Search Results

Search found 13683 results on 548 pages for 'python sphinx'.

Page 378/548 | < Previous Page | 374 375 376 377 378 379 380 381 382 383 384 385  | Next Page >

  • how can i set the key 'blob-key' about BlobStore?

    - by pyleaf
    I use the jquery plugin "uploadify" to upload multiple files to My App(GAE), and then save them with blobstore, but it failed. I debug the code into get_uploads, it seems field.type_options is empty and of course has 'blob-key'. Q: where does the key 'blob-key' come from? thank you!

    Read the article

  • In SqlAlchemy, how to ignore m2m relationship attributes when merge?

    - by ablmf
    There is a m2m relation in my models, User and Role. I want to merge a role, but i DO NOT want this merge has any effect on user and role relation-ship. Unfortunately, for some complicate reason, role.users if not empty. I tried to set role.users = None, but SA complains None is not a list. At this moment, I use sqlalchemy.orm.attributes.del_attribute, but I don't know if it's provided for this purpose.

    Read the article

  • Right way to return proxy model instance from a base model instance in Django ?

    - by sotangochips
    Say I have models: class Animal(models.Model): type = models.CharField(max_length=255) class Dog(Animal): def make_sound(self): print "Woof!" class Meta: proxy = True class Cat(Animal): def make_sound(self): print "Meow!" class Meta: proxy = True Let's say I want to do: animals = Animal.objects.all() for animal in animals: animal.make_sound() I want to get back a series of Woofs and Meows. Clearly, I could just define a make_sound in the original model that forks based on animal_type, but then every time I add a new animal type (imagine they're in different apps), I'd have to go in and edit that make_sound function. I'd rather just define proxy models and have them define the behavior themselves. From what I can tell, there's no way of returning mixed Cat or Dog instances, but I figured maybe I could define a "get_proxy_model" method on the main class that returns a cat or a dog model. Surely you could do this, and pass something like the primary key and then just do Cat.objects.get(pk = passed_in_primary_key). But that'd mean doing an extra query for data you already have which seems redundant. Is there any way to turn an animal into a cat or a dog instance in an efficient way? What's the right way to do what I want to achieve?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • has any tools easy to download or uploaed data from gae ..

    - by zjm1126
    i find this: http://aralbalkan.com/1784 but it is : Gaebar is an easy-to-use, standalone Django application that you can plug in to your existing Google App Engine Django or app-engine-patch-based Django applications on Google App Engine to give them datastore backup and restore functionality. my app is not based on django,so did you know any tools esay to do this . thanks

    Read the article

  • Creating a custom widget using django for use on external sites

    - by ajt
    I have a new site that I am putting together and part of it has statistics for the site's users. I would like to create a widget that others can use on another website by invoking javascript that reads data from my server and shows that statistics for a given user, but I am having a hard time finding specific tutorials that covers this in django. I have seen the link at Alex Maradon's site [0], but it looks to me like that is passing html back to the widget and I am having a hard time figuring out how to do this using something like xml. Are there any django apps for doing this or does anyone know of good how-tos? [0] http://alexmarandon.com/articles/web_widget_jquery/

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • How to separate comma separeted data from csv file?

    - by Rahul
    I have opened a csv file and I want to sort each string which is comma separeted and are in same line: ex:: file : name,sal,dept tom,10000,it o/p :: each string in string variable I have a file which is already open, so I can not use "open" API, I have to use "csv.reader" which have to read one line at a time.

    Read the article

  • beautifulsoup can't find exist href in file

    - by young001
    I have a html file like following: <form action="/2811457/follow?gsid=3_5bce9b871484d3af90c89f37" method="post"> <div> <a href="/2811457/follow?page=2&amp;gsid=3_5bce9b871484d3af90c89f37">next_page</a> &nbsp;<input name="mp" type="hidden" value="3" /> <input type="text" name="page" size="2" style='-wap-input-format: "*N"' /> <input type="submit" value="jump" />&nbsp;1/3 </div> </form> how to extract the "1/3" from the file? It is a part of html,I intend to make it clear. When I use beautifulsoup, I'm new to beautifulsoup,and I have look the document,but still confused. how to extract"1/3" from the html file? total_urls_num = soup.find(re.compile('.*/d\//d.*')) doesn't work As JBernardo said,\d should be a number,When I change to .*\d/\d.*,it doesn't work too. my code: from BeautifulSoup import BeautifulSoup import re with open("html.txt","r") as f: response = f.read() print response soup = BeautifulSoup(response) delete_urls = soup.findAll('a', href=re.compile('follow\?page')) #works print delete_urls #total_urls_num = soup.find(re.compile('.*\d/\d.*')) total_urls_num = soup.find('input',style='submit') #can't work print total_urls_num

    Read the article

  • Does urllib2.urlopen() actually fetch the page?

    - by beagleguy
    hi all, I was condering when I use urllib2.urlopen() does it just to header reads or does it actually bring back the entire webpage? IE does the HTML page actually get fetch on the urlopen call or the read() call? handle = urllib2.urlopen(url) html = handle.read() The reason I ask is for this workflow... I have a list of urls (some of them with short url services) I only want to read the webpage if I haven't seen that url before I need to call urlopen() and use geturl() to get the final page that link goes to (after the 302 redirects) so I know if I've crawled it yet or not. I don't want to incur the overhead of having to grab the html if I've already parsed that page. thanks!

    Read the article

  • How different protocols interact with eachother in Twisted

    - by stsupermouse
    The scenario I want two different protocols interact with each other is as below: A and B is two different protocols. First A will interact with the server and retrieve some values. Only after A finishes retrieving the values , B will start to interact with the server. Now my problem is that is there an elegant way to initial B when A retrieves the values. Currently I just initial B in A's data process function. But i don't think that this is an elegant way. What I mean an elegant way is that the initialization of B is done by a flow controller or something like that, but not another protocol. Is there an elegant way? such using defered or any other things. I'm just new to twisted, not knowing very much about defered.... Thank you very much!

    Read the article

  • sqlite3 'database is locked' won't go away with retries

    - by Azarias
    I have a sqlite3 database that is accessed by a few threads (3-4). I am aware of the general limitations of sqlite3 with regards to concurrency as stated http://www.sqlite.org/faq.html#q6 , but I am convinced that is not the problem. All of the threads both read and write from this database. Whenever I do a write, I have the following construct: try: Cursor.execute(q, params) Connection.commit() except sqlite3.IntegrityError: Notify except sqlite3.OperationalError: print sys.exc_info() print("DATABASE LOCKED; sleeping for 3 seconds and trying again") time.sleep(3) Retry On some runs, I won't even hit this block, but when I do, it never comes out of it (keeps retrying, but I keep getting the 'database is locked' error from exc_info. If I understand the reader/writer lock usage correctly, some amount of waiting should help with the contention. What this sounds like is deadlock, but I do not use any transactions in my code, and every SELECT or INSERT is simply a one off. Some threads, however, keep the same connection when they do their operation (which includes a mix of SELECTS and INSERTS and other modifiers). I would appericiate it if you could shade a light on this, and also ways around fixing it (besides using a different database engine.)

    Read the article

  • Efficiently generate a 16-character, alphanumeric string

    - by ensnare
    I'm looking for a very quick way to generate an alphanumeric unique id for a primary key in a table. Would something like this work? def genKey(): hash = hashlib.md5(RANDOM_NUMBER).digest().encode("base64") alnum_hash = re.sub(r'[^a-zA-Z0-9]', "", hash) return alnum_hash[:16] What would be a good way to generate random numbers? If I base it on microtime, I have to account for the possibility of several calls of genKey() at the same time from different instances. Or is there a better way to do all this? Thanks.

    Read the article

  • Numpy Matrix keeps giving me an Error,

    - by uberjumper
    Okay this is werid, i keep getting the error, randomly. ValueError: matrix must be 2-dimensional So i tracked it down, and cornered it to basically something like this: a_list = [[(1,100) for _ in range(32)] for _ in range(32)] numpy.matrix(a_list) Whats wrong with this? If i print a_list it is clearly a 2d matrix of tuples, however numpy does not believe so.

    Read the article

  • Parsing html for domain links

    - by Hallik
    I have a script that parses an html page for all the links within it. I am getting all of them fine, but I have a list of domains I want to compare it against. So a sample list contains list=['www.domain.com', 'sub.domain.com'] But I may have a list of links that look like http://domain.com http://sub.domain.com/some/other/page I can strip off the http:// just fine, but in the two example links I just posted, they both should match. The first I would like to match against the www.domain.com, and the second, I would like to match against the subdomain in the list. Right now I am using url2lib for parsing the html. What are my options in completely this task?

    Read the article

  • In plain English, what are Django generic views?

    - by allyourcode
    The first two paragraphs of this page explain that generic views are supposed to make my life easier, less monotonous, and make me more attractive to women (I made up that last one): http://docs.djangoproject.com/en/dev/topics/generic-views/#topics-generic-views I'm all for improving my life, but what do generic views actually do? It seems like lots of buzzwords are being thrown around, which confuse more than they explain. Are generic views similar to scaffolding in Ruby on Rails? The last bullet point in the intro seems to indicate this. Is that an accurate statement?

    Read the article

  • Why is django.test.client.Client not keeping me logged in.

    - by Mystic
    I'm using django.test.client.Client to test whether some text shows up when a user is logged in. However, I the Client object doesn't seem to be keeping me logged in. This test passes if done manually with Firefox but not when done with the Client object. class Test(TestCase): def test_view(self): user.set_password(password) user.save() client = self.client # I thought a more manual way would work, but no luck # client.post('/login', {'username':user.username, 'password':password}) login_successful = client.login(username=user.username, password=password) # this assert passes self.assertTrue(login_successful) response = client.get("/path", follow=True) #whether follow=True or not doesn't seem to work self.assertContains(response, "needle" ) When I print response it returns the login form that is hidden by: {% if not request.user.is_authenticated %} ... form ... {% endif %} This is confirmed when I run ipython manage.py shell. The problem seems to be that the Client object is not keeping the session authenticated.

    Read the article

  • How do I relate two models/tables in Django based on non primary non unique keys?

    - by wizard
    I've got two tables that I need to relate on a single field po_num. The data is imported from another source so while I have a little bit of control over what the tables look like but I can't change them too much. What I want to do is relate these two models so I can look up one from the other based on the po_num fields. What I really need to do is join the two tables so I can do a where on a count of the related table. I would like to do filter for all Order objects that have 0 related EDI856 objects. I tried adding a foreign key to the Order model and specified the db_column and to_fields as po_num but django didn't like that the fact that Edi856.po_num wasn't unique. Here are the important fields of my current models that let me display but not filter for the data that I want. class Edi856(models.Model): po_num = models.CharField(max_length=90, db_index=True ) class Order(models.Model): po_num = models.CharField(max_length=90, db_index=True) def in_edi(self): '''Has the edi been processed?''' return Edi856.objects.filter(po_num = self.po_num).count() Thanks for taking the time to read about my problem. I'm not sure what to do from here.

    Read the article

  • Creating a Group of Groups in Django

    - by Greg
    I'm creating my own Group model; I'm not referring to the builtin Group model. I want each hroup to be a member of another group (it's parent), but there is the one "top" group that doesn't have a parent group. The admin interface won't let me create a group without entering a parent. I get the error personnel_group.parent_id may not be NULL. My Group model looks like this: class Group(models.Model): name = models.CharField(max_length=50) parent = models.ForeignKey('self', blank=True, null=True) order = models.IntegerField() icon = models.ImageField(upload_to='groups', blank=True, null=True) description = models.TextField(blank=True, null=True) How can I accomplish this? Thanks.

    Read the article

  • need help in site classification

    - by goh
    hi guys, I have to crawl the contents of several blogs. The problem is that I need to classify whether the blogs the authors are from a specific school and is talking about the school's stuff. May i know what's the best approach in doing the crawling or how should i go about the classification?

    Read the article

  • SQLAlchemy Expression Language problem

    - by Torkel
    I'm trying to convert this to something sqlalchemy expression language compatible, I don't know if it's possible out of box and are hoping someone more experienced can help me along. The backend is PostgreSQL and if I can't make it as an expression I'll create a string instead. SELECT DISTINCT date_trunc('month', x.x) as date, COALESCE(b.res1, 0) AS res1, COALESCE(b.res2, 0) AS res2 FROM generate_series( date_trunc('year', now() - interval '1 years'), date_trunc('year', now() + interval '1 years'), interval '1 months' ) AS x LEFT OUTER JOIN( SELECT date_trunc('month', access_datetime) AS when, count(NULLIF(resource_id != 1, TRUE)) AS res1, count(NULLIF(resource_id != 2, TRUE)) AS res2 FROM tracking_entries GROUP BY date_trunc('month', access_datetime) ) AS b ON (date_trunc('month', x.x) = b.when) First of all I got a class TrackingEntry mapped to tracking_entries, the select statement within the outer joined can be converted to something like (pseudocode):: from sqlalchemy.sql import func, select from datetime import datetime, timedelta stmt = select([ func.date_trunc('month', TrackingEntry.resource_id).label('when'), func.count(func.nullif(TrackingEntry.resource_id != 1, True)).label('res1'), func.count(func.nullif(TrackingEntry.resource_id != 2, True)).label('res2') ], group_by=[func.date_trunc('month', TrackingEntry.access_datetime), ]) Considering the outer select statement I have no idea how to build it, my guess is something like: outer = select([ func.distinct(func.date_trunc('month', ?)).label('date'), func.coalesce(?.res1, 0).label('res1'), func.coalesce(?.res2, 0).label('res2') ], from_obj=[ func.generate_series( datetime.now(), datetime.now() + timedelta(days=365), timedelta(days=1) ).label(x) ]) Then I suppose I have to link those statements together without using foreign keys: outer.outerjoin(stmt???).??(func.date_trunc('month', ?.?), ?.when) Anyone got any suggestions or even better a solution?

    Read the article

  • Connecting slots and events in PyQt4 in a loop

    - by LukaD
    Im trying to build a calculator with PyQt4 and connecting the 'clicked()' signals from the buttons doesn't as expected. Im creating my buttons for the numbers inside a for loop where i try to connect them afterwards. def __init__(self): for i in range(0,10): self._numberButtons += [QPushButton(str(i), self)] self.connect(self._numberButtons[i], SIGNAL('clicked()'), lambda : self._number(i)) def _number(self, x): print(x) When I click on the buttons all of them print out '9'. Why is that so and how can i fix this?

    Read the article

  • Accessing CSR extension stack in M2Crypto

    - by Charles Duffy
    Howdy! I have a certificate signing request with an extension stack added. When building a certificate based on this request, I would like to be able to access that stack to use in creating the final certificate. However, while M2Crypto.X509.X509 has a number of helpers for accessing extensions (get_ext, get_ext_at and the like), M2Crypto.X509.Request appears to provide only a member for adding extensions, but no way to inspect the extensions already associated with a given object. Am I missing something here?

    Read the article

< Previous Page | 374 375 376 377 378 379 380 381 382 383 384 385  | Next Page >