Search Results

Search found 13602 results on 545 pages for 'python decorators'.

Page 375/545 | < Previous Page | 371 372 373 374 375 376 377 378 379 380 381 382  | Next Page >

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • has any tools easy to download or uploaed data from gae ..

    - by zjm1126
    i find this: http://aralbalkan.com/1784 but it is : Gaebar is an easy-to-use, standalone Django application that you can plug in to your existing Google App Engine Django or app-engine-patch-based Django applications on Google App Engine to give them datastore backup and restore functionality. my app is not based on django,so did you know any tools esay to do this . thanks

    Read the article

  • Right way to return proxy model instance from a base model instance in Django ?

    - by sotangochips
    Say I have models: class Animal(models.Model): type = models.CharField(max_length=255) class Dog(Animal): def make_sound(self): print "Woof!" class Meta: proxy = True class Cat(Animal): def make_sound(self): print "Meow!" class Meta: proxy = True Let's say I want to do: animals = Animal.objects.all() for animal in animals: animal.make_sound() I want to get back a series of Woofs and Meows. Clearly, I could just define a make_sound in the original model that forks based on animal_type, but then every time I add a new animal type (imagine they're in different apps), I'd have to go in and edit that make_sound function. I'd rather just define proxy models and have them define the behavior themselves. From what I can tell, there's no way of returning mixed Cat or Dog instances, but I figured maybe I could define a "get_proxy_model" method on the main class that returns a cat or a dog model. Surely you could do this, and pass something like the primary key and then just do Cat.objects.get(pk = passed_in_primary_key). But that'd mean doing an extra query for data you already have which seems redundant. Is there any way to turn an animal into a cat or a dog instance in an efficient way? What's the right way to do what I want to achieve?

    Read the article

  • In SqlAlchemy, how to ignore m2m relationship attributes when merge?

    - by ablmf
    There is a m2m relation in my models, User and Role. I want to merge a role, but i DO NOT want this merge has any effect on user and role relation-ship. Unfortunately, for some complicate reason, role.users if not empty. I tried to set role.users = None, but SA complains None is not a list. At this moment, I use sqlalchemy.orm.attributes.del_attribute, but I don't know if it's provided for this purpose.

    Read the article

  • Trie Backtracking in Recursion

    - by Darksky
    I am building a tree for a spell checker with suggestions. Each node contains a key (a letter) and a value (array of letters down that path). So assume the following sub-trie in my big trie: W / \ a e | | k k | | is word--> e e | ... This is just a subpath of a sub-trie. W is a node and a and e are two nodes in its value array etc... At each node, I check if the next letter in the word is a value of the node. I am trying to support mistyped vowels for now. So 'weke' will yield 'wake' as a suggestion. Here's my searchWord function in my trie: def searchWord(self, word, path=""): if len(word) > 0: key = word[0] word = word[1:] if self.values.has_key(key): path = path + key nextNode = self.values[key] return nextNode.searchWord(word, path) else: # check here if key is a vowel. If it is, check for other vowel substitutes else: if self.isWord: return path # this is the word found else: return None Given 'weke', at the end when word is of length zero and path is 'weke', my code will hit the second big else block. weke is not marked as a word and so it will return with None. This will return out of searchWord with None. To avoid this, at each stack unwind or recursion backtrack, I need to check if a letter is a vowel and if it is, do the checking again. I changed the if self.values.has_key(key) loop to the following: if self.values.has_key(key): path = path + key nextNode = self.values[key] ret = nextNode.searchWord(word, path) if ret == None: # check if key == vowel and replace path # return nextNode.searchWord(... return ret What am I doing wrong here? What can I do when backtracking to achieve what I'm trying to do?

    Read the article

  • How do I relate two models/tables in Django based on non primary non unique keys?

    - by wizard
    I've got two tables that I need to relate on a single field po_num. The data is imported from another source so while I have a little bit of control over what the tables look like but I can't change them too much. What I want to do is relate these two models so I can look up one from the other based on the po_num fields. What I really need to do is join the two tables so I can do a where on a count of the related table. I would like to do filter for all Order objects that have 0 related EDI856 objects. I tried adding a foreign key to the Order model and specified the db_column and to_fields as po_num but django didn't like that the fact that Edi856.po_num wasn't unique. Here are the important fields of my current models that let me display but not filter for the data that I want. class Edi856(models.Model): po_num = models.CharField(max_length=90, db_index=True ) class Order(models.Model): po_num = models.CharField(max_length=90, db_index=True) def in_edi(self): '''Has the edi been processed?''' return Edi856.objects.filter(po_num = self.po_num).count() Thanks for taking the time to read about my problem. I'm not sure what to do from here.

    Read the article

  • beautifulsoup can't find exist href in file

    - by young001
    I have a html file like following: <form action="/2811457/follow?gsid=3_5bce9b871484d3af90c89f37" method="post"> <div> <a href="/2811457/follow?page=2&amp;gsid=3_5bce9b871484d3af90c89f37">next_page</a> &nbsp;<input name="mp" type="hidden" value="3" /> <input type="text" name="page" size="2" style='-wap-input-format: "*N"' /> <input type="submit" value="jump" />&nbsp;1/3 </div> </form> how to extract the "1/3" from the file? It is a part of html,I intend to make it clear. When I use beautifulsoup, I'm new to beautifulsoup,and I have look the document,but still confused. how to extract"1/3" from the html file? total_urls_num = soup.find(re.compile('.*/d\//d.*')) doesn't work As JBernardo said,\d should be a number,When I change to .*\d/\d.*,it doesn't work too. my code: from BeautifulSoup import BeautifulSoup import re with open("html.txt","r") as f: response = f.read() print response soup = BeautifulSoup(response) delete_urls = soup.findAll('a', href=re.compile('follow\?page')) #works print delete_urls #total_urls_num = soup.find(re.compile('.*\d/\d.*')) total_urls_num = soup.find('input',style='submit') #can't work print total_urls_num

    Read the article

  • Efficiently generate a 16-character, alphanumeric string

    - by ensnare
    I'm looking for a very quick way to generate an alphanumeric unique id for a primary key in a table. Would something like this work? def genKey(): hash = hashlib.md5(RANDOM_NUMBER).digest().encode("base64") alnum_hash = re.sub(r'[^a-zA-Z0-9]', "", hash) return alnum_hash[:16] What would be a good way to generate random numbers? If I base it on microtime, I have to account for the possibility of several calls of genKey() at the same time from different instances. Or is there a better way to do all this? Thanks.

    Read the article

  • Numpy Matrix keeps giving me an Error,

    - by uberjumper
    Okay this is werid, i keep getting the error, randomly. ValueError: matrix must be 2-dimensional So i tracked it down, and cornered it to basically something like this: a_list = [[(1,100) for _ in range(32)] for _ in range(32)] numpy.matrix(a_list) Whats wrong with this? If i print a_list it is clearly a 2d matrix of tuples, however numpy does not believe so.

    Read the article

  • Accessing CSR extension stack in M2Crypto

    - by Charles Duffy
    Howdy! I have a certificate signing request with an extension stack added. When building a certificate based on this request, I would like to be able to access that stack to use in creating the final certificate. However, while M2Crypto.X509.X509 has a number of helpers for accessing extensions (get_ext, get_ext_at and the like), M2Crypto.X509.Request appears to provide only a member for adding extensions, but no way to inspect the extensions already associated with a given object. Am I missing something here?

    Read the article

  • need help in site classification

    - by goh
    hi guys, I have to crawl the contents of several blogs. The problem is that I need to classify whether the blogs the authors are from a specific school and is talking about the school's stuff. May i know what's the best approach in doing the crawling or how should i go about the classification?

    Read the article

  • Creating a Group of Groups in Django

    - by Greg
    I'm creating my own Group model; I'm not referring to the builtin Group model. I want each hroup to be a member of another group (it's parent), but there is the one "top" group that doesn't have a parent group. The admin interface won't let me create a group without entering a parent. I get the error personnel_group.parent_id may not be NULL. My Group model looks like this: class Group(models.Model): name = models.CharField(max_length=50) parent = models.ForeignKey('self', blank=True, null=True) order = models.IntegerField() icon = models.ImageField(upload_to='groups', blank=True, null=True) description = models.TextField(blank=True, null=True) How can I accomplish this? Thanks.

    Read the article

  • In plain English, what are Django generic views?

    - by allyourcode
    The first two paragraphs of this page explain that generic views are supposed to make my life easier, less monotonous, and make me more attractive to women (I made up that last one): http://docs.djangoproject.com/en/dev/topics/generic-views/#topics-generic-views I'm all for improving my life, but what do generic views actually do? It seems like lots of buzzwords are being thrown around, which confuse more than they explain. Are generic views similar to scaffolding in Ruby on Rails? The last bullet point in the intro seems to indicate this. Is that an accurate statement?

    Read the article

  • How to give points for each indices of list

    - by Eric Jung
    def voting_borda(rank_ballots): '''(list of list of str) -> tuple of (str, list of int) The parameter is a list of 4-element lists that represent rank ballots for a single riding. The Borda Count is determined by assigning points according to ranking. A party gets 3 points for each first-choice ranking, 2 points for each second-choice ranking and 1 point for each third-choice ranking. (No points are awarded for being ranked fourth.) For example, the rank ballot shown above would contribute 3 points to the Liberal count, 2 points to the Green count and 1 point to the CPC count. The party that receives the most points wins the seat. Return a tuple where the first element is the name of the winning party according to Borda Count and the second element is a four-element list that contains the total number of points for each party. The order of the list elements corresponds to the order of the parties in PARTY_INDICES.''' #>>> voting_borda([['GREEN','NDP', 'LIBERAL', 'CPC'], ['GREEN','CPC','LIBERAL','NDP'], ['LIBERAL','NDP', 'CPC', 'GREEN']]) #('GREEN',[4, 6, 5, 3]) list_of_party_order = [] for sublist in rank_ballots: for party in sublist[0]: if party == 'GREEN': GREEN_COUNT += 3 elif party == 'NDP': NDP_COUNT += 3 elif party == 'LIBERAL': LIBERAL_COUNT += 3 elif party == 'CPC': CPC_COUNT += 3 for party in sublist[1]: if party == 'GREEN': GREEN_COUNT += 2 elif party == 'NDP': NDP_COUNT += 2 elif party == 'LIBERAL': LIBERAL_COUNT += 2 elif party == 'CPC': CPC_COUNT += 2 for party in sublist[2]: if party == 'GREEN': GREEN_COUNT += 1 elif party == 'NDP': NDP_COUNT += 1 elif party == 'LIBERAL': LIBERAL_COUNT += 1 elif party == 'CPC': CPC_COUNT += 1 I don't know how I would give points for each indices of the list MORE SIMPLY. Can someone please help me? Without being too complicated. Thank you!

    Read the article

  • Search for a String and replace it with a variable

    - by chrissygormley
    Hello, I am trying to use regular expression to search a document fo a UUID number and replace the end of it with a new number. The code I have so far is: read_file = open('test.txt', 'r+') write_file = open('test.txt', 'w') r = re.compile(r'(self.uid\s*=\s*5EFF837F-EFC2-4c32-A3D4\s*)(\S+)') for l in read_file: m1 = r.match(l) if m1: new=(str,m1.group(2)) new?????? This where I get stuck. The file test.txt has the below UUID stored in it: self.uid = '5EFF837F-EFC2-4c32-A3D4-D15C7F9E1F22' I want to replace the part D15C7F9E1F22. I have also tried this: r = re.compile(r'(self.uid\s*=\s*)(\S+)') for l in fp: m1 = r.match(l) new=map(int,m1.group(2).split("-") new[4]='RHUI5345JO' But I cannot seem to match the string. Thanks in advance for any help.

    Read the article

  • Declare models elsewhere than in "models.py"

    - by sebpiq
    Hi ! I have an application that splits models into different files. Actually the folder looks like : >myapp __init__.py models.py >hooks ... ... myapp don't care about what's in the hooks, folder, except that there are models, and that they have to be declared somehow. So, I put this in myapp.__init__.py : from django.conf import settings for hook in settings.HOOKS : try : __import__(hook) except ImportError as e : print "Got import err !", e #where HOOKS = ("myapp.hooks.a_super_hook1", ...) The problem is that it doesn't work when I run syncdb(and throws some strange "Got import err !"... strange considering that it's related to another module of my program that I don't even import anywhere :/ ) ! So I tried successively : 1) for hook in settings.HOOKS : try : exec ("from %s import *" % hook) doesn't work either : syncdb doesn't install the models in hooks 2) from myapp.hooks.a_super_hook1 import * This works 3) exec("from myapp.hooks.a_super_hook1 import *") This works to So I checked that in the test 1), the statement executed is the same than in tests 2) and 3), and it is exactly the same ... Any idea ???

    Read the article

  • Distance between numpy arrays, columnwise

    - by Jaapsneep
    I have 2 arrays in 2D, where the column vectors are feature vectors. One array is of size F x A, the other of F x B, where A << B. As an example, for A = 2 and F = 3 (B can be anything): arr1 = np.array( [[1, 4], [2, 5], [3, 6]] ) arr2 = np.array( [[1, 4, 7, 10, ..], [2, 5, 8, 11, ..], [3, 6, 9, 12, ..]] ) I want to calculate the distance between arr1 and a fragment of arr2 that is of equal size (in this case, 3x2), for each possible fragment of arr2. The column vectors are independent of each other, so I believe I should calculate the distance between each column vector in arr1 and a collection of column vectors ranging from i to i + A from arr2 and take the sum of these distances (not sure though). Does numpy offer an efficient way of doing this, or will I have to take slices from the second array and, using another loop, calculate the distance between each column vector in arr1 and the corresponding column vector in the slice?

    Read the article

  • some register.inclusion_tag error in my code using django

    - by zjm1126
    my helloworld_tags: from django import template register = template.Library() def show_profile(): return {"eee": '333'} register.inclusion_tag("b.html")(show_profile) my view: def b(request): return render_to_response('b.html') my html: {% load helloworld_tags%} dsad {{ eee }} but only show 'dsad' ,not show 'dsad333' why?? thanks

    Read the article

  • Iterating dictionary indexes in django templates

    - by unclaimedbaggage
    Hi folks...I have a dictionary with embedded objects, which looks something like this: notes = { 2009: [<Note: Test note>, <Note: Another test note>], 2010: [<Note: Third test note>, <Note: Fourth test note>], } I'm trying to access each of the note objects inside a django template, and having a helluva time navigating to them. In short, I'm not sure how to extract by index in django templating. Current template code is: <h3>Notes</h3> {% for year in notes %} {{ year }} # Works fine {% for note in notes.year %} {{ note }} # Returns blank {% endfor %} {% endfor %} If I replace {% for note in notes.year %} with {% for note in notes.2010 %} things work fine, but I need that '2010' to be dynamic. Any suggestions much appreciated.

    Read the article

  • SQLAlchemy Expression Language problem

    - by Torkel
    I'm trying to convert this to something sqlalchemy expression language compatible, I don't know if it's possible out of box and are hoping someone more experienced can help me along. The backend is PostgreSQL and if I can't make it as an expression I'll create a string instead. SELECT DISTINCT date_trunc('month', x.x) as date, COALESCE(b.res1, 0) AS res1, COALESCE(b.res2, 0) AS res2 FROM generate_series( date_trunc('year', now() - interval '1 years'), date_trunc('year', now() + interval '1 years'), interval '1 months' ) AS x LEFT OUTER JOIN( SELECT date_trunc('month', access_datetime) AS when, count(NULLIF(resource_id != 1, TRUE)) AS res1, count(NULLIF(resource_id != 2, TRUE)) AS res2 FROM tracking_entries GROUP BY date_trunc('month', access_datetime) ) AS b ON (date_trunc('month', x.x) = b.when) First of all I got a class TrackingEntry mapped to tracking_entries, the select statement within the outer joined can be converted to something like (pseudocode):: from sqlalchemy.sql import func, select from datetime import datetime, timedelta stmt = select([ func.date_trunc('month', TrackingEntry.resource_id).label('when'), func.count(func.nullif(TrackingEntry.resource_id != 1, True)).label('res1'), func.count(func.nullif(TrackingEntry.resource_id != 2, True)).label('res2') ], group_by=[func.date_trunc('month', TrackingEntry.access_datetime), ]) Considering the outer select statement I have no idea how to build it, my guess is something like: outer = select([ func.distinct(func.date_trunc('month', ?)).label('date'), func.coalesce(?.res1, 0).label('res1'), func.coalesce(?.res2, 0).label('res2') ], from_obj=[ func.generate_series( datetime.now(), datetime.now() + timedelta(days=365), timedelta(days=1) ).label(x) ]) Then I suppose I have to link those statements together without using foreign keys: outer.outerjoin(stmt???).??(func.date_trunc('month', ?.?), ?.when) Anyone got any suggestions or even better a solution?

    Read the article

  • Connecting slots and events in PyQt4 in a loop

    - by LukaD
    Im trying to build a calculator with PyQt4 and connecting the 'clicked()' signals from the buttons doesn't as expected. Im creating my buttons for the numbers inside a for loop where i try to connect them afterwards. def __init__(self): for i in range(0,10): self._numberButtons += [QPushButton(str(i), self)] self.connect(self._numberButtons[i], SIGNAL('clicked()'), lambda : self._number(i)) def _number(self, x): print(x) When I click on the buttons all of them print out '9'. Why is that so and how can i fix this?

    Read the article

  • Why is django.test.client.Client not keeping me logged in.

    - by Mystic
    I'm using django.test.client.Client to test whether some text shows up when a user is logged in. However, I the Client object doesn't seem to be keeping me logged in. This test passes if done manually with Firefox but not when done with the Client object. class Test(TestCase): def test_view(self): user.set_password(password) user.save() client = self.client # I thought a more manual way would work, but no luck # client.post('/login', {'username':user.username, 'password':password}) login_successful = client.login(username=user.username, password=password) # this assert passes self.assertTrue(login_successful) response = client.get("/path", follow=True) #whether follow=True or not doesn't seem to work self.assertContains(response, "needle" ) When I print response it returns the login form that is hidden by: {% if not request.user.is_authenticated %} ... form ... {% endif %} This is confirmed when I run ipython manage.py shell. The problem seems to be that the Client object is not keeping the session authenticated.

    Read the article

  • How would make this run with an if statement and one for loop?

    - by Nick Jacobs
    I'm trying to get this to run by using an if statment, a for loop, and a list. The list is part of the parameters. I am not sure how to write the if statement and have the program loop through all of the different words and set everything how it is supposed to be. newSndIdx=0; for i in range (8700, 12600+1): sampleValue=getSampleValueAt(sound, i) setSampleValueAt(newSnd, newSndIdx, sampleValue) newSndIdx +=1 newSndIdx=newSndIdx+500 for i in range (15700, 17600+1): sampleValue=getSampleValueAt(sound, i) setSampleValueAt(newSnd, newSndIdx, sampleValue) newSndIdx +=1 newSndIdx=newSndIdx+500 for i in range (18750, 22350+1): sampleValue=getSampleValueAt(sound, i) setSampleValueAt(newSnd, newSndIdx, sampleValue) newSndIdx +=1 newSndIdx=newSndIdx+500 for i in range (23700, 27250+1): sampleValue=getSampleValueAt(sound, i) setSampleValueAt(newSnd, newSndIdx, sampleValue) newSndIdx +=1 newSndIdx=newSndIdx+500 for i in range (106950, 115300+1): sampleValue=getSampleValueAt(sound, i) setSampleValueAt(newSnd, newSndIdx, sampleValue) newSndIdx+=1

    Read the article

< Previous Page | 371 372 373 374 375 376 377 378 379 380 381 382  | Next Page >