Search Results

Search found 80052 results on 3203 pages for 'data load performance'.

Page 390/3203 | < Previous Page | 386 387 388 389 390 391 392 393 394 395 396 397  | Next Page >

  • vectorizing loops in Matlab - performance issues

    - by Gacek
    This question is related to these two: http://stackoverflow.com/questions/2867901/introduction-to-vectorizing-in-matlab-any-good-tutorials http://stackoverflow.com/questions/2561617/filter-that-uses-elements-from-two-arrays-at-the-same-time Basing on the tutorials I read, I was trying to vectorize some procedure that takes really a lot of time. I've rewritten this: function B = bfltGray(A,w,sigma_r) dim = size(A); B = zeros(dim); for i = 1:dim(1) for j = 1:dim(2) % Extract local region. iMin = max(i-w,1); iMax = min(i+w,dim(1)); jMin = max(j-w,1); jMax = min(j+w,dim(2)); I = A(iMin:iMax,jMin:jMax); % Compute Gaussian intensity weights. F = exp(-0.5*(abs(I-A(i,j))/sigma_r).^2); B(i,j) = sum(F(:).*I(:))/sum(F(:)); end end into this: function B = rngVect(A, w, sigma) W = 2*w+1; I = padarray(A, [w,w],'symmetric'); I = im2col(I, [W,W]); H = exp(-0.5*(abs(I-repmat(A(:)', size(I,1),1))/sigma).^2); B = reshape(sum(H.*I,1)./sum(H,1), size(A, 1), []); But this version seems to be as slow as the first one, but in addition it uses a lot of memory and sometimes causes memory problems. I suppose I've made something wrong. Probably some logic mistake regarding vectorizing. Well, in fact I'm not surprised - this method creates really big matrices and probably the computations are proportionally longer. I have also tried to write it using nlfilter (similar to the second solution given by Jonas) but it seems to be hard since I use Matlab 6.5 (R13) (there are no sophisticated function handles available). So once again, I'm asking not for ready solution, but for some ideas that would help me to solve this in reasonable time. Maybe you will point me what I did wrong.

    Read the article

  • SQL Server CTE referred in self joins slow

    - by Kharlos Dominguez
    Hello, I have written a table-valued UDF that starts by a CTE to return a subset of the rows from a large table. There are several joins in the CTE. A couple of inner and one left join to other tables, which don't contain a lot of rows. The CTE has a where clause that returns the rows within a date range, in order to return only the rows needed. I'm then referencing this CTE in 4 self left joins, in order to build subtotals using different criterias. The query is quite complex but here is a simplified pseudo-version of it WITH DataCTE as ( SELECT [columns] FROM table INNER JOIN table2 ON [...] INNER JOIN table3 ON [...] LEFT JOIN table3 ON [...] ) SELECT [aggregates_columns of each subset] FROM DataCTE Main LEFT JOIN DataCTE BananasSubset ON [...] AND Product = 'Bananas' AND Quality = 100 LEFT JOIN DataCTE DamagedBananasSubset ON [...] AND Product = 'Bananas' AND Quality < 20 LEFT JOIN DataCTE MangosSubset ON [...] GROUP BY [ I have the feeling that SQL Server gets confused and calls the CTE for each self join, which seems confirmed by looking at the execution plan, although I confess not being an expert at reading those. I would have assumed SQL Server to be smart enough to only perform the data retrieval from the CTE only once, rather than do it several times. I have tried the same approach but rather than using a CTE to get the subset of the data, I used the same select query as in the CTE, but made it output to a temp table instead. The version referring the CTE version takes 40 seconds. The version referring the temp table takes between 1 and 2 seconds. Why isn't SQL Server smart enough to keep the CTE results in memory? I like CTEs, especially in this case as my UDF is a table-valued one, so it allowed me to keep everything in a single statement. To use a temp table, I would need to write a multi-statement table valued UDF, which I find a slightly less elegant solution. Did some of you had this kind of performance issues with CTE, and if so, how did you get them sorted? Thanks, Kharlos

    Read the article

  • Load javascripts inside jQuery Ajax

    - by brandon14_99
    I have several javascripts at the head of my document, as well as at the bottom, near the body closing tag. I use jQuery to call an ajax element into place and the elements that are called, require these javascripts to function. How can I include these javascripts to work with the ajax call?

    Read the article

  • Improve performance of sorting files by extension

    - by DxCK
    With a given array of file names, the most simpliest way to sort it by file extension is like this: Array.Sort(fileNames, (x, y) => Path.GetExtension(x).CompareTo(Path.GetExtension(y))); The problem is that on very long list (~800k) it takes very long to sort, while sorting by the whole file name is faster for a couple of seconds! Theoretical, there is a way to optimize it: instead of using Path.GetExtension() and compare the newly created extension-only-strings, we can provide a Comparison than compares starting from the LastIndexOf('.') without creating new strings. Now, suppose i found the LastIndexOf('.'), i want to reuse native .NET's StringComparer and apply it only to the part on string after the LastIndexOf('.'). Didn't found a way to do that. Any ideas?

    Read the article

  • Using ModalAlert from cookbook - app does not load

    - by user127091
    I'm using iphone cookbook code to prompt a user for text in a UIAlertView. The cookbook code is available at http://github.com/erica/iphone-3.0-cookbook-/tree/master/C10-Alerts/03-Soliciting%20Text/ In my AppDelegate, applicationDidFinishLaunching(), I invoke as below NSString *str = [ModalAlert ask:@"what is your name?" withTextPrompt:@"ATTUID"]; But my app does not finish loading at all. I get a black screen indefinitely. There are no messages in the console. I tried creating just a UIAlertView with UITextField in the above function and it displays properly. (commenting out her code) Commenting out "CFRunLoopRun()" also loads the app. I'm probably doing something stupid but can't seem to figure it out.

    Read the article

  • Use one Socket to send and recieve data

    - by volody
    What makes more sense? use one socket to send and receive data to/from a embedded hardware device use one socket to send data and separate socket to read data Communication is not very intensive but the important point is to receive data as fast as possible. On application side is used Windows XP and up.

    Read the article

  • Data warehousing in sql server 2008

    - by 3bd
    Hi All: I am new to data warehousing and I am a little confused plz provide some simple steps to create a cube and fill it and make querey on it to know : I have a database with the original data and I have designed the star schema and made appropriate tables I have created an analysis service project in VS 2008 and then I have made the data source -data source view-dimensions - and the cube all that based on the star schema i have created previously now: what should I do to: fill this cube make query on this cube

    Read the article

  • File Encrypt/Decrypt under load?

    - by chopps
    I found an interesting article about encrypting and decrypting files but since it uses a file.dat to store the key this will run into problems when theres alot of users on the site dealing with alot of files. http://www.codeproject.com/KB/security/VernamEncryption.aspx?display=Print Should a new file be created every time a file needs decrypting or would there be a better way to do this? UPDATE: Here is what im using to avoid the locking problems. using (Mutex FileLock = new Mutex(true, System.Guid.NewGuid().ToString())) { try { FileLock.WaitOne(); using (FileStream fs = new FileStream(keyFile, FileMode.Open)) { keyBytes = new byte[fs.Length]; fs.Read(keyBytes, 0, keyBytes.Length); } } catch (Exception ex) { EventLog.LogEvent(ex); } finally { FileLock.ReleaseMutex(); } } I tested it on 1000 TIFFs doing both encryption and decryption without any errors.

    Read the article

  • How do I load all my location based content into google maps

    - by user333639
    I am writing an iPad application that uses the MapKit control. How do I get all my content into Google Maps. i.e. I have a bunch of locations along with photos, video, audio and various other information. So when the iPad user loads my App and zooms into a certain place in the world I want my Annotations to be visible and when they touch the pins they get access to more information etc.

    Read the article

  • Smaller Chunks of Data

    - by Googler
    I am using a web service to fetch a large amount of data. While sending the request, i receive an error as: Error: ** Please request data in smaller chunks.** Is this a problem with the web services i am fetching the information or a normal rule for fetching the data through internet. May i know the cause of this problem and also how to send the data in smaller chunks to avoid this error.

    Read the article

  • NHibernate unintential lazy property loading

    - by chiccodoro
    I introduced a mapping for a business object which has (among others) a property called "Name": public class Foo : BusinessObjectBase { ... public virtual string Name { get; set; } } For some reason, when I fetch "Foo" objects, NHibernate seems to apply lazy property loading (for simple properties, not associations): The following code piece generates n+1 SQL statements, whereof the first only fetches the ids, and the remaining n fetch the Name for each record: ISession session = ...IQuery query = session.CreateQuery(queryString); ITransaction tx = session.BeginTransaction(); List<Foo> result = new List<Foo>(); foreach (Foo foo in query.Enumerable()) { result.Add(foo); } tx.Commit(); session.Close(); produces: NHibernate: select foo0_.FOO_ID as col_0_0_ from V1_FOO foo0_ NHibernate: SELECT foo0_.FOO_ID as FOO1_2_0_, foo0_.NAME as NAME2_0_ FROM V1_FOO foo0_ WHERE foo0_.FOO_ID=:p0;:p0 = 81 NHibernate: SELECT foo0_.FOO_ID as FOO1_2_0_, foo0_.NAME as NAME2_0_ FROM V1_FOO foo0_ WHERE foo0_.FOO_ID=:p0;:p0 = 36470 NHibernate: SELECT foo0_.FOO_ID as FOO1_2_0_, foo0_.NAME as NAME2_0_ FROM V1_FOO foo0_ WHERE foo0_.FOO_ID=:p0;:p0 = 36473 Similarly, the following code leads to a LazyLoadingException after session is closed: ISession session = ... ITransaction tx = session.BeginTransaction(); Foo result = session.Load<Foo>(id); tx.Commit(); session.Close(); Console.WriteLine(result.Name); Following this post, "lazy properties ... is rarely an important feature to enable ... (and) in Hibernate 3, is disabled by default." So what am I doing wrong? I managed to work around the LazyLoadingException by doing a NHibernateUtil.Initialize(foo) but the even worse part are the n+1 sql statements which bring my application to its knees. This is how the mapping looks like: <class name="Foo" table="V1_FOO"> ... <property name="Name" column="NAME"/> </class> BTW: The abstract "BusinessObjectBase" base class encapsulates the ID property which serves as the internal identifier.

    Read the article

  • Help with data retrieval MACRO

    - by Andrei Ciobanu
    Hello, given the following structure: struct nmslist_elem_s { nmptr data; struct nmslist_elem_s *next; }; typedef struct nmslist_elem_s nmslist_elem; Where: typedef void* nmptr; Is it possible to write a MACRO that retrieves the data from the element and cast it to the right type: MACRO(type, element) that expands to *((type*)element->data). For example for int, i would need something like this: *((int*)(element->data)) .

    Read the article

  • javascript mouse cursor change on page load in firefox browser 3.5

    - by Amit
    Hi in case of full page submit a trasparent div id coming and changing the cursor to 'wait' . Now when the page is getting submitted and new page is coming up cursor still remains to 'wait' not changing to default until mouse is moved in Firefox Here is simple html click on show button div is coming when user move mouse over the div cursor is changing as wait cursor. Now when this page is loaded again pressing F5 cursor remain as wait cursor in firefox its working fine in IE is there any way to make the cursor as default on pageload in Firefox <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1" /> <title>Untitled Document</title> <style> body{ cursor:default; } </style> <script src="js/jquery.js"> </script> <script> var test = true; $(document).ready(function(){ $('#maindiv').css('display','none') }); function showDiv(){ $('#maindiv').css('display','block') } </script> </head> <body> <div id="divBody" style="background-color:red;width:500px;height:500px" >aa <div id="maindiv" style="background-color:#999999;height:100$;width:400px;height:400px;cursor:wait"> sss </div>aa </div> <input type="button" value="show" onclick="showDiv()"/> </body> </html>

    Read the article

  • real time stock quotes, StreamReader performance optimization

    - by sean717
    I am working on a program that extracts real time quote for 900+ stocks from a website. I use HttpWebRequest to send HTTP request to the site and store the response to a stream and open a stream using the following code: HttpWebResponse response = (HttpWebResponse)request.GetResponse(); Stream stream = response.GetResponseStream (); StreamReader reader = new StreamReader( stream ) the size of the received HTML is large (5000+ lines), so it takes a long time to parse it and extract the price. For 900 files, It takes about 6 mins for parsing and extracting. Which my boss isn't happy with, he told me he'd want the whole process to be done in TWO mins. I've identified the part of the program that takes most of time to finish is parsing and extracting. I've tried to optimize the code to make it faster, the following is what I have now after some optimization: // skip lines at the top for(int i=0;i<1500;++i) reader.ReadLine(); // read the line that contains the price string theLine = reader.ReadLine(); // ... extract the price from the line now it takes about 4 mins to process all the files, there is still a significant gap to what my boss's expecting. So I am wondering, is there other way that I can further speed up the parsing and extracting and have everything done within 2 mins?

    Read the article

  • how to avoid sub-query to gain performance

    - by chun
    hi i have a reporting query which have 2 long sub-query SELECT r1.code_centre, r1.libelle_centre, r1.id_equipe, r1.equipe, r1.id_file_attente, r1.libelle_file_attente,r1.id_date, r1.tranche, r1.id_granularite_de_periode,r1.granularite, r1.ContactsTraites, r1.ContactsenParcage, r1.ContactsenComm, r1.DureeTraitementContacts, r1.DureeComm, r1.DureeParcage, r2.AgentsConnectes, r2.DureeConnexion, r2.DureeTraitementAgents, r2.DureePostTraitement FROM ( SELECT cc.id_centre_contact, cc.code_centre, cc.libelle_centre, a.id_equipe, a.equipe, a.id_file_attente, f.libelle_file_attente, a.id_date, g.tranche, g.id_granularite_de_periode, g.granularite, sum(Nb_Contacts_Traites) as ContactsTraites, sum(Nb_Contacts_en_Parcage) as ContactsenParcage, sum(Nb_Contacts_en_Communication) as ContactsenComm, sum(Duree_Traitement/1000) as DureeTraitementContacts, sum(Duree_Communication / 1000 + Duree_Conference / 1000 + Duree_Com_Interagent / 1000) as DureeComm, sum(Duree_Parcage/1000) as DureeParcage FROM agr_synthese_activite_media_fa_agent a, centre_contact cc, direction_contact dc, granularite_de_periode g, media m, file_attente f WHERE m.id_media = a.id_media AND cc.id_centre_contact = a.id_centre_contact AND a.id_direction_contact = dc.id_direction_contact AND dc.direction_contact ='INCOMING' AND a.id_file_attente = f.id_file_attente AND m.media = 'PHONE' AND ( ( g.valeur_min = date_format(a.id_date,'%d/%m') and g.granularite = 'Jour') or ( g.granularite = 'Heure' and a.id_th_heure = g.id_granularite_de_periode) ) GROUP by cc.id_centre_contact, a.id_equipe, a.id_file_attente, a.id_date, g.tranche, g.id_granularite_de_periode) r1, ( (SELECT cc.id_centre_contact,cc.code_centre, cc.libelle_centre, a.id_equipe, a.equipe, a.id_date, g.tranche, g.id_granularite_de_periode,g.granularite, count(distinct a.id_agent) as AgentsConnectes, sum(Duree_Connexion / 1000) as DureeConnexion, sum(Duree_en_Traitement / 1000) as DureeTraitementAgents, sum(Duree_en_PostTraitement / 1000) as DureePostTraitement FROM activite_agent a, centre_contact cc, granularite_de_periode g WHERE ( g.valeur_min = date_format(a.id_date,'%d/%m') and g.granularite = 'Jour') AND cc.id_centre_contact = a.id_centre_contact GROUP BY cc.id_centre_contact, a.id_equipe, a.id_date, g.tranche, g.id_granularite_de_periode ) UNION (SELECT cc.id_centre_contact,cc.code_centre, cc.libelle_centre, a.id_equipe, a.equipe, a.id_date, g.tranche, g.id_granularite_de_periode,g.granularite, count(distinct a.id_agent) as AgentsConnectes, sum(Duree_Connexion / 1000) as DureeConnexion, sum(Duree_en_Traitement / 1000) as DureeTraitementAgents, sum(Duree_en_PostTraitement / 1000) as DureePostTraitement FROM activite_agent a, centre_contact cc, granularite_de_periode g WHERE ( g.granularite = 'Heure' AND a.id_th_heure = g.id_granularite_de_periode) AND cc.id_centre_contact = a.id_centre_contact GROUP BY cc.id_centre_contact,a.id_equipe, a.id_date, g.tranche, g.id_granularite_de_periode) ) r2 WHERE r1.id_centre_contact = r2.id_centre_contact AND r1.id_equipe = r2.id_equipe AND r1.id_date = r2.id_date AND r1.tranche = r2.tranche AND r1.id_granularite_de_periode = r2.id_granularite_de_periode GROUP BY r1.id_centre_contact , r1.id_equipe, r1.id_file_attente, r1.id_date, r1.tranche, r1.id_granularite_de_periode ORDER BY r1.code_centre, r1.libelle_centre, r1.equipe, r1.libelle_file_attente, r1.id_date, r1.id_granularite_de_periode,r1.tranche the EXPLAIN shows | id | select_type | table | type| possible_keys | key | key_len | ref| rows | Extra | '1', 'PRIMARY', '<derived3>', 'ALL', NULL, NULL, NULL, NULL, '2520', 'Using temporary; Using filesort' '1', 'PRIMARY', '<derived2>', 'ALL', NULL, NULL, NULL, NULL, '4378', 'Using where; Using join buffer' '3', 'DERIVED', 'a', 'ALL', 'fk_Activite_Agent_centre_contact', NULL, NULL, NULL, '83433', 'Using temporary; Using filesort' '3', 'DERIVED', 'g', 'ref', 'Index_granularite,Index_Valeur_min', 'Index_Valeur_min', '23', 'func', '1', 'Using where' '3', 'DERIVED', 'cc', 'ALL', 'PRIMARY', NULL, NULL, NULL, '6', 'Using where; Using join buffer' '4', 'UNION', 'g', 'ref', 'PRIMARY,Index_granularite', 'Index_granularite', '23', '', '24', 'Using where; Using temporary; Using filesort' '4', 'UNION', 'a', 'ref', 'fk_Activite_Agent_centre_contact,fk_activite_agent_TH_heure', 'fk_activite_agent_TH_heure', '5', 'reporting_acd.g.Id_Granularite_de_periode', '2979', 'Using where' '4', 'UNION', 'cc', 'ALL', 'PRIMARY', NULL, NULL, NULL, '6', 'Using where; Using join buffer' NULL, 'UNION RESULT', '<union3,4>', 'ALL', NULL, NULL, NULL, NULL, NULL, '' '2', 'DERIVED', 'g', 'range', 'PRIMARY,Index_granularite,Index_Valeur_min', 'Index_granularite', '23', NULL, '389', 'Using where; Using temporary; Using filesort' '2', 'DERIVED', 'a', 'ALL', 'fk_agr_synthese_activite_media_fa_agent_centre_contact,fk_agr_synthese_activite_media_fa_agent_direction_contact,fk_agr_synthese_activite_media_fa_agent_file_attente,fk_agr_synthese_activite_media_fa_agent_media,fk_agr_synthese_activite_media_fa_agent_th_heure', NULL, NULL, NULL, '20903', 'Using where; Using join buffer' '2', 'DERIVED', 'cc', 'eq_ref', 'PRIMARY', 'PRIMARY', '4', 'reporting_acd.a.Id_Centre_Contact', '1', '' '2', 'DERIVED', 'f', 'eq_ref', 'PRIMARY', 'PRIMARY', '4', 'reporting_acd.a.Id_File_Attente', '1', '' '2', 'DERIVED', 'dc', 'eq_ref', 'PRIMARY', 'PRIMARY', '4', 'reporting_acd.a.Id_Direction_Contact', '1', 'Using where' '2', 'DERIVED', 'm', 'eq_ref', 'PRIMARY', 'PRIMARY', '4', 'reporting_acd.a.Id_Media', '1', 'Using where' don't know it very clear, but i think is the problem of seems it take full scaning than i change all the sub-query to views(create view as select sub-query), and the result is the same thanks for any advice

    Read the article

  • JavaScript tags, performance and W3C

    - by Thomas
    Today I was looking for website optimization content and I found an article talking about move JavaScript scripts to the bottom of the HTML page. Is this valid with W3C's recommendations? I learned that all JavaScript must be inside of head tag... Thank you.

    Read the article

  • Radiobuttonlist and load page in same initial position

    - by Khalid
    Hi I have this simple code in my page, I have a long page, if the client use this button then it shall reload the page and display the page from the beginning. I wish to be reload the page and display from the last position. <asp:RadioButtonList ID="RadioButtonList5" runat="server" AutoPostBack="True" RepeatDirection="Horizontal"> <asp:ListItem Value="45">Sheet2</asp:ListItem> </asp:RadioButtonList> Any advice, apprciated. Thank you.

    Read the article

  • Recover data from a Windows Dynamic Volume Spanned Disk

    - by iCe
    I have a dynamic volume created with two spanned partitions over two disk. Recently, one disk has started failing, and I want to copy the data inside that disk to another disk, before replacing it. However I don't know how to select only what is inside the failing disk, because the partitions spans across both disks. Maybe imaging the entire disk should do the work? Or I have to copy all the data from both disks? Thanks in advance!

    Read the article

  • Mysql regexp performance question

    - by Tim
    Rumour has it that this; SELECT * FROM lineage_string where lineage like '%179%' and lineage regexp '(^|/)179(/|$)' Would be faster than this; SELECT * FROM lineage_string where lineage regexp '(^|/)179(/|$)' Can anyone confirm ? Or know a decent way to test the speed of such queries. Thanks

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Fadeout a tiled background image in load using JQuery

    - by user346602
    Hi, I've used JQuery in the past to fade divs in and out successfully. However, I have encountered a situation I can't quite wrap my head around: I am coding a site for a designer who has based the formatting of all the elements on a grid pattern he's created. As he wants the pattern elements to be the same size independent of the browser window, I think I can only do this via a repeating background tiled image in CSS. Now he wants the background pattern (only) to come in dark and fade to very light, while not effecting any of the other elements. Am I right in thinking it's impossible to call a tiled background pattern using a CSS selector? Does anyone have any suggestions of a workaround to this problem?

    Read the article

  • Pre-load audio files at the client-side for later use

    - by awj
    I'm building an online test which implements audio (mp3) using the native audio player (i.e. non Flash-based). The test shows one question at a time and loads each subsequent question asynchronously. Some questions have an accompanying audio file, others don't, and the audio files can be several MB in size. So what I'm hoping to do is to preload the audio files client-side at the start of the test and then move these into place when the relevant question comes up. So far I've tried loading an audio file into a QuickTime player, then when that question comes up I use jQuery's clone(true) method to copy this into a part of the page which is displayed. However, when I do this the QuickTime player has to reload the audio file from source. Same is true for Windows Media Player. Does anyone have any suggestions as to how I can preload the audio client-side and then call it forward when needed?

    Read the article

< Previous Page | 386 387 388 389 390 391 392 393 394 395 396 397  | Next Page >