Search Results

Search found 13683 results on 548 pages for 'python sphinx'.

Page 378/548 | < Previous Page | 374 375 376 377 378 379 380 381 382 383 384 385  | Next Page >

  • Extend argparse to write set names in the help text for optional argument choices and define those sets once at the end

    - by Kent
    Example of the problem If I have a list of valid option strings which is shared between several arguments, the list is written in multiple places in the help string. Making it harder to read: def main(): elements = ['a', 'b', 'c', 'd', 'e', 'f'] parser = argparse.ArgumentParser() parser.add_argument( '-i', nargs='*', choices=elements, default=elements, help='Space separated list of case sensitive element names.') parser.add_argument( '-e', nargs='*', choices=elements, default=[], help='Space separated list of case sensitive element names to ' 'exclude from processing') parser.parse_args() When running the above function with the command line argument --help it shows: usage: arguments.py [-h] [-i [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]]] [-e [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]]] optional arguments: -h, --help show this help message and exit -i [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]] Space separated list of case sensitive element names. -e [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]] Space separated list of case sensitive element names to exclude from processing What would be nice It would be nice if one could define an option list name, and in the help output write the option list name in multiple places and define it last of all. In theory it would work like this: def main_optionlist(): elements = ['a', 'b', 'c', 'd', 'e', 'f'] # Two instances of OptionList are equal if and only if they # have the same name (ALFA in this case) ol = OptionList('ALFA', elements) parser = argparse.ArgumentParser() parser.add_argument( '-i', nargs='*', choices=ol, default=ol, help='Space separated list of case sensitive element names.') parser.add_argument( '-e', nargs='*', choices=ol, default=[], help='Space separated list of case sensitive element names to ' 'exclude from processing') parser.parse_args() And when running the above function with the command line argument --help it would show something similar to: usage: arguments.py [-h] [-i [ALFA [ALFA ...]]] [-e [ALFA [ALFA ...]]] optional arguments: -h, --help show this help message and exit -i [ALFA [ALFA ...]] Space separated list of case sensitive element names. -e [ALFA [ALFA ...]] Space separated list of case sensitive element names to exclude from processing sets in optional arguments: ALFA {a,b,c,d,e,f} Question I need to: Replace the {'l', 'i', 's', 't', 's'} shown with the option name, in the optional arguments. At the end of the help text show a section explaining which elements each option name consists of. So I ask: Is this possible using argparse? Which classes would I have to inherit from and which methods would I need to override? I have tried looking at the source for argparse, but as this modification feels pretty advanced I don´t know how to get going.

    Read the article

  • Making all variables accessible to namespace

    - by Gökhan Sever
    Hello, Say I have a simple function: def myfunc(): a = 4.2 b = 5.5 ... many similar variables ... I use this function one time only and I am wondering what is the easiest way to make all the variables inside the function accessible to my main name-space. Do I have to declare global for each item? or any other suggested methods? Thanks.

    Read the article

  • how can i set the key 'blob-key' about BlobStore?

    - by pyleaf
    I use the jquery plugin "uploadify" to upload multiple files to My App(GAE), and then save them with blobstore, but it failed. I debug the code into get_uploads, it seems field.type_options is empty and of course has 'blob-key'. Q: where does the key 'blob-key' come from? thank you!

    Read the article

  • In SqlAlchemy, how to ignore m2m relationship attributes when merge?

    - by ablmf
    There is a m2m relation in my models, User and Role. I want to merge a role, but i DO NOT want this merge has any effect on user and role relation-ship. Unfortunately, for some complicate reason, role.users if not empty. I tried to set role.users = None, but SA complains None is not a list. At this moment, I use sqlalchemy.orm.attributes.del_attribute, but I don't know if it's provided for this purpose.

    Read the article

  • Right way to return proxy model instance from a base model instance in Django ?

    - by sotangochips
    Say I have models: class Animal(models.Model): type = models.CharField(max_length=255) class Dog(Animal): def make_sound(self): print "Woof!" class Meta: proxy = True class Cat(Animal): def make_sound(self): print "Meow!" class Meta: proxy = True Let's say I want to do: animals = Animal.objects.all() for animal in animals: animal.make_sound() I want to get back a series of Woofs and Meows. Clearly, I could just define a make_sound in the original model that forks based on animal_type, but then every time I add a new animal type (imagine they're in different apps), I'd have to go in and edit that make_sound function. I'd rather just define proxy models and have them define the behavior themselves. From what I can tell, there's no way of returning mixed Cat or Dog instances, but I figured maybe I could define a "get_proxy_model" method on the main class that returns a cat or a dog model. Surely you could do this, and pass something like the primary key and then just do Cat.objects.get(pk = passed_in_primary_key). But that'd mean doing an extra query for data you already have which seems redundant. Is there any way to turn an animal into a cat or a dog instance in an efficient way? What's the right way to do what I want to achieve?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • has any tools easy to download or uploaed data from gae ..

    - by zjm1126
    i find this: http://aralbalkan.com/1784 but it is : Gaebar is an easy-to-use, standalone Django application that you can plug in to your existing Google App Engine Django or app-engine-patch-based Django applications on Google App Engine to give them datastore backup and restore functionality. my app is not based on django,so did you know any tools esay to do this . thanks

    Read the article

  • beautifulsoup can't find exist href in file

    - by young001
    I have a html file like following: <form action="/2811457/follow?gsid=3_5bce9b871484d3af90c89f37" method="post"> <div> <a href="/2811457/follow?page=2&amp;gsid=3_5bce9b871484d3af90c89f37">next_page</a> &nbsp;<input name="mp" type="hidden" value="3" /> <input type="text" name="page" size="2" style='-wap-input-format: "*N"' /> <input type="submit" value="jump" />&nbsp;1/3 </div> </form> how to extract the "1/3" from the file? It is a part of html,I intend to make it clear. When I use beautifulsoup, I'm new to beautifulsoup,and I have look the document,but still confused. how to extract"1/3" from the html file? total_urls_num = soup.find(re.compile('.*/d\//d.*')) doesn't work As JBernardo said,\d should be a number,When I change to .*\d/\d.*,it doesn't work too. my code: from BeautifulSoup import BeautifulSoup import re with open("html.txt","r") as f: response = f.read() print response soup = BeautifulSoup(response) delete_urls = soup.findAll('a', href=re.compile('follow\?page')) #works print delete_urls #total_urls_num = soup.find(re.compile('.*\d/\d.*')) total_urls_num = soup.find('input',style='submit') #can't work print total_urls_num

    Read the article

  • Creating a custom widget using django for use on external sites

    - by ajt
    I have a new site that I am putting together and part of it has statistics for the site's users. I would like to create a widget that others can use on another website by invoking javascript that reads data from my server and shows that statistics for a given user, but I am having a hard time finding specific tutorials that covers this in django. I have seen the link at Alex Maradon's site [0], but it looks to me like that is passing html back to the widget and I am having a hard time figuring out how to do this using something like xml. Are there any django apps for doing this or does anyone know of good how-tos? [0] http://alexmarandon.com/articles/web_widget_jquery/

    Read the article

  • How to separate comma separeted data from csv file?

    - by Rahul
    I have opened a csv file and I want to sort each string which is comma separeted and are in same line: ex:: file : name,sal,dept tom,10000,it o/p :: each string in string variable I have a file which is already open, so I can not use "open" API, I have to use "csv.reader" which have to read one line at a time.

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Parsing html for domain links

    - by Hallik
    I have a script that parses an html page for all the links within it. I am getting all of them fine, but I have a list of domains I want to compare it against. So a sample list contains list=['www.domain.com', 'sub.domain.com'] But I may have a list of links that look like http://domain.com http://sub.domain.com/some/other/page I can strip off the http:// just fine, but in the two example links I just posted, they both should match. The first I would like to match against the www.domain.com, and the second, I would like to match against the subdomain in the list. Right now I am using url2lib for parsing the html. What are my options in completely this task?

    Read the article

  • Efficiently generate a 16-character, alphanumeric string

    - by ensnare
    I'm looking for a very quick way to generate an alphanumeric unique id for a primary key in a table. Would something like this work? def genKey(): hash = hashlib.md5(RANDOM_NUMBER).digest().encode("base64") alnum_hash = re.sub(r'[^a-zA-Z0-9]', "", hash) return alnum_hash[:16] What would be a good way to generate random numbers? If I base it on microtime, I have to account for the possibility of several calls of genKey() at the same time from different instances. Or is there a better way to do all this? Thanks.

    Read the article

  • Numpy Matrix keeps giving me an Error,

    - by uberjumper
    Okay this is werid, i keep getting the error, randomly. ValueError: matrix must be 2-dimensional So i tracked it down, and cornered it to basically something like this: a_list = [[(1,100) for _ in range(32)] for _ in range(32)] numpy.matrix(a_list) Whats wrong with this? If i print a_list it is clearly a 2d matrix of tuples, however numpy does not believe so.

    Read the article

  • In plain English, what are Django generic views?

    - by allyourcode
    The first two paragraphs of this page explain that generic views are supposed to make my life easier, less monotonous, and make me more attractive to women (I made up that last one): http://docs.djangoproject.com/en/dev/topics/generic-views/#topics-generic-views I'm all for improving my life, but what do generic views actually do? It seems like lots of buzzwords are being thrown around, which confuse more than they explain. Are generic views similar to scaffolding in Ruby on Rails? The last bullet point in the intro seems to indicate this. Is that an accurate statement?

    Read the article

  • Creating a Group of Groups in Django

    - by Greg
    I'm creating my own Group model; I'm not referring to the builtin Group model. I want each hroup to be a member of another group (it's parent), but there is the one "top" group that doesn't have a parent group. The admin interface won't let me create a group without entering a parent. I get the error personnel_group.parent_id may not be NULL. My Group model looks like this: class Group(models.Model): name = models.CharField(max_length=50) parent = models.ForeignKey('self', blank=True, null=True) order = models.IntegerField() icon = models.ImageField(upload_to='groups', blank=True, null=True) description = models.TextField(blank=True, null=True) How can I accomplish this? Thanks.

    Read the article

  • need help in site classification

    - by goh
    hi guys, I have to crawl the contents of several blogs. The problem is that I need to classify whether the blogs the authors are from a specific school and is talking about the school's stuff. May i know what's the best approach in doing the crawling or how should i go about the classification?

    Read the article

  • SQLAlchemy Expression Language problem

    - by Torkel
    I'm trying to convert this to something sqlalchemy expression language compatible, I don't know if it's possible out of box and are hoping someone more experienced can help me along. The backend is PostgreSQL and if I can't make it as an expression I'll create a string instead. SELECT DISTINCT date_trunc('month', x.x) as date, COALESCE(b.res1, 0) AS res1, COALESCE(b.res2, 0) AS res2 FROM generate_series( date_trunc('year', now() - interval '1 years'), date_trunc('year', now() + interval '1 years'), interval '1 months' ) AS x LEFT OUTER JOIN( SELECT date_trunc('month', access_datetime) AS when, count(NULLIF(resource_id != 1, TRUE)) AS res1, count(NULLIF(resource_id != 2, TRUE)) AS res2 FROM tracking_entries GROUP BY date_trunc('month', access_datetime) ) AS b ON (date_trunc('month', x.x) = b.when) First of all I got a class TrackingEntry mapped to tracking_entries, the select statement within the outer joined can be converted to something like (pseudocode):: from sqlalchemy.sql import func, select from datetime import datetime, timedelta stmt = select([ func.date_trunc('month', TrackingEntry.resource_id).label('when'), func.count(func.nullif(TrackingEntry.resource_id != 1, True)).label('res1'), func.count(func.nullif(TrackingEntry.resource_id != 2, True)).label('res2') ], group_by=[func.date_trunc('month', TrackingEntry.access_datetime), ]) Considering the outer select statement I have no idea how to build it, my guess is something like: outer = select([ func.distinct(func.date_trunc('month', ?)).label('date'), func.coalesce(?.res1, 0).label('res1'), func.coalesce(?.res2, 0).label('res2') ], from_obj=[ func.generate_series( datetime.now(), datetime.now() + timedelta(days=365), timedelta(days=1) ).label(x) ]) Then I suppose I have to link those statements together without using foreign keys: outer.outerjoin(stmt???).??(func.date_trunc('month', ?.?), ?.when) Anyone got any suggestions or even better a solution?

    Read the article

  • Why is django.test.client.Client not keeping me logged in.

    - by Mystic
    I'm using django.test.client.Client to test whether some text shows up when a user is logged in. However, I the Client object doesn't seem to be keeping me logged in. This test passes if done manually with Firefox but not when done with the Client object. class Test(TestCase): def test_view(self): user.set_password(password) user.save() client = self.client # I thought a more manual way would work, but no luck # client.post('/login', {'username':user.username, 'password':password}) login_successful = client.login(username=user.username, password=password) # this assert passes self.assertTrue(login_successful) response = client.get("/path", follow=True) #whether follow=True or not doesn't seem to work self.assertContains(response, "needle" ) When I print response it returns the login form that is hidden by: {% if not request.user.is_authenticated %} ... form ... {% endif %} This is confirmed when I run ipython manage.py shell. The problem seems to be that the Client object is not keeping the session authenticated.

    Read the article

  • How do I relate two models/tables in Django based on non primary non unique keys?

    - by wizard
    I've got two tables that I need to relate on a single field po_num. The data is imported from another source so while I have a little bit of control over what the tables look like but I can't change them too much. What I want to do is relate these two models so I can look up one from the other based on the po_num fields. What I really need to do is join the two tables so I can do a where on a count of the related table. I would like to do filter for all Order objects that have 0 related EDI856 objects. I tried adding a foreign key to the Order model and specified the db_column and to_fields as po_num but django didn't like that the fact that Edi856.po_num wasn't unique. Here are the important fields of my current models that let me display but not filter for the data that I want. class Edi856(models.Model): po_num = models.CharField(max_length=90, db_index=True ) class Order(models.Model): po_num = models.CharField(max_length=90, db_index=True) def in_edi(self): '''Has the edi been processed?''' return Edi856.objects.filter(po_num = self.po_num).count() Thanks for taking the time to read about my problem. I'm not sure what to do from here.

    Read the article

  • Distance between numpy arrays, columnwise

    - by Jaapsneep
    I have 2 arrays in 2D, where the column vectors are feature vectors. One array is of size F x A, the other of F x B, where A << B. As an example, for A = 2 and F = 3 (B can be anything): arr1 = np.array( [[1, 4], [2, 5], [3, 6]] ) arr2 = np.array( [[1, 4, 7, 10, ..], [2, 5, 8, 11, ..], [3, 6, 9, 12, ..]] ) I want to calculate the distance between arr1 and a fragment of arr2 that is of equal size (in this case, 3x2), for each possible fragment of arr2. The column vectors are independent of each other, so I believe I should calculate the distance between each column vector in arr1 and a collection of column vectors ranging from i to i + A from arr2 and take the sum of these distances (not sure though). Does numpy offer an efficient way of doing this, or will I have to take slices from the second array and, using another loop, calculate the distance between each column vector in arr1 and the corresponding column vector in the slice?

    Read the article

  • Trie Backtracking in Recursion

    - by Darksky
    I am building a tree for a spell checker with suggestions. Each node contains a key (a letter) and a value (array of letters down that path). So assume the following sub-trie in my big trie: W / \ a e | | k k | | is word--> e e | ... This is just a subpath of a sub-trie. W is a node and a and e are two nodes in its value array etc... At each node, I check if the next letter in the word is a value of the node. I am trying to support mistyped vowels for now. So 'weke' will yield 'wake' as a suggestion. Here's my searchWord function in my trie: def searchWord(self, word, path=""): if len(word) > 0: key = word[0] word = word[1:] if self.values.has_key(key): path = path + key nextNode = self.values[key] return nextNode.searchWord(word, path) else: # check here if key is a vowel. If it is, check for other vowel substitutes else: if self.isWord: return path # this is the word found else: return None Given 'weke', at the end when word is of length zero and path is 'weke', my code will hit the second big else block. weke is not marked as a word and so it will return with None. This will return out of searchWord with None. To avoid this, at each stack unwind or recursion backtrack, I need to check if a letter is a vowel and if it is, do the checking again. I changed the if self.values.has_key(key) loop to the following: if self.values.has_key(key): path = path + key nextNode = self.values[key] ret = nextNode.searchWord(word, path) if ret == None: # check if key == vowel and replace path # return nextNode.searchWord(... return ret What am I doing wrong here? What can I do when backtracking to achieve what I'm trying to do?

    Read the article

< Previous Page | 374 375 376 377 378 379 380 381 382 383 384 385  | Next Page >