Search Results

Search found 17070 results on 683 pages for 'expression studio 3'.

Page 385/683 | < Previous Page | 381 382 383 384 385 386 387 388 389 390 391 392  | Next Page >

  • How to choose programaticaly the column to be querried by Linq using PropertyInfo???

    - by Richard77
    Hello, I would like to control how linq querries my database programaticaly. For instance, I'd like to querry the column X, column Y, or column Z, depending on some conditions. First of all, I've created an array of all the properties inside my class called myPropertyInfo. Type MyType = (typeOf(MyClass)); PropertyInfo[] myPropertyInfo = myType.GetProperties( BindingFlags.Public|BindingFlags.Instance); the myPropertyInfo array allows me to access each property details (Name, propertyType, etc) through the index*[i]* Now, how can I use the above information to control how linq querries my DB? Here's a sample of a querry I'd like to exploit. var myVar = from tp in db.MyClass select tp.{expression}; Expression using myPropertyInfo[i] to choose which property(column) to querry. I'm not sure if that's the way of doing it, but if there's another way to do so, I'll be glad to learn. Thanks for helping.

    Read the article

  • preg_replace or regex string translation

    - by ccolon
    I found some partial help but cannot seem to fully accomplish what I need. I need to be able to do the following: I need an regular expression to replace any 1 to 3 character words between two words that are longer than 3 characters with a match any expression: For example: walk to the beach == walk(.*)beach If the 1 to 3 character word is not preceded by a word that's longer than 3 characters then I want to translate that 1 to 3 letter word to ' ?' For example: on the beach == on ?the ?beach The simpler the rule the better (of course, if there's an alternative more complicated version that's more performant then I'll take that as well as I eventually anticipate heavy usage eventually). This will be used in a PHP context most likely with preg_replace. Thus, if you can put it in that context then even better!

    Read the article

  • antlr: How to rewrite only specific

    - by user1293945
    I am sure antlr can solve my problem, but can't figure out how to implement it, even high level. I rapidly got caught into syntax problems of antlr itself. My grammar is quite simple and made of following tokens and rules. Don't really need to go in their details here. The evaluator resolves to expressions, which finally resolve to IDENT: evaluator : expression EOF! ; ... ... term : PARTICIPANT_TYPE(IDENT | '('! expression ')'! | max | min | if_ | NUMBER)+ ; Now, I would like to analyse and rewrite the 'term', so that IDENT tokens (and them only) get re-written with the PARTICIPANT_TYPE. All the others should simply remain the same.

    Read the article

  • dealing with IO vs pure code in haskell

    - by Drakosha
    I'm writing a shell script (my 1st non-example in haskell) which is supposed to list a directory, get every file size, do some string manipulation (pure code) and then rename some files. I'm not sure what i'm doing wrong, so 2 questions: How should i arrange the code in such program? I have a specific issue, i get the following error, what am i doing wrong? error: Couldn't match expected type [FilePath]' against inferred typeIO [FilePath]' In the second argument of mapM', namelyfileNames' In a stmt of a 'do' expression: files <- (mapM getFileNameAndSize fileNames) In the expression: do { fileNames <- getDirectoryContents; files <- (mapM getFileNameAndSize fileNames); sortBy cmpFilesBySize files } code: getFileNameAndSize fname = do (fname, (withFile fname ReadMode hFileSize)) getFilesWithSizes = do fileNames <- getDirectoryContents files <- (mapM getFileNameAndSize fileNames) sortBy cmpFilesBySize files

    Read the article

  • Next line matching the regex in bash

    - by Lin_freak
    I have a file in the format: Port Number IP address Port Number IP address (Not sure how the output will be displayed here but let me tell you they are on separate lines) and so on.... I use the command grep -C 1 'port number' file.txt i.e. I want all IP addresses corresponding to a particular port. Making it simple, I want the next line matching a regular expression. Like if my regular expression matches line 2,4 and 6 then I want lines 3, 5 and 7 to be printed. How to do that?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Lambda "if" statement?

    - by AndyC
    I have 2 objects, both of which I want to convert to dictionarys. I use toDictionary<(). The lambda expression for one object to get the key is (i = i.name). For the other, it's (i = i.inner.name). In the second one, i.name doesn't exist. i.inner.name ALWAYS exists if i.name doesn't. Is there a lambda expression I can use to combine these two? Basically to read as: "if i.name exists then set id to i.name, else set id to i.inner.name". Many thanks.

    Read the article

  • Is void *p = 0L valid?

    - by Artefacto
    In this answer, sassman initializes a pointer with: zend_class_entry* ce = 0L; My question is – is this valid? I would say it isn't, to initialize the variable with a null pointer either an unadorned (and possibly casted to void *) 0 constant, or some macro that evaluates to that such as NULL should be used. However, I can't find definitive language in the standard that supports this interpretation. All it says is: An integer constant expression with the value 0, or such an expression cast to type void *, is called a null pointer constant.

    Read the article

  • one-liner if statements...

    - by snickered
    Total noob here so be gentle. I've looked everywhere and can't seem to find the answer to this. How do I condense the following? if (expression) { return true; } else { return false; } I can't get it to work since it's returning something vs. setting something. I've already seen things like this: somevar = (expression) ? value1 : value2; Like I said, please be gentle :)

    Read the article

  • Casting in mixed type calculations in C?

    - by yCalleecharan
    Hi, If I define these variables: double x0, xn, h; int n; and I have this mathematical expression: h = (xn - x0)/n; Is it necessary that I cast n into double prior doing the division for maximum accuracy like in h = (xn - x0)/ (double) n; I wrote a program to check the above but both expressions give the same answers. I understand that C will promote the integer to double type as variables xn and x0 are of type double but strangely enough in a book, the second expression with casting was emphasized. Thanks a lot...

    Read the article

  • How to make validation for a textbox that accept only comma(,) & digit in asp.net application?

    - by prateeksaluja20
    I am working on a website. I am using C# 2008. I want to make a text box that accept only numbers & comma(,). for example-919981424199,78848817711,47171111747 or there may be a single number like 919981424199. I was able to do one thing My text box only containing number by using this Regular Expression validation.in its property-Validation Expression i wrote "[0-9]+". This is working but now my requirement is to send bulk SMS & each number is separated by (,). I tried a lot but not getting the ans. so please help me to sort out this problem.

    Read the article

  • Is there a way to create a string that matches a given C# regex?

    - by Chris Phillips
    My application has a feature that parses text using a regular expression to extract special values. I find myself also needing to create strings that follow the same format. Is there a way to use the already defined regular expression to create those strings? For example, assume my regex looks something like this: public static Regex MyRegex = new Regex( @"sometext_(?<group1>\d*)" ); I'd like to be able to use MyRegex to create a new string, something like: var created = MyRegex.ToString( new Dictionary<string, string>() {{ "group1", "data1" }}; Such that created would then have the value "sometextdata1".

    Read the article

  • How to choose programaticaly the column to be queried by Linq using PropertyInfo???

    - by Richard77
    Hello, I would like to control how linq querries my database programaticaly. For instance, I'd like to query the column X, column Y, or column Z, depending on some conditions. First of all, I've created an array of all the properties inside my class called myPropertyInfo. Type MyType = (typeOf(MyClass)); PropertyInfo[] myPropertyInfo = myType.GetProperties( BindingFlags.Public|BindingFlags.Instance); The myPropertyInfo array allows me to access each property details (Name, propertyType, etc) through the index*[i]* Now, how can I use the above information to control how linq queries my DB? Here's a sample of a querry I'd like to exploit. var myVar = from tp in db.MyClass select tp.{expression}; Expression using myPropertyInfo[i] to choose which property(column) to query. I'm not sure if that's the way of doing it, but if there's another way to do so, I'll be glad to learn. Thanks for helping.

    Read the article

  • How to create a NSPredicate to find entries with leading numerical value?

    - by Toastor
    Hello, I'm using NSPredicates to fetch entities based on a name attribute. Creating a predicate for names beginning with letters was easy (@"name BEGINSWITH %@", searchLetter), however now I'd like to fetch all entities with a name that begins with a numerical value, or rather a non-alphabetical number. What would be the appropriate predicate expression here? Right now I don't want to get too deep into predicate programming, as this is all I need right now and time flies. So, please, don't point me to the Predicate Programming Guide, I just need that expression.. :) Thanks alot guys!

    Read the article

  • Looking for another regex explanation

    - by Sam
    In my regex expression, I was trying to match a password between 8 and 16 character, with at least 2 of each of the following: lowercase letters, capital letters, and digits. In my expression I have: ^((?=.*\d)(?=.*[a-z])(?=.*[A-Z])(?=.*\d)(?=.*[a-z])(?=.*[A-Z]).{8,16})$ But I don't understand why it wouldn't work like this: ^((?=\d)(?=[a-z])(?=[A-Z])(?=\d)(?=[a-z])(?=[A-Z]){8,16})$ Doesnt ".*" just meant "zero or more of any character"? So why would I need that if I'm just checking for specific conditions? And why did I need the period before the curly braces defining the limit of the password? And one more thing, I don't understand what it means to "not consume any of the string" in reference to "?=".

    Read the article

  • Cannot find one or more components. Please reinstall application

    - by Chris
    I am running Windows 8, 64 bit and have SQL Server 2012 installed. I downloaded the client tools, looked in the directory for SQL Server Management Studio, and see it's there. When I try to run SQL Management Studio I receive the error message: "Cannot find one or more components. Please reinstall application". This problem just started. I have reinstalled the application and downloaded the service packs. The shortcut key shows the path but it still will not run.

    Read the article

  • Dual monitors through 1 HDMI port

    - by Carlos
    I currently have a Dell Studio XPS 13 laptop connected to a 24" HP monitor (w2448hc). Im thinking on getting a second one, however am wondering what i need for the setup (hardware wise). Also I was wondering it there is any down side to it, or something i should be aware of. For example, image quality loss, GPU overloading, or anything important I should know. More than anything Im interested in your advice. Also the monitors do have built in speakers (HDMI sound output), is the sound going to be reproduced by only one monitor or both? Specs Model: Dell Studio XPS 13 OS: Genuine Windows® 7 Home Premium 64-Bit CPU: Intel® CoreTM 2 Duo P8600 (2.4GHz, 3MB L2 Cache, 1067MHz FSB) Chipset: NVIDIA® GeForce® MCP79MX RAM: 4GB 1067MHz DDR3 SDRAM Graphics: SLi NVIDIA® GeForce® 9500M - 256MB Thanks for your advice, if there is anything additional i need to buy an you have a personal preference pass the brand name so i can check it out. Thanks!

    Read the article

  • Supplementary Developer Laptop

    - by David Smith
    I'm looking to buy a laptop with the following specs for a developer. The goal will be to have a development machine supplementing the devs desktop. During work hours the dev will be on a beefy desktop. For working while on the go: trains, client sites, code camps, it would be nice to have a machine which can run Visual Studio 2008 without needing to remote desktop into their primary machine. What do you think is the lowest cost laptop meeting this need? Here are the specs I have in mind: SSD drive 64GB-doesn't need to be huge, most data is stored on servers. Will need to fit Windows 7, IIS, SQL Server, and Visual Studio 2010. RAM-3GB processor =Pentium Core 2 duo Screen size = 14 inches. OS doesn't matter. It will be paved with Windows 7 Ultimate optical drive omitted would be a plus. weight and battery life aren't so important because the machine will be plugged in almost all the time.

    Read the article

  • GAC locking problem when running deployment

    - by Kieran
    We have a NANT script that uses msbuild to compile our visual studio solutions and deploys the .dlls into the GAC. This works well on our integration/test servers as part of continuous integration, cruise control uses the NANT scripts and every time the dlls are put into the GAC without problem. On our local development machines, where we use subversion/vs.net etc. for development, frequently certain dlls do not make it to the GAC when we run the build. We think we have narrowed this down to visual studio and/or a plug in locking the GAC or the dlls for some reason. Strangely if we run the build a second time all the dlls make it to the GAC. We have added various iisreset's to the NANT script in the hope of releasing the lock but to no avail. Can anyone suggest a good approach to attack this problem? All the best

    Read the article

  • Set a login with username/password for SQL Server 2008 Express

    - by Ewald Stieger
    I would like to set a password and username for connecting to a server with SQL Management Studio 2008. I set up SQL Server 2008 Express on a customer's computer to host a DB used by an Access 2007 app. The customer should not be able to access the DB or connect with SQL Management Studio. How do I set up a login and remove any logins that allow a user to connect via Windows Authentication and without entering a username and password? I have not much experience with logins and controlling access.

    Read the article

  • Dual monitors though 1 HDMI port

    - by Carlos
    I currently have a Dell Studio XPS 13 laptop connected to a 24" HP monitor (w2448hc). Im thinking on getting a second one, however am wondering what i need for the setup (hardware wise). Also I was wondering it there is any down side to it, or something i should be aware of. For example, image quality loss, GPU overloading, or anything important I should know. More than anything Im interested in your advice. Also the monitors do have built in speakers (HDMI sound output), is the sound going to be reproduced by only one monitor or both? Specs Model: Dell Studio XPS 13 OS: Genuine Windows® 7 Home Premium 64-Bit CPU: Intel® CoreTM 2 Duo P8600 (2.4GHz, 3MB L2 Cache, 1067MHz FSB) Chipset: NVIDIA® GeForce® MCP79MX RAM: 4GB 1067MHz DDR3 SDRAM Graphics: SLi NVIDIA® GeForce® 9500M - 256MB Thanks for your advice, if there is anything additional i need to buy an you have a personal preference pass the brand name so i can check it out. Thanks!

    Read the article

  • Error - Unable to access the IIS metabase

    - by jjathman
    After installing Visual Studio 2012 and opening my solution I get a series of errors in this form: The Web Application Project Foo is configured to use IIS. Unable to access the IIS metabase. You do not have sufficient privilege to access IIS web sites on your machine. I get this for each of our web applications. Things I have tried: Running Visual Studio as Administrator Running aspnet_regiis.exe -ga MyUserName Running aspnet_regiis.exe -i These seem to be common solutions for this problem but I have not had any success with them. Is there anything else I can try to do?

    Read the article

< Previous Page | 381 382 383 384 385 386 387 388 389 390 391 392  | Next Page >