Search Results

Search found 14008 results on 561 pages for 'easy marks'.

Page 386/561 | < Previous Page | 382 383 384 385 386 387 388 389 390 391 392 393  | Next Page >

  • collapsing a UITableView

    - by Sage Washabaugh
    Hey everyone I made a UITableView in my app and when a cell is touched it expands the problem I am having is it does not collapse no matter what I have tried, I'm sure its something easy i just cant figure it out the only time it does collapse is when it another cell is tapped. Here is my code: -(void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { selectedCellIndexPath = indexPath; [tableView reloadRowsAtIndexPaths:[NSArray arrayWithObject:indexPath] withRowAnimation:UITableViewRowAnimationNone]; if (selectedCellIndexPath) { selected = YES; } } -(CGFloat)tableView:(UITableView *)tableView heightForRowAtIndexPath:(NSIndexPath *)indexPath { if(selectedCellIndexPath != nil && [selectedCellIndexPath compare:indexPath] == NSOrderedSame) return 150; return 44; }

    Read the article

  • How to programmatically switch to a specific window in compiz?

    - by FossilBit
    Is there a command to tell compiz that we want to bring in front and set focus to a specific window? How should we identify the window in that command? The reason behind this question is the following use-case: Suppose we have a wiki to keep notes of anything interesting we find out. It would be very convenient to have a keyboard shortcut to bring the browser window with our Wiki page in front and start typing immediately then with another key combination switch to the application we were working before I know that "ALT+TAB" switches between the last two used windows but cannot support more complex combinations of applications. E.g Browser+Eclipse+ Wiki If there is a command like the one described, it is easy to add a shortcut to it from KDE or GNOME interface Thanx ...

    Read the article

  • Using TFS source control - how to remove files

    - by arame3333
    I am a lone developer, and I am now using TFS 2010, having until recently used VSS. I have not found it easy to get any books for beginners to help me use this. So I have now got my project in source control. But when I check in I get references to a number of files that I no longer use. How do I remove files from the TFS Source Control repository? So in the example below you can see lots of files from different projects that I do not want to see.

    Read the article

  • Creating CFArray from MySQL Result Array

    - by Andrew
    Is there an easy way to dump an array returned from mysql_fetch_row into a CFArray? (part of the PHP implementation of CFPropertyList) I'm bummed by the lack of documentation on CFPropertyList for PHP. Iterating through each item in the array seems inefficient. I'm open to using a different mysql_fetch_... command. I'd like to just say: $NewArray = new CFArray( $ResultArray ) But that deosn't seem to work. This is my current code: $plist = new CFPropertyList(); $ResultRow = mysqli_fetch_row( $result ); $plist-add( $TableRow = new CFArray() ); foreach ( $ResultRow as $Item ){ $TableRow-add( new CFString( $Item ) ); }

    Read the article

  • is there an equivalent to a "Focus Listener" in Objective-C or iPhone SDK? (Coming from Java)

    - by MarcZero
    Hello. I am a student programmer who has taken up Objective-C on my free time as my college doesn't teach it. We have only used Java and basic C so far. I am in the middle of making a program for the iPod and was wondering if there was any type of way to call a method in a class similar to the way a Focus Listener does in Java? I have a view that I would like to call a refresh method (to update the newly inputted titles of buttons from another view) when the view is put at the top and visible again. Is this too easy or is there a more methodical way of doing that? I have tried to just call the method from the other view class but it does not seem to work (says the other class is either undefined or may not accept the method call and crashes on execution). Any insight would be appreciated. Thank you for your time.

    Read the article

  • looping and arrays

    - by user1838418
    Hi I'm trying to construct a loop to execute 16 states of the 8 4 2 1 code in (C++) while( condition) { double Bubble[16], Bubble1[16]; Bubble[0] = ( a-2 - (b-2) ) + ( c-2 - (d-2)); // represents 0000 Bubble[1] = ( a-2 - (b-2) ) + ( c-2 - (d+2)); // represents 0001 Bubble[2] = ( a-2 - (b-2) ) + ( c+2 - (d-2)); // represents 0010 Bubble[3] = ( a-2 - (b-2) ) + ( c+2 - (d+2)); //represents 0011 ....... Bubble[15] =(a+2 - (b+2) ) + ( c+2 - (d+2)); //represents 1111 } Is there an easy way of coding using for loops? instead of writing bubble[] every time? 0 stands for -2 and 1 stands for +2. So I have 4 variables and each one need to be incremented and/or decremented. Can this be done using for loop? Appreciate your help

    Read the article

  • Program output to file in Java (and reading it again)

    - by Cohagen
    I have a large main method in an IO class which creates objects from four different classes in my program (which all use one another to some extent). My main method takes all info in using a scanner, from the console window, and uses this info to call the constructors and methods in the other classes. As this is my first full program in Java I have been focussed on making the main method work via the console, without properly considering file input and output. I cannot see an easy way of making that work now. Ideally what I require is some way of writing everything I input to the console while running the main method to a file, in a format that can be read again and inputed back through the main method? I have refrained from posting the main method as it is 250+ lines long, but will post any relevant parts of it if required. Any help appreciated

    Read the article

  • Secure way to run other people code (sandbox) on my server?

    - by amikazmi
    I want to make a web service that run other people code locally... Naturally, I want to limit their code access to certain "sandbox" directory, and that they wont be able to connect to other parts of my server (DB, main webserver, etc) Whats the best way to do it? Run VMware/Virtualbox: (+) I guess it's as secure as it gets.. even if someone manage to "hack".. they only hack the guest machine (+) can limit the cpu & memory the process uses (+) easy to setup.. just create the VM (-) harder to "connect" the sandbox directory from the host to the guest (-) wasting extra memory and cpu for managing the VM Run underprivileged user: (+) doesnt waste extra resources (+) sandbox directory is just a plain directory (?) cant limit cpu and memory? (?) dont know if it's secure enough... Any other way? Server running Fedora Core 8, the "other" codes written in Java & C++

    Read the article

  • Disable Adding Item to Collection

    - by Wonko the Sane
    Hi All, I'm sure there's an "easy" answer to this, but for the moment it escapes me. In an MVVM application, I have a property that is a ObservableCollection, used for displaying some set of elements on the view. private readonly ObservableCollection<MyType> mMyCollection = new ObservableCollection<MyType>(); public ObservableCollection<MyType> MyCollection { get { return mMyCollection; } } I want to restrict consumers of this collection from simply using the property to add to the collection (i.e. I want to prevent this from the view): viewModel.MyCollection.Add(newThing); // want to prevent this! Instead, I want to force the use of a method to add items, because there may be another thread using that collection, and I don't want to modify the collection while that thread is processing it. public void AddToMyCollection(MyType newItem) { // Do some thread/task stuff here } Thanks, wTs

    Read the article

  • HTML5 - Creating a canvas on top of an SVG(or other image)

    - by cawd
    The reason for asking this question is because I want to be able to draw an arrow between two svg images. I want to use canvas to create the arrows, so firstly I generate the svgs then place a canvas on top of them to be able to draw the arrows. I've tried using style=... but haven't had any luck as everytime I add the canvas element it just pushes my svg images to another pl If there's no easy way to do this I'll just create arrows using SVG, I figured it would be more efficient to use canvas if I had to do lots of arrows in a short amount of time.

    Read the article

  • Export SQL Binary/BLOB Data?

    - by davemackey
    Recently a software application we utilize upgraded from ASP to ASP.NET. In the process they abandoned the old web-based product and rewrote the entire UI, using new DB tables. The old DB tables still exist in the database and contain legacy files in binary or blob formats. I'm wondering if there is an easy way to export all these legacy files from the database to the filesystem (NTFS)? Then we could delete these old unused tables and save a few GB of space in the DB backups, etc.

    Read the article

  • What do you name your files when using MVC?

    - by sprugman
    When using the MVC pattern, which I'm not terribly experienced with, I find myself naming things like this: /app/views/widget.php /app/models/widget.php /app/controllers/widget.php That appeals to me because it's easy to find associated classes, and I lean towards shorter names when practical. However, when I'm looking in my IDE, I see three different files called widget.php, which is confusing. I'm tempted to add "_v", "_c", "_m" or something to each name. How do you handle this? FWIW, I'm using CodeIgniter at the moment, and I don't know if there are any special benefits to using a particular convention, or any standard practices. Regardless, I'm intersted in the best-practices from various platforms.

    Read the article

  • TFS: how to change custom field allowed values

    - by Budda
    I have my custom field of string type with predefined set of values: "1 - Cool", "2 - Good", "3 - Average",... Now it is necessary to remove "2 - Good" value and rename "3 - Average" into "2 - Average". I see easy solution: just delete 2 existing "2 - Good" and "3 - Average" and create the new "2 - Average". Question: Q1: What will happens with issues that contain values to be deleted? Probably, system won't accept such work item change? Q2: What is a good approach to do what I need? Thanks a lot! Any thoughts are welcome!

    Read the article

  • Error about TypeError (wrong argument type Module (expected Class)): app/controllers/player_profiles_controller.rb:1:in `<top (required)>'

    - by edi susanto
    hy guys . . im new at this . . sorry for the word that's not understandable and the easy question . . i'd like to ask about an error that shown below : TypeError (wrong argument type Module (expected Class)): app/controllers/player_profiles_controller.rb:1:in `' i want to test the result by render json in soapUI. does anyone know what's the problem so that the error will show up like above ? thanks before.regards,edy

    Read the article

  • directory monitoring

    - by foz1284
    Hi, What is the best way for me to check for new files added to a directory, I dont think the filesystemwatcher would be suitable as this is not an always on service but a method that runs when my program starts up. there are over 20,000 files in the folder structure I am monitoring, at present I am checking each file individually to see if the filepath is in my database table, however this is taking around ten minutes and I would like to speed it up is possible, I can store the date the folder was last checked - is it easy to get all files with createddate last checked date. anyone got any Ideas? Thanks Mark

    Read the article

  • BlackBerry - Multiple Screens or Single Screen with Content Manager?

    - by Max Gontar
    Hi! I've seen projects which use many screens each one for different layout and functionality. I've seen projects with only one screen (like wizard workflow) where content is changed on user interaction (and this seems to be logical to use single screen in wizards). But also I've seen projects (apps like game or messenger or phone settings utility) which use single screen for different functionalities. I can see such advantages of having single screen in app: keep same decoration design and menu or toolbar (which may be also achieved with inheritance) keep single screen in ui stack (which may be achieved by pop/push screen) easy to handle data over application Can you tell other advantages/disadvantages of single screen app? When its better to use this approach? Thank you!

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • print to Flash in C#

    - by Reinhard
    I need an easy way to show different document-types (.doc, .xls, .jpg...) in webpages. Ideally a user prints or saves that document and that document is automatically converted to Adobe-Flash. I know there are existing solutions to this. However, I would like to implement them in my own application, written in C#. Can anyone point me in a direction how to write a "Printer" in C#, where printable documents can be printed to, and that outputs a SWF-File? Thanks, Reinhard

    Read the article

  • Help on choosing which SQL Server 2008 scale-out solution to pick (replication, ...)

    - by usr
    I am currently crossing the jungle of SQL Server scale-out technologies like replication, log-shipping, mirroring... I have the following constraints on my choice: I want the read-only load to be spread accross the primary and the secondary (mirror, subscriber) server Write load can be sent directly to the primary server The solution should be nearly maintainance free. Schema changes should just replicate to the secondary server (attention: replication has some serious constraints here as it seems) Written data should be accessible very quickly (in under 1s, but better would be instantaneously) on the secondary server On server failure I can tollerate up to one hour of data loss easily. I am more concerned with easy scalability Here are some options for what I could pick: http://msdn.microsoft.com/en-us/library/bb510414.aspx. Any experience you could share?

    Read the article

  • Knowledge mining using Hadoop.

    - by Anurag
    Hello there, I want to do a project Hadoop and map reduce and present it as my graduation project. To this, I've given some thought,searched over the internet and came up with the idea of implementing some basic knowledge mining algorithms say on a social websites like Facebook or may stckoverflow, Quora etc and draw some statistical graphs, comparisons frequency distributions and other sort of important values.For searching purpose would it be wise to use Apache Solr ? I want know If such thing is feasible using the above mentioned tools, if so how should I build up on this little idea? Where can I learn about knowledge mining algorithms which are easy to implement using java and map reduce techniques? In case this is a wrong idea please suggest what else can otherwise be done on using Hadoop and other related sub-projects? Thank you

    Read the article

  • Callback exception/error handling for ASP TreeView OnTreeNodePopulate?

    - by MHutchinson
    We're using an asp:TreeView configured with lazy loading. The callback method assigned for OnTreeNodePopulate throws an exception if the user has been logged out since the page was loaded. What we want to do is to direct the user to the login page. First attempt was to catch the exception on the server and try Response.Redirect(...), but that doesn't work because you can't redirect within a callback. I've tried various other approaches, including using ClientScript.RegisterStartupScript(...) but that doesn't seem to work for OnTreeNodePopulate. If there was some way we could hook into the callback event handling on the client side then it would be easy, but the TreeView doesn't seem to offer anything here. Suggestions?

    Read the article

  • MySql php: check if Row exists

    - by Jeff
    This is probably an easy thing to do but I'm an amateur and things just aren't working for me. I just want to check and see if a row exists where the $lectureName shows. If a row does exist with the $lectureName somewhere in it, I want the function to return "assigned" if not then it should return "available". Here's what I have. I'm fairly sure its a mess. Please help. function checkLectureStatus($lectureName) { $con = connectvar(); mysql_select_db("mydatabase", $con); $result = mysql_query("SELECT * FROM preditors_assigned WHERE lecture_name='$lectureName'"); while($row = mysql_fetch_array($result)); { if (!$row[$lectureName] == $lectureName) { mysql_close($con); return "Available"; } else { mysql_close($con); return "Assigned"; } } When I do this everything return available, even when it should return assigned.

    Read the article

  • Conversion of Single to two UInt16 values in .net

    - by Gio
    In the good old days of C. I could cast a float to an int (assuming 32 bit system), do some bit manipluation ( bitwise and, right shift, ect ), and get the upper and lower 16 bit hex representations of the floating point number, which I could then store in two short values. I'm not seeing an easy way of doing this in C#. System.Convert.ToUInt16 just does a float to int convert (even after I shift right), which leaves a vlaue of 0 if the float is less than 0, which is not the desired effect. //useless leaves me witg a value 0f 0 UIN16 s1 = (UInt16)((System.Convert.ToUInt32(d2) & 0xffff0000) >> 16); //capture the high word UInt16 s2 = (UInt16)(System.Convert.ToUInt32(d2) & 0xffff); //capture the low word A basic cast (UInt32) doesn't work either.

    Read the article

  • Solve Physics exercise by brute force approach..

    - by Nils
    Being unable to reproduce a given result. (either because it's wrong or because I was doing something wrong) I was asking myself if it would be easy to just write a small program which takes all the constants and given number and permutes it with a possible operators (* / - + exp(..)) etc) until the result is found. Permutations of n distinct objects with repetition allowed is n^r. At least as long as r is small I think you should be able to do this. I wonder if anybody did something similar here..

    Read the article

  • Any way to stringify a variable id / symbol in Python?

    - by otz
    I'm wondering if it is possible at all in python to stringify variable id/symbol -- that is, a function that behaves as follows: >>> symbol = 'whatever' >>> symbol_name(symbol) 'symbol' Now, it is easy to do it on a function or a class (if it is a direct reference to the object): >>> def fn(): pass >>> fn.func_name 'fn' But I'm looking for a general method that works on all cases, even for indirect object references. I've thought of somehow using id(var), but no luck yet. Is there any way to do it?

    Read the article

< Previous Page | 382 383 384 385 386 387 388 389 390 391 392 393  | Next Page >