Search Results

Search found 13683 results on 548 pages for 'python sphinx'.

Page 375/548 | < Previous Page | 371 372 373 374 375 376 377 378 379 380 381 382  | Next Page >

  • Is there a way to control how pytest-xdist runs tests in parallel?

    - by superselector
    I have the following directory layout: runner.py lib/ tests/ testsuite1/ testsuite1.py testsuite2/ testsuite2.py testsuite3/ testsuite3.py testsuite4/ testsuite4.py The format of testsuite*.py modules is as follows: import pytest class testsomething: def setup_class(self): ''' do some setup ''' # Do some setup stuff here def teardown_class(self): '''' do some teardown''' # Do some teardown stuff here def test1(self): # Do some test1 related stuff def test2(self): # Do some test2 related stuff .... .... .... def test40(self): # Do some test40 related stuff if __name__=='__main()__' pytest.main(args=[os.path.abspath(__file__)]) The problem I have is that I would like to execute the 'testsuites' in parallel i.e. I want testsuite1, testsuite2, testsuite3 and testsuite4 to start execution in parallel but individual tests within the testsuites need to be executed serially. When I use the 'xdist' plugin from py.test and kick off the tests using 'py.test -n 4', py.test is gathering all the tests and randomly load balancing the tests among 4 workers. This leads to the 'setup_class' method to be executed every time of each test within a 'testsuitex.py' module (which defeats my purpose. I want setup_class to be executed only once per class and tests executed serially there after). Essentially what I want the execution to look like is: worker1: executes all tests in testsuite1.py serially worker2: executes all tests in testsuite2.py serially worker3: executes all tests in testsuite3.py serially worker4: executes all tests in testsuite4.py serially while worker1, worker2, worker3 and worker4 are all executed in parallel. Is there a way to achieve this in 'pytest-xidst' framework? The only option that I can think of is to kick off different processes to execute each test suite individually within runner.py: def test_execute_func(testsuite_path): subprocess.process('py.test %s' % testsuite_path) if __name__=='__main__': #Gather all the testsuite names for each testsuite: multiprocessing.Process(test_execute_func,(testsuite_path,))

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Trying to output a list using class

    - by captain morgan
    Am trying to get the moving average of a price..but i keep getting an attribute error in my Moving_Average class. ('Moving_Average' object has no attribute 'days'). Here is what I have: class Moving_Average: def calculation(self, alist:list,days:int): m = self.days prices = alist[1::2] average = [0]* len(prices) signal = ['']* len(prices) for m in range(0,len(prices)-days+1): average[m+2] = sum(prices[m:m+days])/days if prices[m+2] < average[m+2]: signal[m+2]='SELL' elif prices[m+2] > average[m+2] and prices[m+1] < average[m+1]: signal[m+2]='BUY' else: signal[m+2] ='' return average,signal def print_report(symbol:str,strategy:str): print('SYMBOL: ', symbol) print('STRATEGY: ', strategy) print('Date Closing Strategy Signal') def user(): strategy = ''' Which of the following strategy would you like to use? * Simple Moving Average [S] * Directional Indicator[D] Please enter your choice: ''' if signal_strategy in 'Ss': days = input('Please enter the number of days for the average') days = int(days) strategy = 'Simple Moving Average {}-days'.format(str(days)) m = Moving_Average() ma = m.calculation(gg, days) print(ma) gg is an list that contains date and prices. [2013-10-01,60,2013-10-02,60] The output is supposed to look like: Date Price Average Signal 2013-10-01 60.0 2013-10-02 60.0 60.00 BUY

    Read the article

  • Is multi-level polymorphism possible in SQLAlchemy?

    - by Jace
    Is it possible to have multi-level polymorphism in SQLAlchemy? Here's an example: class Entity(Base): __tablename__ = 'entities' id = Column(Integer, primary_key=True) created_at = Column(DateTime, default=datetime.utcnow, nullable=False) entity_type = Column(Unicode(20), nullable=False) __mapper_args__ = {'polymorphic_on': entity_type} class File(Entity): __tablename__ = 'files' id = Column(None, ForeignKey('entities.id'), primary_key=True) filepath = Column(Unicode(255), nullable=False) file_type = Column(Unicode(20), nullable=False) __mapper_args__ = {'polymorphic_identity': u'file', 'polymorphic_on': file_type) class Image(File): __mapper_args__ = {'polymorphic_identity': u'image'} __tablename__ = 'images' id = Column(None, ForeignKey('files.id'), primary_key=True) width = Column(Integer) height = Column(Integer) When I call Base.metadata.create_all(), SQLAlchemy raises the following error: NotImplementedError: Can't generate DDL for the null type IntegrityError: (IntegrityError) entities.entity_type may not be NULL. This error goes away if I remove the Image model and the polymorphic_on key in File. What gives? (Edited: the exception raised was wrong.)

    Read the article

  • How to make Universal Feed Parser only parse feeds?

    - by piquadrat
    I'm trying to get content from external feeds on my Django web site with Universal Feed Parser. I want to have some user error handling, e.g. if the user supplies a URL that is not a feed. When I tried how feedparser responds to faulty input, I was surprised to see that feedparser does not throw any Exceptions at all. E.g. on HTML content, it tries to parse some information from the HTML code, and on non-existing domains, it returns a mostly empty dictionary: {'bozo': 1, 'bozo_exception': URLError(gaierror(-2, 'Name or service not known'),), 'encoding': 'utf-8', 'entries': [], 'feed': {}, 'version': None} Other faulty input manifest themselves in the status_code or the namespaces values in the returned dictionary. So, what's the best approach to have sane error checking without resorting to an endless cascade of if .. elif .. elif ...?

    Read the article

  • How to reload Django models without losing my locals in an interactive session?

    - by Gj
    I'm doing some research with an interactive shell and using a Django app (shell_plus) for storing data and browsing it using the convenient admin. Occasionally I add or change some of the app models, and run a syncdb (or South migration when changing a model). The changes to the models don't take effect in my interactive session even if I re-import the app models. Thus I'm forced to restart the shell_plus and lose my precious locals() in the process. Is there any way to reload the models during a session? Thanks!!

    Read the article

  • The truth value of an array with more than one element is ambigous when trying to index an array

    - by user1440194
    I am trying to put all elements of rbs into a new array if the elements in var(another numpy array) is =0 and <=.1 . However when I try the following code I get this error: ValueError: The truth value of an array with more than one element is ambiguous. Use a.any() or a.all() rbs = [ish[4] for ish in realbooks] for book in realbooks: var -= float(str(book[0]).replace(":", "")) bidsred = rbs[(var <= .1) and (var >=0)] any ideas on what I'm doing wrong?

    Read the article

  • [Django] How to find out whether a model's column is a foreign key?

    - by codethief
    I'm dynamically storing information in the database depending on the request: // table, id and column are provided by the request table_obj = getattr(models, table) record = table_obj.objects.get(pk=id) setattr(record, column, request.POST['value']) The problem is that request.POST['value'] sometimes contains a foreign record's primary key (i.e. an integer) whereas Django expects the column's value to be an object of type ForeignModel: Cannot assign "u'122'": "ModelA.b" must be a "ModelB" instance. Now, is there an elegant way to dynamically check whether b is a column containing foreign keys and what model these keys are linked to? (So that I can load the foreign record by it's primary key and assign it to ModelA?) Or doesn't Django provide information like this to the programmer so I really have to get my hands dirty and use isinstance() on the foreign-key column?

    Read the article

  • How to get to the key name of a referenced entity property from an entity instance without a datastore read in google app engine?

    - by Sumeet Pareek
    Consider I have the following models - class Team(db.Model): # say I have just 5 teams name = db.StringProperty() class Player(db.Model): # say I have thousands of players name = db.StringProperty() team = db.ReferenceProperty(Team, collection_name="player_set") Key name for each Team entity = 'team_' , and for each Player entity = 'player_' By some prior arrangement I have a Team entity's (key_name, name) mapping available to me. For example (team_01, United States Of America), (team_02, Russia) etc I have to show all the players and their teams on a page. One way of doing this would be - players = Player.all().fetch(1000) # This is 1 DB read for player in players: # This will iterate 1000 times self.response.out.write(player.name) # This is obviously not a DB read self.response.out.write(player.team.name) #This is a total of 1x1000 = 1000 DB reads That is a 1001 DB reads for a silly thing. The interesting part is that when I do a db.to_dict() on players, it shows that for every player in that list there is 'name' of the player and there is the 'key_name' of the team available too. So how can I do the below ?? players = Player.all().fetch(1000) # This is 1 DB read for player in players: # This will iterate 1000 times self.response.out.write(player.name) # This is obviously not a DB read self.response.out.write(team_list[player.<SOME WAY OF GETTING TEAM KEY NAME>]) # Here 'team_list' already has (key_name, name) for all 5 teams I have been struggling with this for a long time. Have read every available documentation. I could just hug the person that can help me here :-) Disclaimer: The above problem description is not a real scenario. It is a simplified arrangement that represents my problem exactly. I have run into it in a rater complex and big GAE appication.

    Read the article

  • getting global name not defined error

    - by nashr rafeeg
    i have the following class class notify(): def __init__(self,server="localhost", port=23053): self.host = server self.port = port register = gntp.GNTPRegister() register.add_header('Application-Name',"SVN Monitor") register.add_notification("svnupdate",True) growl(register) def svn_update(self, author="Unknown", files=0): notice = gntp.GNTPNotice() notice.add_header('Application-Name',"SVN Monitor") notice.add_header('Notification-Name', "svnupdate") notice.add_header('Notification-Title',"SVN Commit") # notice.add_header('Notification-Icon',"") notice.add_header('Notification-Text',Msg) growl(notice) def growl(data): s = socket.socket(socket.AF_INET, socket.SOCK_STREAM) s.connect((self.host,self.port)) s.send(data) response = gntp.parse_gntp(s.recv(1024)) print response s.close() but when ever i try to use this class via the follwoing code i get 'NameError: global name 'growl' is not defined' from growlnotify import * n = notify() n.svn_update() any one has an idea what is going on here ? cheers nash

    Read the article

  • Installing twisted.mail.smtp

    - by user3506985
    I am using Ubuntu 14.04 and trying to install twisted.mail.smtp using the following commnands -sudo add-apt-repository ppa:jesstess/twisted-12.1-testing -sudo apt-get update There are no errors in the installation,but when I specify the command that is from twisted.mail.smtp import ESMTPSenderFactory I am getting the following error Error: ImportError: No module named mail.smtp Please help me out

    Read the article

  • Matplotlib autodatelocator custom date formatting?

    - by jawonlee
    I'm using Matplotlib to dynamically generate .png charts from a database. The user may set as the x-axis any given range of datetimes, and I need to account for all of it. While Matplotlib has the dates.AutoDateLocator(), I want the datetime format printed on the chart to be context-specific - e.g. if the user is charting from 3 p.m. to 5 p.m., the year/month/day information doesn't need to be displayed. Right now, I'm manually creating Locator and Formatter objects thusly: def get_ticks(start, end): from datetime import timedelta as td delta = end - start if delta <= td(minutes=10): loc = mdates.MinuteLocator() fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(minutes=30): loc = mdates.MinuteLocator(byminute=range(0,60,5)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(hours=1): loc = mdates.MinuteLocator(byminute=range(0,60,15)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(hours=6): loc = mdates.HourLocator() fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(days=1): loc = mdates.HourLocator(byhour=range(0,24,3)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(days=3): loc = mdates.HourLocator(byhour=range(0,24,6)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(weeks=2): loc = mdates.DayLocator() fmt = mdates.DateFormatter('%b %d') elif delta <= td(weeks=12): loc = mdates.WeekdayLocator() fmt = mdates.DateFormatter('%b %d') elif delta <= td(weeks=52): loc = mdates.MonthLocator() fmt = mdates.DateFormatter('%b') else: loc = mdates.MonthLocator(interval=3) fmt = mdates.DateFormatter('%b %Y') return loc,fmt Is there a better way of doing this?

    Read the article

  • Setting up relations/mappings for a SQLAlchemy many-to-many database

    - by Brent Ramerth
    I'm new to SQLAlchemy and relational databases, and I'm trying to set up a model for an annotated lexicon. I want to support an arbitrary number of key-value annotations for the words which can be added or removed at runtime. Since there will be a lot of repetition in the names of the keys, I don't want to use this solution directly, although the code is similar. My design has word objects and property objects. The words and properties are stored in separate tables with a property_values table that links the two. Here's the code: from sqlalchemy import Column, Integer, String, Table, create_engine from sqlalchemy import MetaData, ForeignKey from sqlalchemy.orm import relation, mapper, sessionmaker from sqlalchemy.ext.declarative import declarative_base engine = create_engine('sqlite:///test.db', echo=True) meta = MetaData(bind=engine) property_values = Table('property_values', meta, Column('word_id', Integer, ForeignKey('words.id')), Column('property_id', Integer, ForeignKey('properties.id')), Column('value', String(20)) ) words = Table('words', meta, Column('id', Integer, primary_key=True), Column('name', String(20)), Column('freq', Integer) ) properties = Table('properties', meta, Column('id', Integer, primary_key=True), Column('name', String(20), nullable=False, unique=True) ) meta.create_all() class Word(object): def __init__(self, name, freq=1): self.name = name self.freq = freq class Property(object): def __init__(self, name): self.name = name mapper(Property, properties) Now I'd like to be able to do the following: Session = sessionmaker(bind=engine) s = Session() word = Word('foo', 42) word['bar'] = 'yes' # or word.bar = 'yes' ? s.add(word) s.commit() Ideally this should add 1|foo|42 to the words table, add 1|bar to the properties table, and add 1|1|yes to the property_values table. However, I don't have the right mappings and relations in place to make this happen. I get the sense from reading the documentation at http://www.sqlalchemy.org/docs/05/mappers.html#association-pattern that I want to use an association proxy or something of that sort here, but the syntax is unclear to me. I experimented with this: mapper(Word, words, properties={ 'properties': relation(Property, secondary=property_values) }) but this mapper only fills in the foreign key values, and I need to fill in the other value as well. Any assistance would be greatly appreciated.

    Read the article

  • How do you automatically remove the preview window after autocompletion in Vim?

    - by Ben Davini
    I'm using omnifunc=pythoncomplete. When autocompleting a word (e.g., os.), I get the list of eligible class members and functions, as expected, as well as a scratch buffer preview window with documentation about the selected member or function. This is great, but after selecting the function I want, the preview window remains. I can get rid of it with ":pc", but I'd like it just to automatically disappear after I've selected my function, a la Eclipse. I've played around with "completeopt" but to no avail.

    Read the article

  • Getting unpredictable data into a tabular format

    - by Acorn
    The situation: Each page I scrape has <input> elements with a title= and a value= I don't know what is going to be on the page. I want to have all my collected data in a single table at the end, with a column for each title. So basically, I need each row of data to line up with all the others, and if a row doesn't have a certain element, then it should be blank (but there must be something there to keep the alignment). eg. First page has: {animal: cat, colour: blue, fruit: lemon, day: monday} Second page has: {animal: fish, colour: green, day: saturday} Third page has: {animal: dog, number: 10, colour: yellow, fruit: mango, day: tuesday} Then my resulting table should be: animal | number | colour | fruit | day cat | none | blue | lemon | monday fish | none | green | none | saturday dog | 10 | yellow | mango | tuesday Although it would be good to keep the order of the title value pairs, which I know dictionaries wont do. So basically, I need to generate columns from all the titles (kept in order but somehow merged together) What would be the best way of going about this without knowing all the possible titles and explicitly specifying an order for the values to be put in?

    Read the article

  • How can I handle dynamic calculated attributes in a model in Django?

    - by bullfish
    In Django I calculate the breadcrumb (a list of fathers) for an geographical object. Since it is not going to change very often, I am thinking of pre calculating it once the object is saved or initialized. 1.) What would be better? Which solution would have a better performance? To calculate it at _init_ or to calculate it when the object is saved (the object takes about 500-2000 characters in the DB)? 2.) I tried to overwrite the _init_ or save() methods but I don't know how to use attributes of the just saved object. Accessing *args, **kwargs did not work. How can I access them? Do I have to save, access the father and then save again? 3.) If I decide to save the breadcrumb. Whats the best way to do it? I used http://www.djangosnippets.org/snippets/1694/ and have crumb = PickledObjectField(). Thats the method to calculate the attribute crumb() def _breadcrumb(self): breadcrumb = [ ] x = self while True: x = x.father try: if hasattr(x, 'country'): breadcrumb.append(x.country) elif hasattr(x, 'region'): breadcrumb.append(x.region) elif hasattr(x, 'city'): breadcrumb.append(x.city) else: break except: break breadcrumb.reverse() return breadcrumb Thats my save-Method: def save(self,*args, **kwargs): # how can I access the father ob the object? father = self.father # does obviously not work father = kwargs['father'] # does not work either # the breadcrumb gets calculated here self.crumb = self._breadcrumb(father) super(GeoObject, self).save(*args,**kwargs) Please help me out. I am working on this for days now. Thank you.

    Read the article

  • Is django orm & templates thread safe?

    - by Piotr Czapla
    I'm using django orm and templates to create a background service that is ran as management command. Do you know if django is thread safe? I'd like to use threads to speed up processing. The processing is blocked by I/O not CPU so I don't care about performance hit caused by GIL.

    Read the article

  • How to generate lots of redundant ajax elements like checkboxes and pulldowns in Django?

    - by iJames
    Hello folks. I've been getting lots of answers from stackoverflow now that I'm in Django just be searching. Now I hope my question will also create some value for everybody. In choosing Django, I was hoping there was some similar mechanism to the way you can do partials in ROR. This was going to help me in two ways. One was in generating repeating indexed forms or form elements, and also in rendering only a piece of the page on the round trip. I've done a little bit of that by using taconite with a simple URL click but now I'm trying to get more advanced. This will focus on the form issue which boils down to how to iterate over a secondary object. If I have a list of photo instances, each of which has a couple of parameters, let's say a size and a quantity. I want to generate form elements for each photo instance separately. But then I have two lists I want to iterate on at the same time. Context: photos : Photo.objects.all() and forms = {} for photo in photos: forms[photo.id] = PhotoForm() In other words we've got a list of photo objects and a dict of forms based on the photo.id. Here's an abstraction of the template: {% for photo in photos %} {% include "photoview.html" %} {% comment %} So here I want to use the photo.id as an index to get the correct form. So that each photo has its own form. I would want to have a different action and each form field would be unique. Is that possible? How can I iterate on that? Thanks! {% endcomment %} Quantity: {{ oi.quantity }} {{ form.quantity }} Dimensions: {{ oi.size }} {{ form.size }} {% endfor %} What can I do about this simple case. And how can I make it where every control is automatically updating the server instead of using a form at all? Thanks! James

    Read the article

  • Django: Is there any way to have "unique for date range"?

    - by tomwolber
    If my model for Items is: class Item(models.Model): name = models.CharField(max_length=500) startDate = models.DateField("Start Date", unique="true") endDate = models.DateField("End Date") Each Item needs to have a unique date range. for example, if i create an Item that has a date range of June 1st to June 8th, how can I keep and Item with a date range of June 3rd to June 5th from being created (or render an error with template logic)?

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

< Previous Page | 371 372 373 374 375 376 377 378 379 380 381 382  | Next Page >