Search Results

Search found 13683 results on 548 pages for 'python sphinx'.

Page 378/548 | < Previous Page | 374 375 376 377 378 379 380 381 382 383 384 385  | Next Page >

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Right way to return proxy model instance from a base model instance in Django ?

    - by sotangochips
    Say I have models: class Animal(models.Model): type = models.CharField(max_length=255) class Dog(Animal): def make_sound(self): print "Woof!" class Meta: proxy = True class Cat(Animal): def make_sound(self): print "Meow!" class Meta: proxy = True Let's say I want to do: animals = Animal.objects.all() for animal in animals: animal.make_sound() I want to get back a series of Woofs and Meows. Clearly, I could just define a make_sound in the original model that forks based on animal_type, but then every time I add a new animal type (imagine they're in different apps), I'd have to go in and edit that make_sound function. I'd rather just define proxy models and have them define the behavior themselves. From what I can tell, there's no way of returning mixed Cat or Dog instances, but I figured maybe I could define a "get_proxy_model" method on the main class that returns a cat or a dog model. Surely you could do this, and pass something like the primary key and then just do Cat.objects.get(pk = passed_in_primary_key). But that'd mean doing an extra query for data you already have which seems redundant. Is there any way to turn an animal into a cat or a dog instance in an efficient way? What's the right way to do what I want to achieve?

    Read the article

  • Non standard interaction among two tables to avoid very large merge

    - by riko
    Suppose I have two tables A and B. Table A has a multi-level index (a, b) and one column (ts). b determines univocally ts. A = pd.DataFrame( [('a', 'x', 4), ('a', 'y', 6), ('a', 'z', 5), ('b', 'x', 4), ('b', 'z', 5), ('c', 'y', 6)], columns=['a', 'b', 'ts']).set_index(['a', 'b']) AA = A.reset_index() Table B is another one-column (ts) table with non-unique index (a). The ts's are sorted "inside" each group, i.e., B.ix[x] is sorted for each x. Moreover, there is always a value in B.ix[x] that is greater than or equal to the values in A. B = pd.DataFrame( dict(a=list('aaaaabbcccccc'), ts=[1, 2, 4, 5, 7, 7, 8, 1, 2, 4, 5, 8, 9])).set_index('a') The semantics in this is that B contains observations of occurrences of an event of type indicated by the index. I would like to find from B the timestamp of the first occurrence of each event type after the timestamp specified in A for each value of b. In other words, I would like to get a table with the same shape of A, that instead of ts contains the "minimum value occurring after ts" as specified by table B. So, my goal would be: C: ('a', 'x') 4 ('a', 'y') 7 ('a', 'z') 5 ('b', 'x') 7 ('b', 'z') 7 ('c', 'y') 8 I have some working code, but is terribly slow. C = AA.apply(lambda row: ( row[0], row[1], B.ix[row[0]].irow(np.searchsorted(B.ts[row[0]], row[2]))), axis=1).set_index(['a', 'b']) Profiling shows the culprit is obviously B.ix[row[0]].irow(np.searchsorted(B.ts[row[0]], row[2]))). However, standard solutions using merge/join would take too much RAM in the long run. Consider that now I have 1000 a's, assume constant the average number of b's per a (probably 100-200), and consider that the number of observations per a is probably in the order of 300. In production I will have 1000 more a's. 1,000,000 x 200 x 300 = 60,000,000,000 rows may be a bit too much to keep in RAM, especially considering that the data I need is perfectly described by a C like the one I discussed above. How would I improve the performance?

    Read the article

  • SQLAlchemy: who is in charge of the "session"? ( and how to unit-test with sessions )

    - by Nick Perkins
    I need some guidance on how to use session objects with SQLAlchemy, and how to organize Unit Tests of my mapped objects. What I would like to able to do is something like this: thing = BigThing() # mapped object child = thing.new_child() # create and return a related object thing.save() # will also save the child object In order to achieve this, I was thinking of having the BigThing actually add itself ( and it's children ) to the database -- but maybe this not a good idea? One reason to add objects as soon as possible is Automatic id values that are assigned by the database -- the sooner they are available, the fewer problems there are ( right? ) What is the best way to manage session objects? Who is in charge of the session? Should it be created only when required? or saved for a long time? What about Unit Tests for my mapped objects?...how should the session be handled? Is it ever OK to have mapped objects just automatically add themselves to a database? or is that going to lead to trouble?

    Read the article

  • Making all variables accessible to namespace

    - by Gökhan Sever
    Hello, Say I have a simple function: def myfunc(): a = 4.2 b = 5.5 ... many similar variables ... I use this function one time only and I am wondering what is the easiest way to make all the variables inside the function accessible to my main name-space. Do I have to declare global for each item? or any other suggested methods? Thanks.

    Read the article

  • Extend argparse to write set names in the help text for optional argument choices and define those sets once at the end

    - by Kent
    Example of the problem If I have a list of valid option strings which is shared between several arguments, the list is written in multiple places in the help string. Making it harder to read: def main(): elements = ['a', 'b', 'c', 'd', 'e', 'f'] parser = argparse.ArgumentParser() parser.add_argument( '-i', nargs='*', choices=elements, default=elements, help='Space separated list of case sensitive element names.') parser.add_argument( '-e', nargs='*', choices=elements, default=[], help='Space separated list of case sensitive element names to ' 'exclude from processing') parser.parse_args() When running the above function with the command line argument --help it shows: usage: arguments.py [-h] [-i [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]]] [-e [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]]] optional arguments: -h, --help show this help message and exit -i [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]] Space separated list of case sensitive element names. -e [{a,b,c,d,e,f} [{a,b,c,d,e,f} ...]] Space separated list of case sensitive element names to exclude from processing What would be nice It would be nice if one could define an option list name, and in the help output write the option list name in multiple places and define it last of all. In theory it would work like this: def main_optionlist(): elements = ['a', 'b', 'c', 'd', 'e', 'f'] # Two instances of OptionList are equal if and only if they # have the same name (ALFA in this case) ol = OptionList('ALFA', elements) parser = argparse.ArgumentParser() parser.add_argument( '-i', nargs='*', choices=ol, default=ol, help='Space separated list of case sensitive element names.') parser.add_argument( '-e', nargs='*', choices=ol, default=[], help='Space separated list of case sensitive element names to ' 'exclude from processing') parser.parse_args() And when running the above function with the command line argument --help it would show something similar to: usage: arguments.py [-h] [-i [ALFA [ALFA ...]]] [-e [ALFA [ALFA ...]]] optional arguments: -h, --help show this help message and exit -i [ALFA [ALFA ...]] Space separated list of case sensitive element names. -e [ALFA [ALFA ...]] Space separated list of case sensitive element names to exclude from processing sets in optional arguments: ALFA {a,b,c,d,e,f} Question I need to: Replace the {'l', 'i', 's', 't', 's'} shown with the option name, in the optional arguments. At the end of the help text show a section explaining which elements each option name consists of. So I ask: Is this possible using argparse? Which classes would I have to inherit from and which methods would I need to override? I have tried looking at the source for argparse, but as this modification feels pretty advanced I don´t know how to get going.

    Read the article

  • Does urllib2.urlopen() actually fetch the page?

    - by beagleguy
    hi all, I was condering when I use urllib2.urlopen() does it just to header reads or does it actually bring back the entire webpage? IE does the HTML page actually get fetch on the urlopen call or the read() call? handle = urllib2.urlopen(url) html = handle.read() The reason I ask is for this workflow... I have a list of urls (some of them with short url services) I only want to read the webpage if I haven't seen that url before I need to call urlopen() and use geturl() to get the final page that link goes to (after the 302 redirects) so I know if I've crawled it yet or not. I don't want to incur the overhead of having to grab the html if I've already parsed that page. thanks!

    Read the article

  • Parsing html for domain links

    - by Hallik
    I have a script that parses an html page for all the links within it. I am getting all of them fine, but I have a list of domains I want to compare it against. So a sample list contains list=['www.domain.com', 'sub.domain.com'] But I may have a list of links that look like http://domain.com http://sub.domain.com/some/other/page I can strip off the http:// just fine, but in the two example links I just posted, they both should match. The first I would like to match against the www.domain.com, and the second, I would like to match against the subdomain in the list. Right now I am using url2lib for parsing the html. What are my options in completely this task?

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Setting up repoze.who with make_redirecting_plugin

    - by Timmy
    my file is: [plugin:form] use = repoze.who.plugins.form:make_redirecting_plugin login_form_url = /account/signin login_handler_path = /account/login logout_handler_path = /account/logout [identifiers] plugins = form;browser auth_tkt i created a form on /account/signin, but it doesnt find the identity? what has to be on the form?

    Read the article

  • beautifulsoup can't find exist href in file

    - by young001
    I have a html file like following: <form action="/2811457/follow?gsid=3_5bce9b871484d3af90c89f37" method="post"> <div> <a href="/2811457/follow?page=2&amp;gsid=3_5bce9b871484d3af90c89f37">next_page</a> &nbsp;<input name="mp" type="hidden" value="3" /> <input type="text" name="page" size="2" style='-wap-input-format: "*N"' /> <input type="submit" value="jump" />&nbsp;1/3 </div> </form> how to extract the "1/3" from the file? It is a part of html,I intend to make it clear. When I use beautifulsoup, I'm new to beautifulsoup,and I have look the document,but still confused. how to extract"1/3" from the html file? total_urls_num = soup.find(re.compile('.*/d\//d.*')) doesn't work As JBernardo said,\d should be a number,When I change to .*\d/\d.*,it doesn't work too. my code: from BeautifulSoup import BeautifulSoup import re with open("html.txt","r") as f: response = f.read() print response soup = BeautifulSoup(response) delete_urls = soup.findAll('a', href=re.compile('follow\?page')) #works print delete_urls #total_urls_num = soup.find(re.compile('.*\d/\d.*')) total_urls_num = soup.find('input',style='submit') #can't work print total_urls_num

    Read the article

  • has any tools easy to download or uploaed data from gae ..

    - by zjm1126
    i find this: http://aralbalkan.com/1784 but it is : Gaebar is an easy-to-use, standalone Django application that you can plug in to your existing Google App Engine Django or app-engine-patch-based Django applications on Google App Engine to give them datastore backup and restore functionality. my app is not based on django,so did you know any tools esay to do this . thanks

    Read the article

  • Trie Backtracking in Recursion

    - by Darksky
    I am building a tree for a spell checker with suggestions. Each node contains a key (a letter) and a value (array of letters down that path). So assume the following sub-trie in my big trie: W / \ a e | | k k | | is word--> e e | ... This is just a subpath of a sub-trie. W is a node and a and e are two nodes in its value array etc... At each node, I check if the next letter in the word is a value of the node. I am trying to support mistyped vowels for now. So 'weke' will yield 'wake' as a suggestion. Here's my searchWord function in my trie: def searchWord(self, word, path=""): if len(word) > 0: key = word[0] word = word[1:] if self.values.has_key(key): path = path + key nextNode = self.values[key] return nextNode.searchWord(word, path) else: # check here if key is a vowel. If it is, check for other vowel substitutes else: if self.isWord: return path # this is the word found else: return None Given 'weke', at the end when word is of length zero and path is 'weke', my code will hit the second big else block. weke is not marked as a word and so it will return with None. This will return out of searchWord with None. To avoid this, at each stack unwind or recursion backtrack, I need to check if a letter is a vowel and if it is, do the checking again. I changed the if self.values.has_key(key) loop to the following: if self.values.has_key(key): path = path + key nextNode = self.values[key] ret = nextNode.searchWord(word, path) if ret == None: # check if key == vowel and replace path # return nextNode.searchWord(... return ret What am I doing wrong here? What can I do when backtracking to achieve what I'm trying to do?

    Read the article

  • Efficiently generate a 16-character, alphanumeric string

    - by ensnare
    I'm looking for a very quick way to generate an alphanumeric unique id for a primary key in a table. Would something like this work? def genKey(): hash = hashlib.md5(RANDOM_NUMBER).digest().encode("base64") alnum_hash = re.sub(r'[^a-zA-Z0-9]', "", hash) return alnum_hash[:16] What would be a good way to generate random numbers? If I base it on microtime, I have to account for the possibility of several calls of genKey() at the same time from different instances. Or is there a better way to do all this? Thanks.

    Read the article

  • How to give points for each indices of list

    - by Eric Jung
    def voting_borda(rank_ballots): '''(list of list of str) -> tuple of (str, list of int) The parameter is a list of 4-element lists that represent rank ballots for a single riding. The Borda Count is determined by assigning points according to ranking. A party gets 3 points for each first-choice ranking, 2 points for each second-choice ranking and 1 point for each third-choice ranking. (No points are awarded for being ranked fourth.) For example, the rank ballot shown above would contribute 3 points to the Liberal count, 2 points to the Green count and 1 point to the CPC count. The party that receives the most points wins the seat. Return a tuple where the first element is the name of the winning party according to Borda Count and the second element is a four-element list that contains the total number of points for each party. The order of the list elements corresponds to the order of the parties in PARTY_INDICES.''' #>>> voting_borda([['GREEN','NDP', 'LIBERAL', 'CPC'], ['GREEN','CPC','LIBERAL','NDP'], ['LIBERAL','NDP', 'CPC', 'GREEN']]) #('GREEN',[4, 6, 5, 3]) list_of_party_order = [] for sublist in rank_ballots: for party in sublist[0]: if party == 'GREEN': GREEN_COUNT += 3 elif party == 'NDP': NDP_COUNT += 3 elif party == 'LIBERAL': LIBERAL_COUNT += 3 elif party == 'CPC': CPC_COUNT += 3 for party in sublist[1]: if party == 'GREEN': GREEN_COUNT += 2 elif party == 'NDP': NDP_COUNT += 2 elif party == 'LIBERAL': LIBERAL_COUNT += 2 elif party == 'CPC': CPC_COUNT += 2 for party in sublist[2]: if party == 'GREEN': GREEN_COUNT += 1 elif party == 'NDP': NDP_COUNT += 1 elif party == 'LIBERAL': LIBERAL_COUNT += 1 elif party == 'CPC': CPC_COUNT += 1 I don't know how I would give points for each indices of the list MORE SIMPLY. Can someone please help me? Without being too complicated. Thank you!

    Read the article

  • Creating a Group of Groups in Django

    - by Greg
    I'm creating my own Group model; I'm not referring to the builtin Group model. I want each hroup to be a member of another group (it's parent), but there is the one "top" group that doesn't have a parent group. The admin interface won't let me create a group without entering a parent. I get the error personnel_group.parent_id may not be NULL. My Group model looks like this: class Group(models.Model): name = models.CharField(max_length=50) parent = models.ForeignKey('self', blank=True, null=True) order = models.IntegerField() icon = models.ImageField(upload_to='groups', blank=True, null=True) description = models.TextField(blank=True, null=True) How can I accomplish this? Thanks.

    Read the article

  • need help in site classification

    - by goh
    hi guys, I have to crawl the contents of several blogs. The problem is that I need to classify whether the blogs the authors are from a specific school and is talking about the school's stuff. May i know what's the best approach in doing the crawling or how should i go about the classification?

    Read the article

  • Accessing CSR extension stack in M2Crypto

    - by Charles Duffy
    Howdy! I have a certificate signing request with an extension stack added. When building a certificate based on this request, I would like to be able to access that stack to use in creating the final certificate. However, while M2Crypto.X509.X509 has a number of helpers for accessing extensions (get_ext, get_ext_at and the like), M2Crypto.X509.Request appears to provide only a member for adding extensions, but no way to inspect the extensions already associated with a given object. Am I missing something here?

    Read the article

  • How do I relate two models/tables in Django based on non primary non unique keys?

    - by wizard
    I've got two tables that I need to relate on a single field po_num. The data is imported from another source so while I have a little bit of control over what the tables look like but I can't change them too much. What I want to do is relate these two models so I can look up one from the other based on the po_num fields. What I really need to do is join the two tables so I can do a where on a count of the related table. I would like to do filter for all Order objects that have 0 related EDI856 objects. I tried adding a foreign key to the Order model and specified the db_column and to_fields as po_num but django didn't like that the fact that Edi856.po_num wasn't unique. Here are the important fields of my current models that let me display but not filter for the data that I want. class Edi856(models.Model): po_num = models.CharField(max_length=90, db_index=True ) class Order(models.Model): po_num = models.CharField(max_length=90, db_index=True) def in_edi(self): '''Has the edi been processed?''' return Edi856.objects.filter(po_num = self.po_num).count() Thanks for taking the time to read about my problem. I'm not sure what to do from here.

    Read the article

  • Search for a String and replace it with a variable

    - by chrissygormley
    Hello, I am trying to use regular expression to search a document fo a UUID number and replace the end of it with a new number. The code I have so far is: read_file = open('test.txt', 'r+') write_file = open('test.txt', 'w') r = re.compile(r'(self.uid\s*=\s*5EFF837F-EFC2-4c32-A3D4\s*)(\S+)') for l in read_file: m1 = r.match(l) if m1: new=(str,m1.group(2)) new?????? This where I get stuck. The file test.txt has the below UUID stored in it: self.uid = '5EFF837F-EFC2-4c32-A3D4-D15C7F9E1F22' I want to replace the part D15C7F9E1F22. I have also tried this: r = re.compile(r'(self.uid\s*=\s*)(\S+)') for l in fp: m1 = r.match(l) new=map(int,m1.group(2).split("-") new[4]='RHUI5345JO' But I cannot seem to match the string. Thanks in advance for any help.

    Read the article

  • How to display multiple images?

    - by misterwebz
    I'm trying to get multiple image paths from my database in order to display them, but it currently doesn't work. Here's what i'm using: def get_image(self, userid, id): image = meta.Session.query(Image).filter_by(userid=userid) permanent_file = open(image[id].image_path, 'rb') if not os.path.exists(image.image_path): return 'No such file' data = permanent_file.read() permanent_file.close() response.content_type = guess_type(image.image_path)[0] or 'text/plain' return data I'm getting an error regarding this part: image[id].image_path What i want is for Pylons to display several jpg files on 1 page. Any idea how i could achieve this?

    Read the article

  • Find next lower item in a sorted list

    - by Sebastian
    Hey guys, let's say I have a sorted list of Floats. Now I'd like to get the index of the next lower item of a given value. The usual for-loop aprroach has a complexity of O(n). Since the list is sorted there must be a way to get the index with O(log n). My O(n) approach: index=0 for i,value in enumerate(mylist): if value>compareValue: index=i-1 Is there a datatype for solving that problem in O(log n)? best regards Sebastian

    Read the article

< Previous Page | 374 375 376 377 378 379 380 381 382 383 384 385  | Next Page >