Search Results

Search found 6715 results on 269 pages for 'preg match all'.

Page 38/269 | < Previous Page | 34 35 36 37 38 39 40 41 42 43 44 45  | Next Page >

  • A regex to match a comma that isn't surrounded by quotes.

    - by Rayne
    I'm using Clojure, so this is in the context of Java regexes. Here is an example string: "{:a "ab,cd, efg", :b "ab,def, egf,", :c "Conjecture"}" The important bits are the commas after each string. I'd like to be able to replace them with newline characters with Java's replaceAll method. A regex that will match any comma that is not surrounded by quotes will do. If I'm not coming across well, please ask and I'll be happily to clarify anything. edit: sorry for the confusion in the title. I haven't been awake very long. String: {:a "ab, cd efg",} <-- In this example, the comma at the end would be matched, but the ones inside the quote would not.

    Read the article

  • How can I make a case-insensitive regexp match for Russian letters?

    - by jonny
    I have list of catalog paths and need to filter out some of them. My match pattern is in a non-Unicode encoding. I tried the following: require 5.004; use POSIX qw(locale_h); my $old_locale = setlocale(LC_ALL); setlocale(LC_ALL, "ru_RU.cp1251"); @{$data -> {doc_folder_rights}} = grep { # catalog path pattern in $_REQUEST{q} $_->{doc_folder} =~/$_REQUEST{q}/i; } @{$data -> {doc_folder_rights}}; setlocale(LC_ALL, $old_locale); What I need is case-insensitive regexp pattern matching when pattern contains russsian letters.

    Read the article

  • How can I extract the nth occurrence of a match in a Perl regex?

    - by Zaid
    Is it possible to extract the n'th match in a string of single-quoted words? use strict; use warnings; my $string1 = '\'I want to\' \'extract the word\' \'Perl\',\'from this string\''; my $string2 = '\'What about\',\'getting\',\'Perl\',\'from\',\'here\',\'?\''; sub extract_quoted { my ($string, $index) = @_; my ($wanted) = $string =~ /some_regex_using _$index/; return $wanted; } extract_wanted ($string1, 3); # Should return 'Perl', with quotes extract_wanted ($string2, 3); # Should return 'Perl', with quotes

    Read the article

  • Why is this exception thrown when trying to match this regex in Java?

    - by Scott Ferguson
    I'm trying to match a specific string out of a an HTML document and have this regex pattern to grab it: Pattern somePattern = Pattern.compile("var json = ({\"r\":\"^d1\".*});"); However when I try to hit that code at runtime, I get this error: FATAL EXCEPTION: Timer-0 java.util.regex.PatternSyntaxException: Syntax error U_REGEX_RULE_SYNTAX near index 13: var json = ({"r":"^d1".*}); ^ at com.ibm.icu4jni.regex.NativeRegEx.open(Native Method) at java.util.regex.Pattern.compileImpl(Pattern.java:383) at java.util.regex.Pattern.<init>(Pattern.java:341) at java.util.regex.Pattern.compile(Pattern.java:317) Can anybody tell me what I'm doing wrong?

    Read the article

  • Using PIG with Hadoop, how do I regex match parts of text with an unknown number of groups?

    - by lmonson
    I'm using Amazon's elastic map reduce. I have log files that look something like this random text foo="1" more random text foo="2" more text noise foo="1" blah blah blah foo="1" blah blah foo="3" blah blah foo="4" ... How can I write a pig expression to pick out all the numbers in the 'foo' expressions? I prefer tuples that look something like this: (1,2) (1) (1,3,4) I've tried the following: TUPLES = foreach LINES generate FLATTEN(EXTRACT(line,'foo="([0-9]+)"')); But this yields only the first match in each line: (1) (1) (1)

    Read the article

  • How to match ColdFusion encryption with Java 1.4.2?

    - by JohnTheBarber
    * sweet - thanks to Edward Smith for the CF Technote that indicated the key from ColdFusion was Base64 encoded. See generateKey() for the 'fix' My task is to use Java 1.4.2 to match the results a given ColdFusion code sample for encryption. Known/given values: A 24-byte key A 16-byte salt (IVorSalt) Encoding is Hex Encryption algorithm is AES/CBC/PKCS5Padding A sample clear-text value The encrypted value of the sample clear-text after going through the ColdFusion code Assumptions: Number of iterations not specified in the ColdFusion code so I assume only one iteration 24-byte key so I assume 192-bit encryption Given/working ColdFusion encryption code sample: <cfset ThisSalt = "16byte-salt-here"> <cfset ThisAlgorithm = "AES/CBC/PKCS5Padding"> <cfset ThisKey = "a-24byte-key-string-here"> <cfset thisAdjustedNow = now()> <cfset ThisDateTimeVar = DateFormat( thisAdjustedNow , "yyyymmdd" )> <cfset ThisDateTimeVar = ThisDateTimeVar & TimeFormat( thisAdjustedNow , "HHmmss" )> <cfset ThisTAID = ThisDateTimeVar & "|" & someOtherData> <cfset ThisTAIDEnc = Encrypt( ThisTAID , ThisKey , ThisAlgorithm , "Hex" , ThisSalt)> My Java 1.4.2 encryption/decryption code swag: package so.example; import java.security.*; import javax.crypto.Cipher; import javax.crypto.spec.IvParameterSpec; import javax.crypto.spec.SecretKeySpec; import org.apache.commons.codec.binary.*; public class SO_AES192 { private static final String _AES = "AES"; private static final String _AES_CBC_PKCS5Padding = "AES/CBC/PKCS5Padding"; private static final String KEY_VALUE = "a-24byte-key-string-here"; private static final String SALT_VALUE = "16byte-salt-here"; private static final int ITERATIONS = 1; private static IvParameterSpec ivParameterSpec; public static String encryptHex(String value) throws Exception { Key key = generateKey(); Cipher c = Cipher.getInstance(_AES_CBC_PKCS5Padding); ivParameterSpec = new IvParameterSpec(SALT_VALUE.getBytes()); c.init(Cipher.ENCRYPT_MODE, key, ivParameterSpec); String valueToEncrypt = null; String eValue = value; for (int i = 0; i < ITERATIONS; i++) { // valueToEncrypt = SALT_VALUE + eValue; // pre-pend salt - Length > sample length valueToEncrypt = eValue; // don't pre-pend salt Length = sample length byte[] encValue = c.doFinal(valueToEncrypt.getBytes()); eValue = Hex.encodeHexString(encValue); } return eValue; } public static String decryptHex(String value) throws Exception { Key key = generateKey(); Cipher c = Cipher.getInstance(_AES_CBC_PKCS5Padding); ivParameterSpec = new IvParameterSpec(SALT_VALUE.getBytes()); c.init(Cipher.DECRYPT_MODE, key, ivParameterSpec); String dValue = null; char[] valueToDecrypt = value.toCharArray(); for (int i = 0; i < ITERATIONS; i++) { byte[] decordedValue = Hex.decodeHex(valueToDecrypt); byte[] decValue = c.doFinal(decordedValue); // dValue = new String(decValue).substring(SALT_VALUE.length()); // when salt is pre-pended dValue = new String(decValue); // when salt is not pre-pended valueToDecrypt = dValue.toCharArray(); } return dValue; } private static Key generateKey() throws Exception { // Key key = new SecretKeySpec(KEY_VALUE.getBytes(), _AES); // this was wrong Key key = new SecretKeySpec(new BASE64Decoder().decodeBuffer(keyValueString), _AES); // had to un-Base64 the 'known' 24-byte key. return key; } } I cannot create a matching encrypted value nor decrypt a given encrypted value. My guess is it's something to do with how I'm handling the initial vector/salt. I'm not very crypto-savvy but I'm thinking I should be able to take the sample clear-text and produce the same encrypted value in Java as ColdFusion produced. I am able to encrypt/decrypt my own data with my Java code (so I'm consistent) but I cannot match nor decrypt the ColdFusion sample encrypted value. I have access to a local webservice that can test the encrypted output. The given ColdFusion output sample passes/decrypts fine (of course). If I try to decrypt the same sample with my Java code (using the actual key and salt) I get a "Given final block not properly padded" error. I get the same net result when I pass my attempt at encryption (using the actual key and salt) to the test webservice. Any Ideas?

    Read the article

  • How to match the last url in a line containing multiple urls, using regular expressions?

    - by Mert Nuhoglu
    I want to write a regex that matches a url that ends with ".mp4" given that there are multiple urls in a line. For example, for the following line: "http://www.link.org/1610.jpg","Debt","http://www.archive.org/610_.mp4","66196517" Using the following pattern matches from the first http until mp4. (http:\/\/[^"].*?\.mp4)[",].*? How can I make it match only the last url only? Note that, the lines may contain any number of urls and anything in between. But only the last url contains .mp4 ending.

    Read the article

  • Code Signing Identity does not match in my keychain, for mac app store developing?

    - by larntin
    hi, 1, I already download the "Apple Worldwide Developer Relations Certification Authority",and add it into my keychain. 2, My team leader already had created two Cers for Mac App store developing, I download and add it into my keychain. 3, I used two methods to sign my add, but failed all. First, add code sign section in my .xcodeproj(3.2.5). Second, I used script: productbuild --component ./bin/MAS_Release/MyApp.app /Applications --sign "3rd Party Mac Developer Application: My Company Co., Ltd." --product ./src/MyApp/MyApp-Info.plist MyApp.pkg But it failed with information: Code Signing Identity '3rd Party Mac Developer Application: My Company Co., Ltd.' does not match any valid, non-expired, code-signing certificate in your keychain. I observed that my certifications in keychain don't have small trangle. how make the small trangle absence?(when I'am importing the Cers from my Agent, it don't have the trangle absence)

    Read the article

  • If .net sha1 hash expects a byte array, and php sha1() wants a string, can I match the results?

    - by lynn
    I have a set of bytes I want to apply an sha1 hash to. One hash will be in .net, the other in PHP. Then I'll test to see if they match. In .net, you can create a byte array and use sha.ComputeHash(). byte[] data = new byte[DATA_SIZE]; byte[] result; SHA1 sha = new SHA1CryptoServiceProvider(); // This is one implementation of the abstract class SHA1. result = sha.ComputeHash(data); In PHP, you call sha1($string). I can't do anything about the .net side of the code, but how can I get the same hash out of PHP that .net will generate? Please note: I am ONLY able to work on the PHP side of this. The .net stuff is fixed and can't be modified. Thanks!

    Read the article

  • How to let the matcher to match the second invocation on mock?

    - by Alex Luya
    I have an interface like this public interface EventBus{ public void fireEvent(GwtEvent<?> event); } and test code(testng method) looks like this: @Test public void testFireEvent(){ EventBus mock=mock(EventBus.class); //when both Event1 and Event2 are subclasses of GwtEvent<?> mock.fireEvent(new Event1()); mock.fireEvent(new Event2()); //then verify(mock).fireEvent(argThat(new Event2Matcher())); } Event2Matcher looks like this: private class Event2Matcher extends ArgumentMatcher<Event2> { @Override public boolean matches(Object arg) { return ((Event2) arg).getSth==sth; } } But get an error indicating that: Event1 can't be cast to Event2 And obviously,the matcher matched the first invoking mock.fireEvent(new Event1()); So,the statement within matcher return ((Event2) arg).getSth==sth; Will throw out this exception.So the question is how to let verify(mock).fireEvent(argThat(new Event2Matcher())); to match the second invoking?

    Read the article

  • What's the best way to match a query to a set of keywords?

    - by Ryan Detzel
    Pretty much what you would assume Google does. Advertisers come in and big on keywords, lets say "ipod", "ipod nano", "ipod 60GB", "used ipod", etc. Then we have a query, "I want to buy an ipod nano" or "best place to buy used ipods" what kind of algorithms and systems are used to match those queries to the keyword set. I would imagine that some of those keyword sets are huge, 100k keywords made up of one or more actual words. on top of that queries can be 1-n words as well. Any thoughts, links to wikipedia I can start reading? From what I know already I would use some stemmed hash in disk(CDB?) and a bloom filter to check to see if I should even go to disk.

    Read the article

  • Is it possible to match with decomposed sequences in F#?

    - by Ball
    I seem to remember an older version of F# allowing structural decomposition when matching sequences just like lists. Is there a way to use the list syntax while keeping the sequence lazy? I'm hoping to avoid a lot of calls to Seq.head and Seq.skip 1. I'm hoping for something like: let decomposable (xs:seq<'a>) = match xs with | h :: t -> true | _ -> false seq{ 1..100 } |> decomposable But this only handles lists and gives a type error when using sequences. When using List.of_seq, it seems to evaluate all the elements in the sequence, even if it is infinite.

    Read the article

  • Can a regex return a match that's not a part of the original string?

    - by Vishnu
    I'm using an application that requires me to provide a regex for various files. It uses the matches from the regex to uniquely identify each file and then use a data store to retrieve metadata about these files. there is however a problem with the application, so it assumes that the data which is used to identify each file is only numeric data. Hence, it stores the results of matches in integers. I control the data store but not the names of the files. Since the application has a bug in it, I was hoping that I could use an encoding scheme to convert the non-numeric data to an integer. But for that I'd require the regex to return something that's not part of the original string as a match. Is this possible?

    Read the article

  • HELP!! Implementing a search to match the specified author and displaying a book by the specified publisher

    - by Brian
    Hey guys! So i'm having problems with my assignment. I successfully got it to run multiple last names by the author, but now, I need to find all books by author, which means searching the collection for all books that match the specified author and I also need to find all books by publisher, which displays a list of books by the specified publisher. How would I implement this? Would I use string or vector? Any help will be much appreciated!

    Read the article

  • How to generate random strings that match a given regexp?

    - by Pies
    Duplicate: Random string that matches a regexp No, it isn't. I'm looking for an easy and universal method, one that I could actually implement. That's far more difficult than randomly generating passwords. I want to create an application that takes a regular expression, and shows 10 randomly generated strings that match that expression. It's supposed to help people better understand their regexps, and to decide i.e. if they're secure enough for validation purposes. Does anyone know of an easy way to do that? One obvious solution would be to write (or steal) a regexp parser, but that seems really over my head. I repeat, I'm looking for an easy and universal way to do that. Edit: Brute force approach is out of the question. Assuming the random strings would just be [a-z0-9]{10} and 1 million iterations per second, it would take 65 years to iterate trough the space of all 10-char strings.

    Read the article

  • SQL Server 2008: The columns in table do not match an existing primary key or unique constraint

    - by 109221793
    Hi guys, I need to make some changes to a SQL Server 2008 database. This requires the creation of a new table, and inserting a foreign key in the new table that references the Primary key of an already existing table. So I want to set up a relationship between my new tblTwo, which references the primary key of tblOne. However when I tried to do this (through SQL Server Management Studio) I got the following error: The columns in table 'tblOne' do not match an existing primary key or UNIQUE constraint I'm not really sure what this means, and I was wondering if there was any way around it?

    Read the article

  • How to select parent object of a hyperlink whose href match the requested page/file name using jQuer

    - by ARS
    How to select parent object of a hyperlink whose href match the requested page/file name using jQuery? I have following code <div> <div class="menu-head"> <a href="empdet.aspx">employees</a> <a href="custdet.aspx">customers</a> </div> <div class="menu-head"> <a href="depdet.aspx">departments</a> </div> <div> I want a Jquery to change the color of the parent div corresponding a hyperlink. If the user is browsing custdet.aspx the respective parent div background should be changed to red. Edit: I have a method to retrieve the file name. I just need the right selector to select the parent.

    Read the article

  • Removing certain characters in all rows that match a regex?

    - by user001
    I'd like to change {foo, {bar}, foobar} to {foo, bar, foobar} in all rows that match '{.*{'. I.e. remove all curly braces { and } except the outer most pair. So doing mysql -h $H -u $U -p$P $DB -B -e "SELECT id FROM t WHERE col REGEXP '{.*{'" > bad.txt selects all the rows that will need this substitution. How do I make this substitution very quickly? EDIT: Could I do it by update table set column = REPLACE(column,'{',''); Then restore the out most pair update table set column = REPLACE(column,'^','{'); update table set column = REPLACE(column,'$','}');

    Read the article

  • How to Get the F# Name of a Module, Function, etc. From Quoted Expression Match

    - by Stephen Swensen
    I continue to work on a printer for F# quoted expressions, it doesn't have to be perfect, but I'd like to see what is possible. The active patterns in Microsoft.FSharp.Quotations.Patterns and Microsoft.FSharp.Quotations.DerivedPatterns used for decomposing quoted expressions will typically provide MemberInfo instances when appropriate, these can be used to obtain the name of a property, function, etc. and their "declaring" type, such as a module or static class. The problem is, I only know how to obtain the CompiledName from these instances but I'd like the F# name. For example, > <@ List.mapi (fun i j -> i+j) [1;2;3] @> |> (function Call(_,mi,_) -> mi.DeclaringType.Name, mi.Name);; val it : string * string = ("ListModule", "MapIndexed") How can this match be rewritten to return ("List", "mapi")? Is it possible?

    Read the article

  • What's the fastest way to search a very long list of words for a match in actionscript 3?

    - by Nuthman
    So I have a list of words (the entire English dictionary). For a word matching game, when a player moves a piece I need to check the entire dictionary to see if the the word that the player made exists in the dictionary. I need to do this as quickly as possible. simply iterating through the dictionary is way too slow. What is the quickest algorithm in AS3 to search a long list like this for a match, and what datatype should I use? (ie array, object, Dictionary etc)

    Read the article

  • How to specify "PG-USERNAME" in pg_ident.conf so that it'll match any database user ?

    - by felace
    I need to restrict a specific unix user so that it can login with only a few select postgres usernames (with password prompt), but allowing every other user to use whatever pg username they want. Assuming restrUnixUser is the unix user name and restrUser is one of the postgres users it may use, and AllowedDB is the only database they should connect to : pg_hba.conf : local AllowedDB restrUser password local all restrUser reject local all all ident map=exceptrestrUser And pg_ident.conf : exceptrestrUser /^(?!restrUnixUser).*$ user1 exceptrestrUser /^(?!restrUnixUser).*$ user2 exceptrestrUser /^(?!restrUnixUser).*$ postgres does what I exactly want to do right now, however, I'll probably add a lot more users so I wonder if there is something like mapname unixuserpattern allpgusers that'll match with whatever username used to login by any unix user matching the pattern.

    Read the article

  • Can we match Any to a generic type? [Scala 2.8]

    - by Jus12
    Please point me to correct link if this has been answered before. I have this code: def getResult(a:Any):Any = a def getAnswer[T](i:Int) = { val result = getResult(i) result match { case t:T => Some(t) case _ => None } } This gives me a unchecked warning and everything matches to T. For instance, when I do getAnswer[Int](2), I get Some(2) (as expected). However, if I do getAnswer[String](2), I also get Some(2) which is not expected (I need None). Is there any way to work around type erasure and somehow get getAnswer to work correctly (i.e., return Some(result) if and only if the result is of type T)? Thanks in advance.

    Read the article

  • Regular expression help

    - by DJPB
    I there I'm working on a C# app, and I get a string with a date or part of a date and i need to take day, month and year for that string ex: string example='31-12-2010' string day = Regex.Match(example, "REGULAR EXPRESSION FOR DAY").ToString(); string month = Regex.Match(example, "REGULAR EXPRESSION FOR MONTH").ToString() string year = Regex.Match(example, "REGULAR EXPRESSION FOR YEAR").ToString() day = "31" month = "12" year = "2010" ex2: string example='12-2010' string month = Regex.Match(example, "REGULAR EXPRESSION FOR MONTH").ToString() string year = Regex.Match(example, "REGULAR EXPRESSION FOR YEAR").ToString() month = "12" year = "2010" any idea? tks

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • RemoveAll Dictionary Extension Method

    - by João Angelo
    Removing from a dictionary all the elements where the keys satisfy a set of conditions is something I needed to do more than once so I implemented it as an extension method to the IDictionary<TKey, TValue> interface. Here’s the code: public static class DictionaryExtensions { /// <summary> /// Removes all the elements where the key match the conditions defined by the specified predicate. /// </summary> /// <typeparam name="TKey"> /// The type of the dictionary key. /// </typeparam> /// <typeparam name="TValue"> /// The type of the dictionary value. /// </typeparam> /// <param name="dictionary"> /// A dictionary from which to remove the matched keys. /// </param> /// <param name="match"> /// The <see cref="Predicate{T}"/> delegate that defines the conditions of the keys to remove. /// </param> /// <exception cref="ArgumentNullException"> /// dictionary is null /// <br />-or-<br /> /// match is null. /// </exception> /// <returns> /// The number of elements removed from the <see cref="IDictionary{TKey, TValue}"/>. /// </returns> public static int RemoveAll<TKey, TValue>( this IDictionary<TKey, TValue> dictionary, Predicate<TKey> match) { if (dictionary == null) throw new ArgumentNullException("dictionary"); if (match == null) throw new ArgumentNullException("match"); var keysToRemove = dictionary.Keys.Where(k => match(k)).ToList(); if (keysToRemove.Count == 0) return 0; foreach (var key in keysToRemove) { dictionary.Remove(key); } return keysToRemove.Count; } }

    Read the article

< Previous Page | 34 35 36 37 38 39 40 41 42 43 44 45  | Next Page >