 1.1.2 source, and un-tarrred the "django" subdirectory to live within my application directory (a peer of app.yaml) At the top of each .py source file, I do this: import settings import os os.environ["DJANGO_SETTINGS_MODULE"] = 'settings' In my file settings.py (which lives at the root of the app directory, as well), I do this: DEBUG = True TEMPLATE_DIRS = ('html') INSTALLED_APPS = ('filters') import os os.environ["DJANGO_SETTINGS_MODULE"] = 'settings' from google.appengine.dist import use_library use_library('django', '1.1') from django.template import loader Yes, this looks a bit like overkill, doesn't it? I only use django.template. I don't explicitly use any other part of django. However, intermittently I get one of two errors: 1) Django complains that DJANGO_SETTINGS_MODULE is not defined. 2) Django complains that common.html (a template I'm extending in other templates) doesn't exist. 95% of the time, these errors are not encountered, and they randomly just start happening. Once in that state, the local server seems "wedged" and re-booting it generally fixes it. What's causing this to happen, and what can I do about it? How can I even debug it? Here is the traceback from the error: Traceback (most recent call last): File "C:\code\kwbudget\edit_budget.py", line 34, in get self.response.out.write(t.render(template.Context(values))) File "C:\code\kwbudget\django\template\__init__.py", line 165, in render return self.nodelist.render(context) File "C:\code\kwbudget\django\template\__init__.py", line 784, in render bits.append(self.render_node(node, context)) File "C:\code\kwbudget\django\template\__init__.py", line 797, in render_node return node.render(context) File "C:\code\kwbudget\django\template\loader_tags.py", line 71, in render compiled_parent = self.get_parent(context) File "C:\code\kwbudget\django\template\loader_tags.py", line 66, in get_parent raise TemplateSyntaxError, "Template %r cannot be extended, because it doesn't exist" % parent TemplateSyntaxError: Template u'common.html' cannot be extended, because it doesn't exist And edit_budget.py starts with exactly the lines that I included up top. All templates live in a directory named "html" in my root directory, and "html/common.html" exists. I know the template engine finds them, because I start out with "html/edit_budget.html" which extends common.html. It looks as if the settings module somehow isn't applied (because that's what adds html to the search path for templates).

    Read the article

  • csrf error in django

    - by niklasfi
    Hello, I want to realize a login for my site. I basically copied and pasted the following bits from the Django Book together. However I still get an error (CSRF verification failed. Request aborted.), when submitting my registration form. Can somebody tell my what raised this error and how to fix it? Here is my code: views.py: # Create your views here. from django import forms from django.contrib.auth.forms import UserCreationForm from django.http import HttpResponseRedirect from django.shortcuts import render_to_response def register(request): if request.method == 'POST': form = UserCreationForm(request.POST) if form.is_valid(): new_user = form.save() return HttpResponseRedirect("/books/") else: form = UserCreationForm() return render_to_response("registration/register.html", { 'form': form, }) register.html: <html> <body> {% block title %}Create an account{% endblock %} {% block content %} <h1>Create an account</h1> <form action="" method="post">{% csrf_token %} {{ form.as_p }} <input type="submit" value="Create the account"> </form> {% endblock %} </body> </html>

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 363 364 365 366 367 368 369 370 371 372 373 374  | Next Page >