Search Results

Search found 1065 results on 43 pages for 'calculation'.

Page 38/43 | < Previous Page | 34 35 36 37 38 39 40 41 42 43  | Next Page >

  • ArithmeticException thrown during BigDecimal.divide

    - by polygenelubricants
    I thought java.math.BigDecimal is supposed to be The Answer™ to the need of performing infinite precision arithmetic with decimal numbers. Consider the following snippet: import java.math.BigDecimal; //... final BigDecimal one = BigDecimal.ONE; final BigDecimal three = BigDecimal.valueOf(3); final BigDecimal third = one.divide(three); assert third.multiply(three).equals(one); // this should pass, right? I expect the assert to pass, but in fact the execution doesn't even get there: one.divide(three) causes ArithmeticException to be thrown! Exception in thread "main" java.lang.ArithmeticException: Non-terminating decimal expansion; no exact representable decimal result. at java.math.BigDecimal.divide It turns out that this behavior is explicitly documented in the API: In the case of divide, the exact quotient could have an infinitely long decimal expansion; for example, 1 divided by 3. If the quotient has a non-terminating decimal expansion and the operation is specified to return an exact result, an ArithmeticException is thrown. Otherwise, the exact result of the division is returned, as done for other operations. Browsing around the API further, one finds that in fact there are various overloads of divide that performs inexact division, i.e.: final BigDecimal third = one.divide(three, 33, RoundingMode.DOWN); System.out.println(three.multiply(third)); // prints "0.999999999999999999999999999999999" Of course, the obvious question now is "What's the point???". I thought BigDecimal is the solution when we need exact arithmetic, e.g. for financial calculations. If we can't even divide exactly, then how useful can this be? Does it actually serve a general purpose, or is it only useful in a very niche application where you fortunately just don't need to divide at all? If this is not the right answer, what CAN we use for exact division in financial calculation? (I mean, I don't have a finance major, but they still use division, right???).

    Read the article

  • How can I await the first completed async task of a list in .Net?

    - by Eyal
    My input is a long list of files located on an Amazon S3 server. I'd like to download the metadata of the files, compute the hashes of the local files, and compare the metadata hash with the local files' hash. Currently, I use a loop to start all the metadata downloads asynchronously, then as each completes, compute MD5 on the local file if needed and compare. Here's the code (just the relevant lines): Dim s3client As New AmazonS3Client(KeyId.Text, keySecret.Text) Dim responseTasks As New List(Of System.Tuple(Of ListViewItem, Task(Of GetObjectMetadataResponse))) For Each lvi As ListViewItem In lvStatus.Items Dim gomr As New Amazon.S3.Model.GetObjectMetadataRequest gomr.BucketName = S3FileDialog.GetBucketName(lvi.SubItems(2).Text) gomr.Key = S3FileDialog.GetPrefix(lvi.SubItems(2).Text) responseTasks.Add(New System.Tuple(Of ListViewItem, Task(Of GetObjectMetadataResponse))(lvi, s3client.GetObjectMetadataAsync(gomr))) Next For Each t As System.Tuple(Of ListViewItem, Task(Of GetObjectMetadataResponse)) In responseTasks Dim response As GetObjectMetadataResponse = Await t.Item2 If response.ETag.Trim(""""c) = MD5CalcFile(lvi.SubItems(1).Text) Then lvi.SubItems(3).Text = "Match" UpdateLvi(lvi) End If Next I've got two problems: I'm awaiting the reponses in the order that I made them. I'd rather process them in the order that they complete so that I get them faster. The MD5 calculation is long and synchronous. I tried making it async but the process locked up. I think that the MD5 task was added to the end of .Net's task list and it didn't get to run until all the downloads completed. Ideally, I process the response as they arrive, not in order, and the MD5 is asynchronous but gets a chance to run. Edit: Incorporating WhenAll, it looks like this now: Dim s3client As New Amazon.S3.AmazonS3Client(KeyId.Text, keySecret.Text) Dim responseTasks As New Dictionary(Of Task(Of GetObjectMetadataResponse), ListViewItem) For Each lvi As ListViewItem In lvStatus.Items Dim gomr As New Amazon.S3.Model.GetObjectMetadataRequest gomr.BucketName = S3FileDialog.GetBucketName(lvi.SubItems(2).Text) gomr.Key = S3FileDialog.GetPrefix(lvi.SubItems(2).Text) responseTasks.Add(s3client.GetObjectMetadataAsync(gomr), lvi) Next Dim startTime As DateTimeOffset = DateTimeOffset.Now Do While responseTasks.Count > 0 Dim currentTask As Task(Of GetObjectMetadataResponse) = Await Task.WhenAny(responseTasks.Keys) Dim response As GetObjectMetadataResponse = Await currentTask If response.ETag.Trim(""""c) = MD5CalcFile(lvi.SubItems(1).Text) Then lvi.SubItems(3).Text = "Match" UpdateLvi(lvi) End If Loop MsgBox((DateTimeOffset.Now - startTime).ToString) The UI locks up momentarily whenever MDSCalcFile is done. The whole loop takes about 45s and the first file's MD5 result happens within 1s of starting. If I change the line to: If response.ETag.Trim(""""c) = Await Task.Run(Function () MD5CalcFile(lvi.SubItems(1).Text)) Then The UI doesn't lock up when MD5CalcFile is done. The whole loop takes about 75s, up from 45s, and the first file's MD5 result happens after 40s of waiting.

    Read the article

  • Need some constructive criticism on my SSE/Assembly attempt

    - by Brett
    Hello, I'm working on converting a bit of code to SSE, and while I have the correct output it turns out to be slower than standard c++ code. The bit of code that I need to do this for is: float ox = p2x - (px * c - py * s)*m; float oy = p2y - (px * s - py * c)*m; What I've got for SSE code is: void assemblycalc(vector4 &p, vector4 &sc, float &m, vector4 &xy) { vector4 r; __m128 scale = _mm_set1_ps(m); __asm { mov eax, p //Load into CPU reg mov ebx, sc movups xmm0, [eax] //move vectors to SSE regs movups xmm1, [ebx] mulps xmm0, xmm1 //Multiply the Elements movaps xmm2, xmm0 //make a copy of the array shufps xmm2, xmm0, 0x1B //shuffle the array subps xmm0, xmm2 //subtract the elements mulps xmm0, scale //multiply the vector by the scale mov ecx, xy //load the variable into cpu reg movups xmm3, [ecx] //move the vector to the SSE regs subps xmm3, xmm0 //subtract xmm3 - xmm0 movups [r], xmm3 //Save the retun vector, and use elements 0 and 3 } } Since its very difficult to read the code, I'll explain what I did: loaded vector4 , xmm0 _ p = [px , py , px , py ] mult. by vector4, xmm1 _ cs = [c , c , s , s ] _____________mult---------------------------- result,______ xmm0 = [px*c, py*c, px*s, py*s] reuse result, xmm0 = [px*c, py*c, px*s, py*s] shuffle result, xmm2 = [py*s, px*s, py*c, px*c] ___________subtract---------------------------- result, xmm0 = [px*c-py*s, py*c-px*s, px*s-py*c, py*s-px*c] reuse result, xmm0 = [px*c-py*s, py*c-px*s, px*s-py*c, py*s-px*c] load m vector4, scale = [m, m, m, m] ______________mult---------------------------- result, xmm0 = [(px*c-py*s)*m, (py*c-px*s)*m, (px*s-py*c)*m, (py*s-px*c)*m] load xy vector4, xmm3 = [p2x, p2x, p2y, p2y] reuse, xmm0 = [(px*c-py*s)*m, (py*c-px*s)*m, (px*s-py*c)*m, (py*s-px*c)*m] ___________subtract---------------------------- result, xmm3 = [p2x-(px*c-py*s)*m, p2x-(py*c-px*s)*m, p2y-(px*s-py*c)*m, p2y-(py*s-px*c)*m] then ox = xmm3[0] and oy = xmm3[3], so I essentially don't use xmm3[1] or xmm3[4] I apologize for the difficulty reading this, but I'm hoping someone might be able to provide some guidance for me, as the standard c++ code runs in 0.001444ms and the SSE code runs in 0.00198ms. Let me know if there is anything I can do to further explain/clean this up a bit. The reason I'm trying to use SSE is because I run this calculation millions of times, and it is a part of what is slowing down my current code. Thanks in advance for any help! Brett

    Read the article

  • Help ---- SQL Script

    - by Vinoj Nambiar
    Store No Store Name Region Division Q10(response) Q21(response) 2345       ABC              North Test              1                       5 2345                            North Test              6                       3 2345       ABC              North Test              4                       6 1st calculation 1 ) Engaged(%) = Response Greater than 4.5 3 (total response greater than 4.5) / 6 (total count) * 100 = 50% Store No Store Name Region Division Q10 Q21 2345             ABC      North Test           1       5 2345             ABC      North Test           6       3 2345            ABC       North Test           4       6 2) not engaged (%) = Response less than 2 1 (total response less than 2) / 6 (total count) * 100 = 16.66% I should be able to get the table like this Store No Store Name Region Division Engaged(%) Disengaged(%) 2345            ABC     North Test                 50                 16.66

    Read the article

  • Cepstral Analysis for pitch detection

    - by Ohmu
    Hi! I'm looking to extract pitches from a sound signal. Someone on IRC just explain to me how taking a double FFT achieves this. Specifically: take FFT take log of square of absolute value (can be done with lookup table) take another FFT take absolute value I am attempting this using vDSP I can't understand how I didn't come across this technique earlier. I did a lot of hunting and asking questions; several weeks worth. More to the point, I can't understand why I didn't think of it. I am attempting to achieve this with vDSP library. it looks as though it has functions to handle all of these tasks. However, I'm wondering about the accuracy of the final result. I have previously used a technique which scours the frequency bins of a single FFT for local maxima. when it encounters one, it uses a cunning technique (the change in phase since the last FFT) to more accurately place the actual peak within the bin. I am worried that this precision will be lost with this technique I'm presenting here. I guess the technique could be used after the second FFT to get the fundamental accurately. But it kind of looks like the information is lost in step 2. as this is a potentially tricky process, could someone with some experience just look over what I'm doing and check it for sanity? also, I've heard there is an alternative technique involving fitting a quadratic over neighbouring bins. Is this of comparable accuracy? if so, I would favour it, as it doesn't involve remembering bin phases. so questions: does this approach makes sense? Can it be improved? I'm a bit worried about And the log square component; there seems to be a vDSP function to do exactly that: vDSP_vdbcon however, there is no indication it precalculates a log-table -- I assume it doesn't, as the FFT function requires an explicit pre-calculation function to be called and passed into it. and this function doesn't. Is there some danger of harmonics being picked up? is there any cunning way of making vDSP pull out the maxima, biggest first? Can anyone point me towards some research or literature on this technique? the main question: is it accurate enough? Can the accuracy be improved? I have just been told by an expert that the accuracy IS INDEED not sufficient. Is this the end of the line? Pi PS I get SO annoyed (npi) when I want to create tags, but cannot. :| I have suggested to the maintainers that SO keep track of attempted tags, but I'm sure I was ignored. we need tags for vDSP, accelerate framework, cepstral analysis

    Read the article

  • Setting up a "to-many" relationship value dependency for a transient Core Data attribute

    - by Greg Combs
    I've got a relatively complicated Core Data relationship structure and I'm trying to figure out how to set up value dependencies (or observations) across various to-many relationships. Let me start out with some basic info. I've got a classroom with students, assignments, and grades (students X assignments). For simplicity's sake, we don't really have to focus much on the assignments yet. StudentObj <--->> ScoreObj <<---> AssignmentObj Each ScoreObj has a to-one relation with the StudentObj and the AssignmentObj. ScoreObj has real attributes for the numerical grade, the turnInDate, and notes. AssignmentObj.scores is the set of Score objects for that assignment (N = all students). AssignmentObj has real attributes for name, dueDate, curveFunction, gradeWeight, and maxPoints. StudentObj.scores is the set of Score objects for that student (N = all assignments). StudentObj also has real attributes like name, studentID, email, etc. StudentObj has a transient (calculated, not stored) attribute called gradeTotal. This last item, gradeTotal, is the real pickle. it calculates the student's overall semester grade using the scores (ScoreObj) from all their assignments, their associated assignment gradeWeights, curves, and maxPoints, and various other things. This gradeTotal value is displayed in a table column, along with all the students and their individual assignment grades. Determining the value of gradeTotal is a relatively expensive operation, particularly with a large class, therefore I want to run it only when necessary. For simplicity's sake, I'm not storing that gradeTotal value in the core data model. I don't mind caching it somewhere, but I'm having a bitch of a time determining where and how to best update that cache. I need to run that calculation for each student whenever any value changes that affects their gradeTotal. If this were a simple to-one relationship, I know I could use something like keyPathsForValuesAffectingGradeTotal ... but it's more like a many-to-one-to-many relationship. Does anyone know of an elegant (and KVC correct) solution? I guess I could tear through all those score and assignment objects and tell them to register their students as observers. But this seems like a blunt force approach.

    Read the article

  • Help with method logic in Java, hw

    - by Crystal
    I have a Loan class that in its printPayment method, it prints the amortization table of a loan for a hw assignment. We are also to implement a print first payment method, and a print last payment method. Since my calculation is done in the printPayment method, I didn't know how I could get the value in the first or last iteration of the loop and print that amount out. One way I can think of is to write a new method that might return that value, but I wasn't sure if there was a better way. Here is my code: public abstract class Loan { public void setClient(Person client) { this.client = client; } public Person getClient() { return client; } public void setLoanId() { loanId = nextId; nextId++; } public int getLoanId() { return loanId; } public void setInterestRate(double interestRate) { this.interestRate = interestRate; } public double getInterestRate() { return interestRate; } public void setLoanLength(int loanLength) { this.loanLength = loanLength; } public int getLoanLength() { return loanLength; } public void setLoanAmount(double loanAmount) { this.loanAmount = loanAmount; } public double getLoanAmount() { return loanAmount; } public void printPayments() { double monthlyInterest; double monthlyPrincipalPaid; double newPrincipal; int paymentNumber = 1; double monthlyInterestRate = interestRate / 1200; double monthlyPayment = loanAmount * (monthlyInterestRate) / (1 - Math.pow((1 + monthlyInterestRate),( -1 * loanLength))); System.out.println("Payment Number | Interest | Principal | Loan Balance"); // amortization table while (loanAmount >= 0) { monthlyInterest = loanAmount * monthlyInterestRate; monthlyPrincipalPaid = monthlyPayment - monthlyInterest; newPrincipal = loanAmount - monthlyPrincipalPaid; loanAmount = newPrincipal; System.out.printf("%d, %.2f, %.2f, %.2f", paymentNumber++, monthlyInterest, monthlyPrincipalPaid, loanAmount); } } /* //method to print first payment public double getFirstPayment() { } method to print last payment public double getLastPayment() { }*/ private Person client; private int loanId; private double interestRate; private int loanLength; private double loanAmount; private static int nextId = 1; } Thanks!

    Read the article

  • How does Sentry aggregate errors?

    - by Hugo Rodger-Brown
    I am using Sentry (in a django project), and I'd like to know how I can get the errors to aggregate properly. I am logging certain user actions as errors, so there is no underlying system exception, and am using the culprit attribute to set a friendly error name. The message is templated, and contains a common message ("User 'x' was unable to perform action because 'y'"), but is never exactly the same (different users, different conditions). Sentry clearly uses some set of attributes under the hood to determine whether to aggregate errors as the same exception, but despite having looked through the code, I can't work out how. Can anyone short-cut my having to dig further into the code and tell me what properties I need to set in order to manage aggregation as I would like? [UPDATE 1: event grouping] This line appears in sentry.models.Group: class Group(MessageBase): """ Aggregated message which summarizes a set of Events. """ ... class Meta: unique_together = (('project', 'logger', 'culprit', 'checksum'),) ... Which makes sense - project, logger and culprit I am setting at the moment - the problem is checksum. I will investigate further, however 'checksum' suggests that binary equivalence, which is never going to work - it must be possible to group instances of the same exception, with differenct attributes? [UPDATE 2: event checksums] The event checksum comes from the sentry.manager.get_checksum_from_event method: def get_checksum_from_event(event): for interface in event.interfaces.itervalues(): result = interface.get_hash() if result: hash = hashlib.md5() for r in result: hash.update(to_string(r)) return hash.hexdigest() return hashlib.md5(to_string(event.message)).hexdigest() Next stop - where do the event interfaces come from? [UPDATE 3: event interfaces] I have worked out that interfaces refer to the standard mechanism for describing data passed into sentry events, and that I am using the standard sentry.interfaces.Message and sentry.interfaces.User interfaces. Both of these will contain different data depending on the exception instance - and so a checksum will never match. Is there any way that I can exclude these from the checksum calculation? (Or at least the User interface value, as that has to be different - the Message interface value I could standardise.) [UPDATE 4: solution] Here are the two get_hash functions for the Message and User interfaces respectively: # sentry.interfaces.Message def get_hash(self): return [self.message] # sentry.interfaces.User def get_hash(self): return [] Looking at these two, only the Message.get_hash interface will return a value that is picked up by the get_checksum_for_event method, and so this is the one that will be returned (hashed etc.) The net effect of this is that the the checksum is evaluated on the message alone - which in theory means that I can standardise the message and keep the user definition unique. I've answered my own question here, but hopefully my investigation is of use to others having the same problem. (As an aside, I've also submitted a pull request against the Sentry documentation as part of this ;-)) (Note to anyone using / extending Sentry with custom interfaces - if you want to avoid your interface being use to group exceptions, return an empty list.)

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Multi-threaded random_r is slower than single threaded version.

    - by Nixuz
    The following program is essentially the same the one described here. When I run and compile the program using two threads (NTHREADS == 2), I get the following run times: real 0m14.120s user 0m25.570s sys 0m0.050s When it is run with just one thread (NTHREADS == 1), I get run times significantly better even though it is only using one core. real 0m4.705s user 0m4.660s sys 0m0.010s My system is dual core, and I know random_r is thread safe and I am pretty sure it is non-blocking. When the same program is run without random_r and a calculation of cosines and sines is used as a replacement, the dual-threaded version runs in about 1/2 the time as expected. #include <pthread.h> #include <stdlib.h> #include <stdio.h> #define NTHREADS 2 #define PRNG_BUFSZ 8 #define ITERATIONS 1000000000 void* thread_run(void* arg) { int r1, i, totalIterations = ITERATIONS / NTHREADS; for (i = 0; i < totalIterations; i++){ random_r((struct random_data*)arg, &r1); } printf("%i\n", r1); } int main(int argc, char** argv) { struct random_data* rand_states = (struct random_data*)calloc(NTHREADS, sizeof(struct random_data)); char* rand_statebufs = (char*)calloc(NTHREADS, PRNG_BUFSZ); pthread_t* thread_ids; int t = 0; thread_ids = (pthread_t*)calloc(NTHREADS, sizeof(pthread_t)); /* create threads */ for (t = 0; t < NTHREADS; t++) { initstate_r(random(), &rand_statebufs[t], PRNG_BUFSZ, &rand_states[t]); pthread_create(&thread_ids[t], NULL, &thread_run, &rand_states[t]); } for (t = 0; t < NTHREADS; t++) { pthread_join(thread_ids[t], NULL); } free(thread_ids); free(rand_states); free(rand_statebufs); } I am confused why when generating random numbers the two threaded version performs much worse than the single threaded version, considering random_r is meant to be used in multi-threaded applications.

    Read the article

  • Preoblem with Precision floating point operation in C

    - by Microkernel
    Hi Guys, For one of my course project I started implementing "Naive Bayesian classifier" in C. My project is to implement a document classifier application (especially Spam) using huge training data. Now I have problem implementing the algorithm because of the limitations in the C's datatype. ( Algorithm I am using is given here, http://en.wikipedia.org/wiki/Bayesian_spam_filtering ) PROBLEM STATEMENT: The algorithm involves taking each word in a document and calculating probability of it being spam word. If p1, p2 p3 .... pn are probabilities of word-1, 2, 3 ... n. The probability of doc being spam or not is calculated using Here, probability value can be very easily around 0.01. So even if I use datatype "double" my calculation will go for a toss. To confirm this I wrote a sample code given below. #define PROBABILITY_OF_UNLIKELY_SPAM_WORD (0.01) #define PROBABILITY_OF_MOSTLY_SPAM_WORD (0.99) int main() { int index; long double numerator = 1.0; long double denom1 = 1.0, denom2 = 1.0; long double doc_spam_prob; /* Simulating FEW unlikely spam words */ for(index = 0; index < 162; index++) { numerator = numerator*(long double)PROBABILITY_OF_UNLIKELY_SPAM_WORD; denom2 = denom2*(long double)PROBABILITY_OF_UNLIKELY_SPAM_WORD; denom1 = denom1*(long double)(1 - PROBABILITY_OF_UNLIKELY_SPAM_WORD); } /* Simulating lot of mostly definite spam words */ for (index = 0; index < 1000; index++) { numerator = numerator*(long double)PROBABILITY_OF_MOSTLY_SPAM_WORD; denom2 = denom2*(long double)PROBABILITY_OF_MOSTLY_SPAM_WORD; denom1 = denom1*(long double)(1- PROBABILITY_OF_MOSTLY_SPAM_WORD); } doc_spam_prob= (numerator/(denom1+denom2)); return 0; } I tried Float, double and even long double datatypes but still same problem. Hence, say in a 100K words document I am analyzing, if just 162 words are having 1% spam probability and remaining 99838 are conspicuously spam words, then still my app will say it as Not Spam doc because of Precision error (as numerator easily goes to ZERO)!!!. This is the first time I am hitting such issue. So how exactly should this problem be tackled?

    Read the article

  • Problem with Precision floating point operation in C

    - by Microkernel
    Hi Guys, For one of my course project I started implementing "Naive Bayesian classifier" in C. My project is to implement a document classifier application (especially Spam) using huge training data. Now I have problem implementing the algorithm because of the limitations in the C's datatype. ( Algorithm I am using is given here, http://en.wikipedia.org/wiki/Bayesian_spam_filtering ) PROBLEM STATEMENT: The algorithm involves taking each word in a document and calculating probability of it being spam word. If p1, p2 p3 .... pn are probabilities of word-1, 2, 3 ... n. The probability of doc being spam or not is calculated using Here, probability value can be very easily around 0.01. So even if I use datatype "double" my calculation will go for a toss. To confirm this I wrote a sample code given below. #define PROBABILITY_OF_UNLIKELY_SPAM_WORD (0.01) #define PROBABILITY_OF_MOSTLY_SPAM_WORD (0.99) int main() { int index; long double numerator = 1.0; long double denom1 = 1.0, denom2 = 1.0; long double doc_spam_prob; /* Simulating FEW unlikely spam words */ for(index = 0; index < 162; index++) { numerator = numerator*(long double)PROBABILITY_OF_UNLIKELY_SPAM_WORD; denom2 = denom2*(long double)PROBABILITY_OF_UNLIKELY_SPAM_WORD; denom1 = denom1*(long double)(1 - PROBABILITY_OF_UNLIKELY_SPAM_WORD); } /* Simulating lot of mostly definite spam words */ for (index = 0; index < 1000; index++) { numerator = numerator*(long double)PROBABILITY_OF_MOSTLY_SPAM_WORD; denom2 = denom2*(long double)PROBABILITY_OF_MOSTLY_SPAM_WORD; denom1 = denom1*(long double)(1- PROBABILITY_OF_MOSTLY_SPAM_WORD); } doc_spam_prob= (numerator/(denom1+denom2)); return 0; } I tried Float, double and even long double datatypes but still same problem. Hence, say in a 100K words document I am analyzing, if just 162 words are having 1% spam probability and remaining 99838 are conspicuously spam words, then still my app will say it as Not Spam doc because of Precision error (as numerator easily goes to ZERO)!!!. This is the first time I am hitting such issue. So how exactly should this problem be tackled?

    Read the article

  • Finding good heuristic for A* search

    - by Martin
    I'm trying to find the optimal solution for a little puzzle game called Twiddle (an applet with the game can be found here). The game has a 3x3 matrix with the number from 1 to 9. The goal is to bring the numbers in the correct order using the minimum amount of moves. In each move you can rotate a 2x2 square either clockwise or counterclockwise. I.e. if you have this state 6 3 9 8 7 5 1 2 4 and you rotate the upper left 2x2 square clockwise you get 8 6 9 7 3 5 1 2 4 I'm using a A* search to find the optimal solution. My f() is simply the number of rotations need. My heuristic function already leads to the optimal solution but I don't think it's the best one you can find. My current heuristic takes each corner, looks at the number at the corner and calculates the manhatten distance to the position this number will have in the solved state (which gives me the number of rotation needed to bring the number to this postion) and sums all these values. I.e. You take the above example: 6 3 9 8 7 5 1 2 4 and this end state 1 2 3 4 5 6 7 8 9 then the heuristic does the following 6 is currently at index 0 and should by at index 5: 3 rotations needed 9 is currently at index 2 and should by at index 8: 2 rotations needed 1 is currently at index 6 and should by at index 0: 2 rotations needed 4 is currently at index 8 and should by at index 3: 3 rotations needed h = 3 + 2 + 2 + 3 = 10 But there is the problem, that you rotate 4 elements at once. So there a rare cases where you can do two (ore more) of theses estimated rotations in one move. This means theses heuristic overestimates the distance to the solution. My current workaround is, to simply excluded one of the corners from the calculation which solves this problem at least for my test-cases. I've done no research if really solves the problem or if this heuristic still overestimates in same edge-cases. So my question is: What is the best heuristic you can come up with? (Disclaimer: This is for a university project, so this is a bit of homework. But I'm free to use any resource if can come up with, so it's okay to ask you guys. Also I will credit Stackoverflow for helping me ;) )

    Read the article

  • Connection between Properties of Entities in Data Oriented Design

    - by sharethis
    I want to start with an example illustrating my question. The following way it is done in the most games. class car { vec3 position; vec3 rotation; mesh model; imge texture; void move(); // modify position and rotation void draw(); // use model, texture, ... }; vector<car> cars; for(auto i = cars.begin(); i != cars.end(); ++i) { i->move(); i->draw(); } Data oriented design means to process the same calculation on the hole batch of data at once. This way it takes more advantage out of the processor cache. struct movedata { vec3 position; vec3 rotation; }; struct drawdata { mesh model; imge texture; }; vector<movedata> movedatas; vector<drawdata> drawdatas; for(auto i = movedatas.begin(); i != movedatas.end(); ++i) { // modify position and rotation } for(auto i = drawdatas.begin(); i != drawdatas.end(); ++i) { // use model, texture, ... } But there comes a point where you need to find other properties according to an entity. For example if the car crashes, I do not need the drawdata and the movedata any more. So I need to delete the entries of this entity in all vectors. The entries are not linked by code. So my question is the following. How are properties of the same entity conceptually linked in a data oriented design?

    Read the article

  • Memory Management iOS dev app doesn't work after a few detail items

    - by user1434846
    I am working on a project with a tableView controller and the detail views contains CMMotionManager.When i open 5 or 6 detailViews all goes well,but after a while the app goes slow and finally crashes.On instruments the only leak is on main.m , also i must say that I'm using ARC and i can't dealloc or realese the instances. Here is the code: First the table view: - (void)viewDidLoad { [super viewDidLoad]; // Do any additional setup after loading the view, typically from a nib. self.title = @"Movement";//Master View Controller title bar UIImage *image = [UIImage imageNamed:@"jg_navibar.png"]; [self.navigationController.navigationBar setBackgroundImage:image forBarMetrics:UIBarMetricsDefault]; //Init the array with data bodypartsMutableArray = [NSMutableArray arrayWithCapacity:26]; BodypartData *part1 = [[BodypartData alloc] init]; part1.bodypartname = @"Shoulder"; part1.movementname = @"Flexion"; part1.fullimageStartingPosition=[UIImage imageNamed:@"2_shoulder_flexion_end_position.jpg"]; part1.fullimageEndedPosition=[UIImage imageNamed:@"2_shoulder_flexion_end_position.jpg"]; part1.thumbimage=[UIImage imageNamed:@"1_shoulder_flexion_landmarks_thumb.jpg"]; [bodypartsMutableArray addObject:part1]; ......... } then the cell: - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:@"MyBasicCell"]; BodypartData *part = [self.bodypartsMutableArray objectAtIndex:indexPath.row]; cell.textLabel.text =[NSString stringWithFormat:part.movementname]; cell.detailTextLabel.text =[NSString stringWithFormat:part.bodypartname]; cell.imageView.image =part.thumbimage; return cell; } and the the detailViewdid load: - (void)viewDidLoad { [super viewDidLoad]; // Do any additional setup after loading the view, typically from a nib. // Init motionManager object and set the Update Interval _motionManager = [[CMMotionManager alloc]init]; _motionManager.deviceMotionUpdateInterval=1/60; //60 Hz [_motionManager startGyroUpdates]; if (_motionManager.gyroAvailable) { _motionManager.gyroUpdateInterval = 1.0/60.0; [_motionManager startDeviceMotionUpdatesToQueue:[NSOperationQueue currentQueue] withHandler: ^(CMDeviceMotion *motion, NSError *error) { CMAttitude *attitude = motion.attitude; //Calculation with rotationMatrix m11 = [NSString stringWithFormat:@"%.02f", attitude.rotationMatrix.m11]; m12 = [NSString stringWithFormat:@"%.02f", attitude.rotationMatrix.m12]; m13 = [NSString stringWithFormat:@"%.02f", attitude.rotationMatrix.m13]; ......... }

    Read the article

  • Optimizing sparse dot-product in C#

    - by Haggai
    Hello. I'm trying to calculate the dot-product of two very sparse associative arrays. The arrays contain an ID and a value, so the calculation should be done only on those IDs that are common to both arrays, e.g. <(1, 0.5), (3, 0.7), (12, 1.3) * <(2, 0.4), (3, 2.3), (12, 4.7) = 0.7*2.3 + 1.3*4.7 . My implementation (call it dict) currently uses Dictionaries, but it is too slow to my taste. double dot_product(IDictionary<int, double> arr1, IDictionary<int, double> arr2) { double res = 0; double val2; foreach (KeyValuePair<int, double> p in arr1) if (arr2.TryGetValue(p.Key, out val2)) res += p.Value * val2; return res; } The full arrays have about 500,000 entries each, while the sparse ones are only tens to hundreds entries each. I did some experiments with toy versions of dot products. First I tried to multiply just two double arrays to see the ultimate speed I can get (let's call this "flat"). Then I tried to change the implementation of the associative array multiplication using an int[] ID array and a double[] values array, walking together on both ID arrays and multiplying when they are equal (let's call this "double"). I then tried to run all three versions with debug or release, with F5 or Ctrl-F5. The results are as follows: debug F5: dict: 5.29s double: 4.18s (79% of dict) flat: 0.99s (19% of dict, 24% of double) debug ^F5: dict: 5.23s double: 4.19s (80% of dict) flat: 0.98s (19% of dict, 23% of double) release F5: dict: 5.29s double: 3.08s (58% of dict) flat: 0.81s (15% of dict, 26% of double) release ^F5: dict: 4.62s double: 1.22s (26% of dict) flat: 0.29s ( 6% of dict, 24% of double) I don't understand these results. Why isn't the dictionary version optimized in release F5 as do the double and flat versions? Why is it only slightly optimized in the release ^F5 version while the other two are heavily optimized? Also, since converting my code into the "double" scheme would mean lots of work - do you have any suggestions how to optimize the dictionary one? Thanks! Haggai

    Read the article

  • Representation of a DateTime as the local to remote user

    - by TwoSecondsBefore
    Hello! I was confused in the problem of time zones. I am writing a web application that will contain some news with dates of publication, and I want the client to see the date of publication of the news in the form of corresponding local time. However, I do not know in which time zone the client is located. I have three questions. I have to ask just in case: does DateTimeOffset.UtcNow always returns the correct UTC date and time, regardless of whether the server is dependent on daylight savings time? For example, if the first time I get the value of this property for two minutes before daylight savings time (or before the transition from daylight saving time back) and the second time in 2 minutes after the transfer, whether the value of properties in all cases differ by only 4 minutes? Or here require any further logic? (Question #1) Please see the following example and tell me what you think. I posted the news on the site. I assume that DateTimeOffset.UtcNow takes into account the time zone of the server and the daylight savings time, and so I immediately get the correct UTC server time when pressing the button "Submit". I write this value to a MS SQL database in the field of type datetime2(0). Then the user opens a page with news and no matter how long after publication. This may occur even after many years. I did not ask him to enter his time zone. Instead, I get the offset of his current local time from UTC using the javascript function following way: function GetUserTimezoneOffset() { var offset = new Date().getTimezoneOffset(); return offset; } Next I make the calculation of the date and time of publication, which will show the user: public static DateTime Get_Publication_Date_In_User_Local_DateTime( DateTime Publication_Utc_Date_Time_From_DataBase, int User_Time_Zone_Offset_Returned_by_Javascript) { int userTimezoneOffset = User_Time_Zone_Offset_Returned_by_Javascript; // For // example Javascript returns a value equal to -300, which means the // current user's time differs from UTC to 300 minutes. Ie offset // is UTC +6. In this case, it may be the time zone UTC +5 which // currently operates summer time or UTC +6 which currently operates the // standard time. // Right? (Question #2) DateTimeOffset utcPublicationDateTime = new DateTimeOffset(Publication_Utc_Date_Time_From_DataBase, new TimeSpan(0)); // get an instance of type DateTimeOffset for the // date and time of publication for further calculations DateTimeOffset publication_DateTime_In_User_Local_DateTime = utcPublicationDateTime.ToOffset(new TimeSpan(0, - userTimezoneOffset, 0)); return publication_DateTime_In_User_Local_DateTime.DateTime;// return to user } Is the value obtained correct? Is this the right approach to solving this problem? (Question #3)

    Read the article

  • How to use an adjacency matrix to determine which rows to 'pass' to a function in r?

    - by dubhousing
    New to R, and I have a long-ish question: I have a shapefile/map, and I'm aiming to calculate a certain index for every polygon in that map, based on attributes of that polygon and each polygon that neighbors it. I have an adjacency matrix -- which I think is the same as a "1st-order queen contiguity weights matrix", although I'm not sure -- that describes which polygons border which other polygons, e.g., POLYID A B C D E A 0 0 1 0 1 B 0 0 1 0 0 C 1 1 0 1 0 D 0 0 1 0 1 E 1 0 0 1 0 The above indicates, for instance, that polygons 'C' and 'E' adjoin polygon 'A'; polygon 'B' adjoins only polygon 'C', etc. The attribute table I have has one polygon per row: POLYID TOT L10K 10_15K 15_20K ... A 500 24 30 77 ... Where TOT, L10K, etc. are the variables I use to calculate an index. There are 525 polygons/rows in my data, so I'd like to use the adjacency matrix to determine which rows' attributes to incorporate into the calculation of the index of interest. For now, I can calculate the index when I subset the rows that correspond to one 'bundle' of neighboring polygons, and then use a loop (if it's of interest, I'm calculating the Centile Gap Index, a measure of local income segregation). E.g., subsetting the 'neighborhood' of the Detroit City Schools: Detroit <- UNSD00[c(142,150,164,221,226,236,295,327,157,177,178,364,233,373,418,424,449,451,487),] Then record the marginal column proportions and a running total: catprops <- vector() for(i in 4:19) { catprops[(i-3)]<-sum(Detroit[,i])/sum(Detroit[,3]) } catprops <- as.data.frame(catprops) catprops[,2]<-cumsum(catprops[,1]) Columns 4:19 are the necessary ones in the attribute table. Then I use the following code to calculate the index -- note that the loop has "i in 1:19" because the Detroit subset has 19 polygons. cgidistsum <- 0 for(i in 1:19) { pranks <- vector() for(j in 4:19) { if (Detroit[i,j]==0) pranks <- append(pranks,0) else if (j == 4) pranks <- append(pranks,seq(0,catprops[1,2],by=catprops[1,2]/Detroit[i,j])) else pranks <- append(pranks,seq(catprops[j-4,2],catprops[j-3,2],by=catprops[j-3,1]/Detroit[i,j])) } distpranks <- vector() distpranks<-abs(pranks-median(pranks)) cgidistsum <- cgidistsum + sum(distpranks) } cgi <- (.25-(cgidistsum/sum(Detroit[,3])))/.25 My apologies if I've provided more information than is necessary. I would really like to exploit the adjacency matrix in order to calculate the CGI for each 'bundle' of these rows. If you happen to know how I could started with this, that would be great. and my apologies for any novice mistakes, I'm new to R!

    Read the article

  • Line Graph CGPoints from NSMutableArray

    - by Mattog1456
    I have been trying to adapt the code from the accelerometer example such that when the user depresses a uibutton a point is added to a line graph. Working on the converting two floats, which are the result of calculate as below into a CGPoint and converting the CGPoint into an NSValue and then adding this to a NSMutableArray with the following -(IBAction)calculate:(id)sender { self.points = [NSMutableArray array]; CGPoint pt = CGPointMake(d, c); [self.points addObject:[NSValue valueWithCGPoint:pt]]; NSLog(@"%@", NSStringFromCGPoint(pt)); NSLog(@"%@", [NSString stringWithFormat:@"%d points", self.points.count ]); } But for some reason I am only getting one object stored in the array, it seems everytime push the calculate button the object pt gets overwritten, on the plus side it has the correct x,y coords. Any ideas on this one? UPDATE Removed self.points = [NSMutableArray array]; and placed it in view did load, also set the first points to 0,0. so that is working ok. Now the next problem is that I have a Graph subclass where the CG Drawing is taking place. I am trying to figure out a simple way to be able to access the above NSMutableArray which is in a ViewController class from the graph class. Am so close to the end but am really stuck, any help would be great. Still trying to draw a line graph on a UIView which is on a UIScrollview. The draw rect method is in the UIView Subclass and everything is working there, I have gridlines and labels on the axis and I can draw manually onto it. But the problem I have is that I cannot read the NSMutableArray of the CGPoints, which are the x and y coords. The ViewController performs a calculation and the results are written to the NSMutable array and this is all working fine as well, I can see the CGpoints and their values being written with NSLogs in the ViewController. I have tried various ways to set the NSMutableArray up as a global but to no avail, everything runs but while I can see the points being written in the ViewController they are just not visible to the UIView Subclass. I have also tried to use the addObserver and observeValueForKeyPath methods and once again while everything runs the subclass cannot see the array. Any ideas, suggestions, tips or thoughts would be great

    Read the article

  • CodePlex Daily Summary for Friday, February 19, 2010

    CodePlex Daily Summary for Friday, February 19, 2010New ProjectsApplication Management Library: Application Management makes your application life easier. It will automatic do memory management, handle and log unhandled exceptions, profiling y...Audio Service - Play Wave Files From Windows Service: This is a windows service that Check a registry key, when the key is updated with a new wave file path the service plays the wave file.Aviamodels: 3d drawing AviamodelsControl of payment proofs program for Greek citizens: This is a program that is used for Greek citizens who want to keep track of their payment proofs.Cover Creator: Cover Creator gives you the possibility to create and print CD covers. Content of CD is taken from http://www.freedb.org/ or can be added/modyfied ...DevBoard: DevBoard is a webbased scrum tool that helps developers/team get a clear overview of the project progress. It's developed in C# and silverlight.Flex AdventureWorks: The is mostly a skunk-works application to help me get acclimated to CodePlex. The long term goal is to integrate a Flex UI with the AdventureWor...GRE Wordlist: An intuitive and customizable word list for GRE aspirants. Developed in Java using a word list similar to Barron's.Indexer: A desktop file Index and Search tool which allows you to choose a list of folders to index, and then search on later. It is based on Lucene.net an...Project Management Office (PMO) for SharePoint: Sample web part for the Code Mastery event in Boston, February 11, 2010.Restart SQL Audit Policy and Job: Resolve SQL 2008 Audit Network Connectivity Issue.Rounded Corners / DIV Container: The RoundedDiv round corners container is a skin-able, CSS compliant UI control. Select which corners should be rounded, collapse and expand the c...Silverlight Google Search Application: The Silverlight Google Search Application uses Google Search API and behaves like Internet Search Application with option to preview desired page i...Weather Forecast Control: MyWeather forecast control pulls up to date weather forecast information from The Weather Channel for your website.New ReleasesApplication Management Library: ApplicationManagement v1.0: First ReleaseAudio Service - Play Wave Files From Windows Service: Audio Service v1.0: This is a working version of the Audio Service. Please use as you need to.AutoMapper: 1.0.1 for Silverlight 3.0 Alpha: AutoMapper for Silverlight 3.0. Features not supported: IDataReader mapping IListSource mapping All other features are supported.Buzz Dot Net: Buzz Dot Net v.1.10219: Buzz Dot Net Library (Parser & Objects) + WPF Example (using MVVM & Threading)Canvas VSDOC Intellisense: V 1.0.0.0a: This release contains two JavaScript files: canvas-utils.js (can be referenced in both runtime and development environment) canvas-vsdoc.js (must ...Control of payment proofs program for Greek citizens: Payment Proofs: source codeCourier: Beta 2: Added Rx Framework support and re-factored how message registration and un-registration works Blog post explaining the updates and re-factoring c...Cover Creator: Initial release: This is initial stable release. For now only in Polish language.Employee Scheduler: Employee Scheduler 2.2: Small Bug found. Small total hour calculation bug. See http://employeescheduler.codeplex.com/WorkItem/View.aspx?WorkItemId=6059 Extract the files...EnhSim: Release v1.9.7.1: Release v1.9.7.1Implemented Dislodged Foreign Object trinket Whispering Fanged Skull now also procs off Flame shock dots You can toggle bloodlust o...Extend SmallBasic: Teaching Extensions v.007: added SimpleSquareTest added Tortoise.Approve() for virtual proctor how to use virtual proctor: change the path in the proctor.txt file (located i...FolderSize: FolderSize.Win32.1.0.1.0: FolderSize.Win32.1.0.1.0 A simple utility intended to be used to scan harddrives for the folders that take most place and display this to the user...GLB Virtual Player Builder: v0.4.0 Beta: Allows for user to import and use archetypes for building players. The archetypes are contained in the file "archetypes.xml". This file is editab...Google Map WebPart from SharePoint List: GMap Stable Release: GMap Stable ReleaseHenge3D Physics Library for XNA: Henge3D Source (2010-02 R2): Fixed a build error related to an assembly attribute in XBOX 360 builds. Tweaked the controls in the sample when targeting the 360. Reduced the...Indexer: Beta Release 1: Just the initial/rough cut.NukeCS: NukeCS 5.2.3 Source Code: update version to 5.2.3ODOS: ODOS STABLE 1.5.0: Thank you for your patience while we develop this version. Not that much has been added, though. Just doing some sub-conscious stuff to make life...PoshBoard: PoshBoard 3.0 Beta 1: Welcome to the first beta release of PoshBoard 3.0 ! IMPORTANT WARNING : this release is absolutly not feature complete and is error-prone. Okay, ...Restart SQL Audit Policy and Job: Restart SQL 2008 Audit Policy and Job: This folder contains three pieces of source code: Server Audit Status (Started).xml - Import this on-schedule policy into your server's Policy-Ba...SAL- Self Artificial Learning: Artificial Learning 2AQV Working Proof Of Concept: This is the Simulation proof of concept version that comes after the 1aq version. AQ stands for Anwering Questions.SharePoint 2010 Word Automation: SP 2010 Word Automation - Workflow Actions 1.1: This release includes two new custom workflow activities for SharePoint designer Convert Folder Convert Library More information about these new...SharePoint Outlook Connector: Version 1.0.1.1: Exception Logging has been improved.Sharpy: Sharpy 1.2 Alpha: This is the third Sharpy release. A change has been made to allow overriding the master page from the controller. The release contains the single ...Silverlight Google Search Application: SL Google Search App Alpha: This is just a first alpha version of the application, as it looks like when I uploaded it to CodePlex. The application works, requires Silverlight...Starter Kit Mytrip.Mvc.Entity: Mytrip.Mvc.Entity 1.0 RC: EF Membership UserManager FileManager Localization Captcha ClientValidation Theme CrossBrowser VS 2010 RC MVC 2 RC db MSSQL2008thinktecture WSCF.blue: WSCF.blue V1 Update (1.0.6): This release is an update for WSCF.blue V1. Below are the bug fixes made since the V1.0.5 release: The data contract type filter was not including...TS3QueryLib.Net: TS3QueryLib.Net Version 0.18.13.0: Changelog Added overloads to all methods of QueryRunenr class handling permission tasks to allow passing of permission name instead of permissionid...Umbraco CMS: Umbraco 4.1 Beta 2: This is the second beta of Umbraco 4.1. Umbraco 4.1 is more advanced than ever, yet faster, lighter and simpler to use than ever. We, on behalf of...VCC: Latest build, v2.1.30218.0: Automatic drop of latest buildZack's Fiasco - Code Generated DAL: v1.2.4: Enhancements: SQL Server CRUD Stored Procedures added option for USE <db> added option to create or not create INSERT sprocs added option to cr...Most Popular ProjectsRawrWBFS ManagerAJAX Control ToolkitMicrosoft SQL Server Product Samples: DatabaseSilverlight ToolkitWindows Presentation Foundation (WPF)Image Resizer Powertoy Clone for WindowsASP.NETMicrosoft SQL Server Community & SamplesDotNetNuke® Community EditionMost Active ProjectsRawrSharpyDinnerNow.netBlogEngine.NETjQuery Library for SharePoint Web ServicesNB_Store - Free DotNetNuke Ecommerce Catalog Modulepatterns & practices – Enterprise LibraryPHPExcelFacebook Developer ToolkitFluent Ribbon Control Suite

    Read the article

  • ASP.NET MVC 3: Implicit and Explicit code nuggets with Razor

    - by ScottGu
    This is another in a series of posts I’m doing that cover some of the new ASP.NET MVC 3 features: New @model keyword in Razor (Oct 19th) Layouts with Razor (Oct 22nd) Server-Side Comments with Razor (Nov 12th) Razor’s @: and <text> syntax (Dec 15th) Implicit and Explicit code nuggets with Razor (today) In today’s post I’m going to discuss how Razor enables you to both implicitly and explicitly define code nuggets within your view templates, and walkthrough some code examples of each of them.  Fluid Coding with Razor ASP.NET MVC 3 ships with a new view-engine option called “Razor” (in addition to the existing .aspx view engine).  You can learn more about Razor, why we are introducing it, and the syntax it supports from my Introducing Razor blog post. Razor minimizes the number of characters and keystrokes required when writing a view template, and enables a fast, fluid coding workflow. Unlike most template syntaxes, you do not need to interrupt your coding to explicitly denote the start and end of server blocks within your HTML. The Razor parser is smart enough to infer this from your code. This enables a compact and expressive syntax which is clean, fast and fun to type. For example, the Razor snippet below can be used to iterate a collection of products and output a <ul> list of product names that link to their corresponding product pages: When run, the above code generates output like below: Notice above how we were able to embed two code nuggets within the content of the foreach loop.  One of them outputs the name of the Product, and the other embeds the ProductID within a hyperlink.  Notice that we didn’t have to explicitly wrap these code-nuggets - Razor was instead smart enough to implicitly identify where the code began and ended in both of these situations.  How Razor Enables Implicit Code Nuggets Razor does not define its own language.  Instead, the code you write within Razor code nuggets is standard C# or VB.  This allows you to re-use your existing language skills, and avoid having to learn a customized language grammar. The Razor parser has smarts built into it so that whenever possible you do not need to explicitly mark the end of C#/VB code nuggets you write.  This makes coding more fluid and productive, and enables a nice, clean, concise template syntax.  Below are a few scenarios that Razor supports where you can avoid having to explicitly mark the beginning/end of a code nugget, and instead have Razor implicitly identify the code nugget scope for you: Property Access Razor allows you to output a variable value, or a sub-property on a variable that is referenced via “dot” notation: You can also use “dot” notation to access sub-properties multiple levels deep: Array/Collection Indexing: Razor allows you to index into collections or arrays: Calling Methods: Razor also allows you to invoke methods: Notice how for all of the scenarios above how we did not have to explicitly end the code nugget.  Razor was able to implicitly identify the end of the code block for us. Razor’s Parsing Algorithm for Code Nuggets The below algorithm captures the core parsing logic we use to support “@” expressions within Razor, and to enable the implicit code nugget scenarios above: Parse an identifier - As soon as we see a character that isn't valid in a C# or VB identifier, we stop and move to step 2 Check for brackets - If we see "(" or "[", go to step 2.1., otherwise, go to step 3  Parse until the matching ")" or "]" (we track nested "()" and "[]" pairs and ignore "()[]" we see in strings or comments) Go back to step 2 Check for a "." - If we see one, go to step 3.1, otherwise, DO NOT ACCEPT THE "." as code, and go to step 4 If the character AFTER the "." is a valid identifier, accept the "." and go back to step 1, otherwise, go to step 4 Done! Differentiating between code and content Step 3.1 is a particularly interesting part of the above algorithm, and enables Razor to differentiate between scenarios where an identifier is being used as part of the code statement, and when it should instead be treated as static content: Notice how in the snippet above we have ? and ! characters at the end of our code nuggets.  These are both legal C# identifiers – but Razor is able to implicitly identify that they should be treated as static string content as opposed to being part of the code expression because there is whitespace after them.  This is pretty cool and saves us keystrokes. Explicit Code Nuggets in Razor Razor is smart enough to implicitly identify a lot of code nugget scenarios.  But there are still times when you want/need to be more explicit in how you scope the code nugget expression.  The @(expression) syntax allows you to do this: You can write any C#/VB code statement you want within the @() syntax.  Razor will treat the wrapping () characters as the explicit scope of the code nugget statement.  Below are a few scenarios where we could use the explicit code nugget feature: Perform Arithmetic Calculation/Modification: You can perform arithmetic calculations within an explicit code nugget: Appending Text to a Code Expression Result: You can use the explicit expression syntax to append static text at the end of a code nugget without having to worry about it being incorrectly parsed as code: Above we have embedded a code nugget within an <img> element’s src attribute.  It allows us to link to images with URLs like “/Images/Beverages.jpg”.  Without the explicit parenthesis, Razor would have looked for a “.jpg” property on the CategoryName (and raised an error).  By being explicit we can clearly denote where the code ends and the text begins. Using Generics and Lambdas Explicit expressions also allow us to use generic types and generic methods within code expressions – and enable us to avoid the <> characters in generics from being ambiguous with tag elements. One More Thing….Intellisense within Attributes We have used code nuggets within HTML attributes in several of the examples above.  One nice feature supported by the Razor code editor within Visual Studio is the ability to still get VB/C# intellisense when doing this. Below is an example of C# code intellisense when using an implicit code nugget within an <a> href=”” attribute: Below is an example of C# code intellisense when using an explicit code nugget embedded in the middle of a <img> src=”” attribute: Notice how we are getting full code intellisense for both scenarios – despite the fact that the code expression is embedded within an HTML attribute (something the existing .aspx code editor doesn’t support).  This makes writing code even easier, and ensures that you can take advantage of intellisense everywhere. Summary Razor enables a clean and concise templating syntax that enables a very fluid coding workflow.  Razor’s ability to implicitly scope code nuggets reduces the amount of typing you need to perform, and leaves you with really clean code. When necessary, you can also explicitly scope code expressions using a @(expression) syntax to provide greater clarity around your intent, as well as to disambiguate code statements from static markup. Hope this helps, Scott P.S. In addition to blogging, I am also now using Twitter for quick updates and to share links. Follow me at: twitter.com/scottgu

    Read the article

  • Analytic functions – they’re not aggregates

    - by Rob Farley
    SQL 2012 brings us a bunch of new analytic functions, together with enhancements to the OVER clause. People who have known me over the years will remember that I’m a big fan of the OVER clause and the types of things that it brings us when applied to aggregate functions, as well as the ranking functions that it enables. The OVER clause was introduced in SQL Server 2005, and remained frustratingly unchanged until SQL Server 2012. This post is going to look at a particular aspect of the analytic functions though (not the enhancements to the OVER clause). When I give presentations about the analytic functions around Australia as part of the tour of SQL Saturdays (starting in Brisbane this Thursday), and in Chicago next month, I’ll make sure it’s sufficiently well described. But for this post – I’m going to skip that and assume you get it. The analytic functions introduced in SQL 2012 seem to come in pairs – FIRST_VALUE and LAST_VALUE, LAG and LEAD, CUME_DIST and PERCENT_RANK, PERCENTILE_CONT and PERCENTILE_DISC. Perhaps frustratingly, they take slightly different forms as well. The ones I want to look at now are FIRST_VALUE and LAST_VALUE, and PERCENTILE_CONT and PERCENTILE_DISC. The reason I’m pulling this ones out is that they always produce the same result within their partitions (if you’re applying them to the whole partition). Consider the following query: SELECT     YEAR(OrderDate),     FIRST_VALUE(TotalDue)         OVER (PARTITION BY YEAR(OrderDate)               ORDER BY OrderDate, SalesOrderID               RANGE BETWEEN UNBOUNDED PRECEDING                         AND UNBOUNDED FOLLOWING),     LAST_VALUE(TotalDue)         OVER (PARTITION BY YEAR(OrderDate)               ORDER BY OrderDate, SalesOrderID               RANGE BETWEEN UNBOUNDED PRECEDING                         AND UNBOUNDED FOLLOWING),     PERCENTILE_CONT(0.95)         WITHIN GROUP (ORDER BY TotalDue)         OVER (PARTITION BY YEAR(OrderDate)),     PERCENTILE_DISC(0.95)         WITHIN GROUP (ORDER BY TotalDue)         OVER (PARTITION BY YEAR(OrderDate)) FROM Sales.SalesOrderHeader ; This is designed to get the TotalDue for the first order of the year, the last order of the year, and also the 95% percentile, using both the continuous and discrete methods (‘discrete’ means it picks the closest one from the values available – ‘continuous’ means it will happily use something between, similar to what you would do for a traditional median of four values). I’m sure you can imagine the results – a different value for each field, but within each year, all the rows the same. Notice that I’m not grouping by the year. Nor am I filtering. This query gives us a result for every row in the SalesOrderHeader table – 31465 in this case (using the original AdventureWorks that dates back to the SQL 2005 days). The RANGE BETWEEN bit in FIRST_VALUE and LAST_VALUE is needed to make sure that we’re considering all the rows available. If we don’t specify that, it assumes we only mean “RANGE BETWEEN UNBOUNDED PRECEDING AND CURRENT ROW”, which means that LAST_VALUE ends up being the row we’re looking at. At this point you might think about other environments such as Access or Reporting Services, and remember aggregate functions like FIRST. We really should be able to do something like: SELECT     YEAR(OrderDate),     FIRST_VALUE(TotalDue)         OVER (PARTITION BY YEAR(OrderDate)               ORDER BY OrderDate, SalesOrderID               RANGE BETWEEN UNBOUNDED PRECEDING                         AND UNBOUNDED FOLLOWING) FROM Sales.SalesOrderHeader GROUP BY YEAR(OrderDate) ; But you can’t. You get that age-old error: Msg 8120, Level 16, State 1, Line 5 Column 'Sales.SalesOrderHeader.OrderDate' is invalid in the select list because it is not contained in either an aggregate function or the GROUP BY clause. Msg 8120, Level 16, State 1, Line 5 Column 'Sales.SalesOrderHeader.SalesOrderID' is invalid in the select list because it is not contained in either an aggregate function or the GROUP BY clause. Hmm. You see, FIRST_VALUE isn’t an aggregate function. None of these analytic functions are. There are too many things involved for SQL to realise that the values produced might be identical within the group. Furthermore, you can’t even surround it in a MAX. Then you get a different error, telling you that you can’t use windowed functions in the context of an aggregate. And so we end up grouping by doing a DISTINCT. SELECT DISTINCT     YEAR(OrderDate),         FIRST_VALUE(TotalDue)              OVER (PARTITION BY YEAR(OrderDate)                   ORDER BY OrderDate, SalesOrderID                   RANGE BETWEEN UNBOUNDED PRECEDING                             AND UNBOUNDED FOLLOWING),         LAST_VALUE(TotalDue)             OVER (PARTITION BY YEAR(OrderDate)                   ORDER BY OrderDate, SalesOrderID                   RANGE BETWEEN UNBOUNDED PRECEDING                             AND UNBOUNDED FOLLOWING),     PERCENTILE_CONT(0.95)          WITHIN GROUP (ORDER BY TotalDue)         OVER (PARTITION BY YEAR(OrderDate)),     PERCENTILE_DISC(0.95)         WITHIN GROUP (ORDER BY TotalDue)         OVER (PARTITION BY YEAR(OrderDate)) FROM Sales.SalesOrderHeader ; I’m sorry. It’s just the way it goes. Hopefully it’ll change the future, but for now, it’s what you’ll have to do. If we look in the execution plan, we see that it’s incredibly ugly, and actually works out the results of these analytic functions for all 31465 rows, finally performing the distinct operation to convert it into the four rows we get in the results. You might be able to achieve a better plan using things like TOP, or the kind of calculation that I used in http://sqlblog.com/blogs/rob_farley/archive/2011/08/23/t-sql-thoughts-about-the-95th-percentile.aspx (which is how PERCENTILE_CONT works), but it’s definitely convenient to use these functions, and in time, I’m sure we’ll see good improvements in the way that they are implemented. Oh, and this post should be good for fellow SQL Server MVP Nigel Sammy’s T-SQL Tuesday this month.

    Read the article

  • Product Development Investment: A Measure of Vendor Performance

    - by Jim Mcglothlin
    The relationship between a large, complex organization and its key suppliers of information technology is normally more than just "strategic". Expectations about the duration of the relationship typically exceed 20 years. Enterprise applications and technology infrastructure are not expected to be changed out like petunias. So how would you rate the due diligence processes as performed in Higher Education when selecting critical, transformational information technology? My observation: I see a lot of effort put into elaborate demonstration of basic software functionality. I see a lot of attention paid to the cost element of technology acquisition, including the contracted cost of implementation consulting services. But the factor that receives only cursory analysis and due diligence is long-term performance--the ability of a vendor to grow, expand, and develop, and bring its customers along with it. So what should you look for in a long-term IT supplier? Oracle has a public track record for product development. The annual investment has been on a run rate of almost $3 Billion organic product development. Oracle's well-publicized acquisitions and mergers have been supplemental to its R&D. This is important for Higher Education. Another meaningful way to evaluate a company is to look at the tangible track record of enhancement. Consider the Oracle-PeopleSoft enterprise business platform since acquired by Oracle 6 years ago: Product or Technology Enhancement Customer or User Impact Service Oriented Architecture (SOA) 300+ new web services delivered in versions 9.0 & 9.1 provide flexibility, so that customers can integrate PeopleSoft with other applications. Campus Solutions has added Admissions and Constituent Web Services. Constituent Relationship Management PeopleSoft CRM 9.1 for Higher Education introduced new process flows for student recruiting and retention to support "Student Success" initiatives. A 360 view of the constituent is now delivered, and the concept of a single-stop Student Services Center is now in CRM 9.1 with tight integration to PeopleSoft Campus Solutions. Human Capital Management Contract Pay for Education, with flexibility for configuration and calculation, has been extended in HCM 9.1. New chartfield integration among Project Costing - Time & Labor - Payroll to serve the labor distribution requirements for Grants / Sponsored Research. Talent Management PeopleSoft 9.0 and 9.1 feature an integrated talent management approach centered on definitions in "Profile Manager", with all new usability improvements. Internal and external candidate pools, and the entire recruitment process, are driven by delivered configurable selection and on-boarding processes. Interview scheduling, and online job offers are newly delivered processes. Performance Management PeopleSoft HCM ePerformance 9.1 will include significant new functionality designed to help organizations more effectively align business objectives with employee goals. Using an Organization Chart view, your business goals can flow down to become tangible objectives per employee. Succession Planning / Workforce Development New in HCM 9.0, enhanced in 9.1, is a planning capability for regular or unusual (major organizational change) succession of internal or external candidates. PeopleSoft supports employee-based career planning, which ultimately increases the integrity of the succession planning process (identify their career needs, plans, preferences, and interests). Dashboards / Oracle Business Intelligence Application Suite Oracle Human Resources Analytics provides the workforce information foundation that integrates data from HR functional areas and Finance. Oracle Human Resources Analytics delivers 9 dashboards and over 200 reports. Provide your HR professionals and front-line managers the tools to analyze workforce staffing, retention, productivity, to better source high-quality applicants, and to reduce absence costs. Multi-year Planning and Commitment Control External funding sources, especially Grants, require a multi-year encumbrance business process. PeopleSoft HCM 9.1 adds multi-year funding and commitment control, including budget checking. The newly designed Real Time Budget Checking will provide the customer with an updated snapshot of their budget and encumbrances at any given time. Position Budgeting with Hyperion Hyperion Planning world-class products now include delivered integration to PeopleSoft HCM. Position Budgeting is available in the new Public Sector Planning module of Hyperion. Web 2.0 features for the latest in usability PeopleSoft 9.1 features a contemporary internet user experience: Partial-page refreshing Drag and drop pagelets New menu structure Navigation pagelets Modal popup message windows Favorites & recently used links Type-ahead Drag and drop grid columns, pop-out grids Portal Workspaces Enterprise 2.0 for your collaborative web communities, using new content management, along with Wikis, blogs, and discussion forums in PeopleSoft Portal 9.1. PeopleTools enhanced by Oracle Fusion Middleware Standards-based tools have been added to the PeopleTools application infrastructure: BI (XML) Publisher, Java tools. Certified for use with PeopleSoft: Oracle Business Intelligence (OBIEE), Oracle Enterprise Manager, Oracle Weblogic Server, Oracle SOA Suite. Hosting for PeopleSoft applications A solid new deployment option: Oracle On Demand remote hosting center for high scalability, security, and continuity of operations. Business Process Outsourcing (BPO) for HCM / Payroll functions Partnership with AT&T provides hosting of HR/Payroll application along with payroll business process operations, and subscription-based service fees (SaaS). AT&T BPO full service includes pay sheet processing, bank and 3rd party file transfer, payroll tax handling, etc. Continuous Delivery Model Feature Packs provide faster time-to-benefit; new features become available in PeopleSoft 9.1 (or Campus Solutions 9.0) without need to perform upgrade. Golden person data model across all campus applications Oracle Higher Education Constituent Hub provides synchronization and data governance of person data across any application, e.g. HR/ Payroll, Student Information System, Housing, Emergency Contact, LMS, CRM. Oracle's aggressive enhancement plans within the "Applications Unlimited" program continue, as new functionality is under development for a new version of a PeopleSoft release planned for 2012. Meanwhile, new capabilities are planned on an annual basis in Feature Packs. PeopleSoft just delivered the HCM 2010 Feature Pack and another is planned for 2011. In February we plan to have over 100 customers from our Customer Advisory Boards at our PeopleSoft Development Center in California to review designs for all of these releases. For those of you near New York City The investment and progressive development story described above is the subject of an Oracle road show event on February 9, 2011. Charting Your Course with Oracle Applications is a global event series designed to help business and IT executives assess the impact of new inflection points on their business and applications roadmap: changing workforces, shifting customer and constituent bases, and increased volatility. Learn how innovations ranging from new deployment models like cloud computing to the introduction of social applications and smart devices are delivering results across all areas of business and industry. THIS DOCUMENT IS FOR INFORMATIONAL PURPOSES ONLY AND MAY NOT BE INCORPORATED INTO A CONTRACT OR AGREEMENT.

    Read the article

  • SQL SERVER – Weekly Series – Memory Lane – #048

    - by Pinal Dave
    Here is the list of selected articles of SQLAuthority.com across all these years. Instead of just listing all the articles I have selected a few of my most favorite articles and have listed them here with additional notes below it. Let me know which one of the following is your favorite article from memory lane. 2007 Order of Result Set of SELECT Statement on Clustered Indexed Table When ORDER BY is Not Used Above theory is true in most of the cases. However SQL Server does not use that logic when returning the resultset. SQL Server always returns the resultset which it can return fastest.In most of the cases the resultset which can be returned fastest is the resultset which is returned using clustered index. Effect of TRANSACTION on Local Variable – After ROLLBACK and After COMMIT One of the Jr. Developer asked me this question (What will be the Effect of TRANSACTION on Local Variable – After ROLLBACK and After COMMIT?) while I was rushing to an important meeting. I was getting late so I asked him to talk with his Application Tech Lead. When I came back from meeting both of them were looking for me. They said they are confused. I quickly wrote down following example for them. 2008 SQL SERVER – Guidelines and Coding Standards Complete List Download Coding standards and guidelines are very important for any developer on the path of a successful career. A coding standard is a set of guidelines, rules and regulations on how to write code. Coding standards should be flexible enough or should take care of the situation where they should not prevent best practices for coding. They are basically the guidelines that one should follow for better understanding. Download Guidelines and Coding Standards complete List Download Get Answer in Float When Dividing of Two Integer Many times we have requirements of some calculations amongst different fields in Tables. One of the software developers here was trying to calculate some fields having integer values and divide it which gave incorrect results in integer where accurate results including decimals was expected. Puzzle – Computed Columns Datatype Explanation SQL Server automatically does a cast to the data type having the highest precedence. So the result of INT and INT will be INT, but INT and FLOAT will be FLOAT because FLOAT has a higher precedence. If you want a different data type, you need to do an EXPLICIT cast. Renaming SP is Not Good Idea – Renaming Stored Procedure Does Not Update sys.procedures I have written many articles about renaming a tables, columns and procedures SQL SERVER – How to Rename a Column Name or Table Name, here I found something interesting about renaming the stored procedures and felt like sharing it with you all. The interesting fact is that when we rename a stored procedure using SP_Rename command, the Stored Procedure is successfully renamed. But when we try to test the procedure using sp_helptext, the procedure will be having the old name instead of new names. 2009 Insert Values of Stored Procedure in Table – Use Table Valued Function It is clear from the result set that , where I have converted stored procedure logic into the table valued function, is much better in terms of logic as it saves a large number of operations. However, this option should be used carefully. The performance of the stored procedure is “usually” better than that of functions. Interesting Observation – Index on Index View Used in Similar Query Recently, I was working on an optimization project for one of the largest organizations. While working on one of the queries, we came across a very interesting observation. We found that there was a query on the base table and when the query was run, it used the index, which did not exist in the base table. On careful examination, we found that the query was using the index that was on another view. This was very interesting as I have personally never experienced a scenario like this. In simple words, “Query on the base table can use the index created on the indexed view of the same base table.” Interesting Observation – Execution Plan and Results of Aggregate Concatenation Queries Working with SQL Server has never seemed to be monotonous – no matter how long one has worked with it. Quite often, I come across some excellent comments that I feel like acknowledging them as blog posts. Recently, I wrote an article on SQL SERVER – Execution Plan and Results of Aggregate Concatenation Queries Depend Upon Expression Location, which is well received in the community. 2010 I encourage all of you to go through complete series and write your own on the subject. If you write an article and send it to me, I will publish it on this blog with due credit to you. If you write on your own blog, I will update this blog post pointing to your blog post. SQL SERVER – ORDER BY Does Not Work – Limitation of the View 1 SQL SERVER – Adding Column is Expensive by Joining Table Outside View – Limitation of the View 2 SQL SERVER – Index Created on View not Used Often – Limitation of the View 3 SQL SERVER – SELECT * and Adding Column Issue in View – Limitation of the View 4 SQL SERVER – COUNT(*) Not Allowed but COUNT_BIG(*) Allowed – Limitation of the View 5 SQL SERVER – UNION Not Allowed but OR Allowed in Index View – Limitation of the View 6 SQL SERVER – Cross Database Queries Not Allowed in Indexed View – Limitation of the View 7 SQL SERVER – Outer Join Not Allowed in Indexed Views – Limitation of the View 8 SQL SERVER – SELF JOIN Not Allowed in Indexed View – Limitation of the View 9 SQL SERVER – Keywords View Definition Must Not Contain for Indexed View – Limitation of the View 10 SQL SERVER – View Over the View Not Possible with Index View – Limitations of the View 11 2011 Startup Parameters Easy to Configure If you are a regular reader of this blog, you must be aware that I have written about SQL Server Denali recently. Here is the quickest way to reach into the screen where we can change the startup parameters. Go to SQL Server Configuration Manager >> SQL Server Services >> Right Click on the Server >> Properties >> Startup Parameters 2012 Validating Unique Columnname Across Whole Database I sometimes come across very strange requirements and often I do not receive a proper explanation of the same. Here is the one of those examples. For example “Our business requirement is when we add new column we want it unique across current database.” Read the solution to this strange request in this blog post. Excel Losing Decimal Values When Value Pasted from SSMS ResultSet It is very common when users are coping the resultset to Excel, the floating point or decimals are missed. The solution is very much simple and it requires a small adjustment in the Excel. By default Excel is very smart and when it detects the value which is getting pasted is numeric it changes the column format to accommodate that. Basic Calculation and PEMDAS Order of Operation Read this interesting blog post for fantastic conversation about the subject. Copy Column Headers from Resultset – SQL in Sixty Seconds #027 – Video http://www.youtube.com/watch?v=x_-3tLqTRv0 Delete From Multiple Table – Update Multiple Table in Single Statement There are two questions which I get every single day multiple times. In my gmail, I have created standard canned reply for them. Let us see the questions here. I want to delete from multiple table in a single statement how will I do it? I want to update multiple table in a single statement how will I do it? Read the answer in the blog post. Reference: Pinal Dave (http://blog.sqlauthority.com) Filed under: Memory Lane, PostADay, SQL, SQL Authority, SQL Query, SQL Server, SQL Tips and Tricks, T SQL, Technology

    Read the article

  • Does Test Driven Development (TDD) improve Quality and Correctness? (Part 1)

    - by David V. Corbin
    Since the dawn of the computer age, various methodologies have been introduced to improve quality and reduce cost. In this posting, I will by sharing my experiences with Test Driven Development; both its benefits and limitations. To start this topic, we need to agree on what TDD is. The first is to define each of the three words as used in this context. Test - An item or action which measures something in some quantifiable form. Driven - The primary motivation or focus of a series of activities (process) Development - All phases of a software project/product from concept through delivery. The above are very simple definitions that result in the following: "TDD is a process where the primary focus is on measuring and quantifying all aspects of the creation of a (software) product." There are many places where TDD is used outside of software development, even though it is not known by this name. Consider the (conventional) education process that most of us grew up on. The focus was to get the best grades as measured by different tests. Many of these tests measured rote memorization and not understanding of the subject matter. The result of this that many people graduated with high scores but without "quality and correctness" in their ability to utilize the subject matter (of course, the flip side is true where certain people DID understand the material but were not very good at taking this type of test). Returning to software development, let us look at some common scenarios. While these items are generally applicable regardless of platform, language and tools; the remainder of this post will utilize Microsoft Visual Studio and Team Foundation Server (TFS) for examples. It should be realized that everyone does at least some aspect of TDD. At the most rudimentary level, getting a program to compile involves a "pass/fail" measurement (is the syntax valid) that drives their ability to proceed further (run the program). Other developers may create "Unit Tests" in the belief that having a test for every method/property of a class and good code coverage is the goal of TDD. These items may be helpful and even important, but really only address a small aspect of the overall effort. To see TDD in a bigger view, lets identify the various activities that are part of the Software Development LifeCycle. These are going to be presented in a Waterfall style for simplicity, but each item also occurs within Iterative methodologies such as Agile/Scrum. the key ones here are: Requirements Gathering Architecture Design Implementation Quality Assurance Can each of these items be subjected to a process which establishes metrics (quantified metrics) that reflect both the quality and correctness of each item? It should be clear that conventional Unit Tests do not apply to all of these items; at best they can verify that a local aspect (e.g. a Class/Method) of implementation matches the (test writers perspective of) the appropriate design document. So what can we do? For each of area, the goal is to create tests that are quantifiable and durable. The ability to quantify the measurements (beyond a simple pass/fail) is critical to tracking progress(eventually measuring the level of success that has been achieved) and for providing clear information on what items need to be addressed (along with the appropriate time to address them - in varying levels of detail) . Durability is important so that the test can be reapplied (ideally in an automated fashion) over the entire cycle. Returning for a moment back to our "education example", one must also be careful of how the tests are organized and how the measurements are taken. If a test is in a multiple choice format, there is a significant statistical probability that a correct answer might be the result of a random guess. Also, in many situations, having the student simply provide a final answer can obscure many important elements. For example, on a math test, having the student simply provide a numeric answer (rather than showing the methodology) may result in a complete mismatch between the process and the result. It is hard to determine which is worse: The student who makes a simple arithmetric error at one step of a long process (resulting in a wrong answer) or The student who (without providing the "workflow") uses a completely invalid approach, yet still comes up with the right number. The "Wrong Process"/"Right Answer" is probably the single biggest problem in software development. Even very simple items can suffer from this. As an example consider the following code for a "straight line" calculation....Is it correct? (for Integral Points)         int Solve(int m, int b, int x) { return m * x + b; }   Most people would respond "Yes". But let's take the question one step further... Is it correct for all possible values of m,b,x??? (no fair if you cheated by being focused on the bolded text!)  Without additional information regarding constrains on "the possible values of m,b,x" the answer must be NO, there is the risk of overflow/wraparound that will produce an incorrect result! To properly answer this question (i.e. Test the Code), one MUST be able to backtrack from the implementation through the design, and architecture all the way back to the requirements. And the requirement itself must be tested against the stakeholder(s). It is only when the bounding conditions are defined that it is possible to determine if the code is "Correct" and has "Quality". Yet, how many of us (myself included) have written such code without even thinking about it. In many canses we (think we) "know" what the bounds are, and that the code will be correct. As we all know, requirements change, "code reuse" causes implementations to be applied to different scenarios, etc. This leads directly to the types of system failures that plague so many projects. This approach to TDD is much more holistic than ones which start by focusing on the details. The fundamental concepts still apply: Each item should be tested. The test should be defined/implemented before (or concurrent with) the definition/implementation of the actual item. We also add concepts that expand the scope and alter the style by recognizing: There are many things beside "lines of code" that benefit from testing (measuring/evaluating in a formal way) Correctness and Quality can not be solely measured by "correct results" In the future parts, we will examine in greater detail some of the techniques that can be applied to each of these areas....

    Read the article

< Previous Page | 34 35 36 37 38 39 40 41 42 43  | Next Page >