Search Results

Search found 80052 results on 3203 pages for 'data load performance'.

Page 391/3203 | < Previous Page | 387 388 389 390 391 392 393 394 395 396 397 398  | Next Page >

  • Help with data retrieval MACRO

    - by Andrei Ciobanu
    Hello, given the following structure: struct nmslist_elem_s { nmptr data; struct nmslist_elem_s *next; }; typedef struct nmslist_elem_s nmslist_elem; Where: typedef void* nmptr; Is it possible to write a MACRO that retrieves the data from the element and cast it to the right type: MACRO(type, element) that expands to *((type*)element->data). For example for int, i would need something like this: *((int*)(element->data)) .

    Read the article

  • How to load file into javascript

    - by misha-moroshko
    I have an HTML table that should be updated according the file that user uploads. In other words, I would like user to be able to upload a file, and change the contents of the table according to file content. The file size can be several MB. What are my options ? Do I must to upload the file to a server, or it can be done in client side ? Thanks !

    Read the article

  • Django: text fixture fails to load

    - by Esteban Feldman
    Hi all, Did a dumpdata of my project, then in my new test I added it to fixtures. from django.test import TestCase class TestGoal(TestCase): fixtures = ['test_data.json'] def test_goal(self): """ Tests that 1 + 1 always equals 2. """ self.failUnlessEqual(1 + 1, 2) When running the test I get: Problem installing fixture 'XXX/fixtures/test_data.json': DoesNotExist: XXX matching query does not exist. But manually doing loaddata works fine does not when the db is empty. I do a dropdb, createdb a simple syncdb the try loaddata and it fails, same error. Any clue? Python version 2.6.5, Django 1.1.1

    Read the article

  • How do I load all my location based content into google maps

    - by user333639
    I am writing an iPad application that uses the MapKit control. How do I get all my content into Google Maps. i.e. I have a bunch of locations along with photos, video, audio and various other information. So when the iPad user loads my App and zooms into a certain place in the world I want my Annotations to be visible and when they touch the pins they get access to more information etc.

    Read the article

  • Fadeout a tiled background image in load using JQuery

    - by user346602
    Hi, I've used JQuery in the past to fade divs in and out successfully. However, I have encountered a situation I can't quite wrap my head around: I am coding a site for a designer who has based the formatting of all the elements on a grid pattern he's created. As he wants the pattern elements to be the same size independent of the browser window, I think I can only do this via a repeating background tiled image in CSS. Now he wants the background pattern (only) to come in dark and fade to very light, while not effecting any of the other elements. Am I right in thinking it's impossible to call a tiled background pattern using a CSS selector? Does anyone have any suggestions of a workaround to this problem?

    Read the article

  • Stopping cookies being set from a domain (aka "cookieless domain") to increase site performance

    - by Django Reinhardt
    I was reading in Google's documentation about improving site speed. One of their recommendations is serving static content (images, css, js, etc.) from a "cookieless domain": Static content, such as images, JS and CSS files, don't need to be accompanied by cookies, as there is no user interaction with these resources. You can decrease request latency by serving static resources from a domain that doesn't serve cookies. Google then says that the best way to do this is to buy a new domain and set it to point to your current one: To reserve a cookieless domain for serving static content, register a new domain name and configure your DNS database with a CNAME record that points the new domain to your existing domain A record. Configure your web server to serve static resources from the new domain, and do not allow any cookies to be set anywhere on this domain. In your web pages, reference the domain name in the URLs for the static resources. This is pretty straight forward stuff, except for the bit where it says to "configure your web server to serve static resources from the new domain, and do not allow any cookies to be set anywhere on this domain". From what I've read, there's no setting in IIS that allows you to say "serve static resources", so how do I prevent ASP.NET from setting cookies on this new domain? At present, even if I'm just requesting a .jpg from the new domain, it sets a cookie on my browser, even though our application's cookies are set to our old domain. For example, ASP.NET sets an ".ASPXANONYMOUS" cookie that (as far as I'm aware) we're not telling it to do. Apologies if this is a real newb question, I'm new at this! Thanks.

    Read the article

  • Use one Socket for send and recieve data

    - by volody
    What makes more sense? use one socket to send and receive data to/from a embedded hardware device use one socket to send data and separate socket to read data Communication is not very intensive but the important point is to receive data as fast as possible. On application side is used Windows XP and up.

    Read the article

  • Performance implications of finalizers on JVM

    - by Alexey Romanov
    According to this post, in .Net, Finalizers are actually even worse than that. Besides that they run late (which is indeed a serious problem for many kinds of resources), they are also less powerful because they can only perform a subset of the operations allowed in a destructor (e.g., a finalizer cannot reliably use other objects, whereas a destructor can), and even when writing in that subset finalizers are extremely difficult to write correctly. And collecting finalizable objects is expensive: Each finalizable object, and the potentially huge graph of objects reachable from it, is promoted to the next GC generation, which makes it more expensive to collect by some large multiple. Does this also apply to JVMs in general and to HotSpot in particular?

    Read the article

  • Delete data from a SQL Server database on a full partition

    - by aleroot
    I have a SQL Server 2005 Database on a dedicated partition, during the time the database grown and now it have occupied all the space on the partition, now the problem is that the only operation I can do on the database is detach, but i want to remove old data from some tables to save space ... How can I remove old data from the database if SQL Server interface doesn't allow to run queries on it ?

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • Laptop Backup Synch to the Data Center Without VPN

    - by Sameer
    We would like to synchronize our users or backup their laptops to the data center – looking for suggestions/alternatives to synch them to the data center where they don’t have to know about it. Blue sky like to haves: • Don’t want VPN but needs to secure • Admin can access all files • Global dedup • Select file types only – MS Office, PSTs, PDFs • Incremental change only • Right now 60 users but needs to scale (all Windows7 64 bit) • Can allocate budget if have to Don’t mean to be vague but hoping to get some proven places to start.

    Read the article

  • basic JSON pulling data help..

    - by Webby
    New to json data and struggling i guess the answer is real easy but been bugging me for the last hour.. Sample data { "data": { "userid": "17", "dates": { "timestame": "1275528578", }, "username": "harino54", } } Ok I can pull userid or username easy enough with echo "$t->userid" or echo "$t->username " but how do I pull data from the brackets within ? in this case timestame? cant seem to figure it out.. any ideas?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Re-load Android activity data

    - by rhinds
    Hi, I am writing an Android app, part of which will be a survey involving multiple pages of checkbox question and answers. I have created an activity to display the question and options (from the DB) and what I want to do now is when i press the "Next" button it should just reload the current activity with the next question set from the database. (the activity starts with survey.getNextQuestion() - so its just a case of refreshing the activity so it updates) Im sure this is a simple thing to do -any ideas? Thanks

    Read the article

  • Recover data from a Windows Dynamic Volume Spanned Disk

    - by iCe
    I have a dynamic volume created with two spanned partitions over two disk. Recently, one disk has started failing, and I want to copy the data inside that disk to another disk, before replacing it. However I don't know how to select only what is inside the failing disk, because the partitions spans across both disks. Maybe imaging the entire disk should do the work? Or I have to copy all the data from both disks? Thanks in advance!

    Read the article

  • jQuery UI Tabs causes content to be cutoff on page load in IE6/IE7

    - by Patricker
    I have a web page with jQuery UI Tabs on it. Some of the content is in an html table. When the page loads some of the content will be cut off at the end, usually just the last few letters. If I change tabs and come back to the original tab then it fixes itself. This appears to be an issue just with Internet Explorer, specifically IE6/7, I haven't tested it on 8. I believe the issue is directly related to my use of the Blueprint CSS Framework as if I don't use Blueprint then I don't have the issue. Has anyone encountered this before or have any ideas?

    Read the article

  • Pre-load audio files at the client-side for later use

    - by awj
    I'm building an online test which implements audio (mp3) using the native audio player (i.e. non Flash-based). The test shows one question at a time and loads each subsequent question asynchronously. Some questions have an accompanying audio file, others don't, and the audio files can be several MB in size. So what I'm hoping to do is to preload the audio files client-side at the start of the test and then move these into place when the relevant question comes up. So far I've tried loading an audio file into a QuickTime player, then when that question comes up I use jQuery's clone(true) method to copy this into a part of the page which is displayed. However, when I do this the QuickTime player has to reload the audio file from source. Same is true for Windows Media Player. Does anyone have any suggestions as to how I can preload the audio client-side and then call it forward when needed?

    Read the article

  • Change a Munin server and keep the data

    - by Khelben
    We are migrating some servers, and we need tp change our Munin server. Most of the Munin nodes are not changed, and we would want to keep track of the historical data, if possible. I can set up a new Munin server, but I like to know if it's possible to transfer the old data to the new server, and how to do it.

    Read the article

  • problem with php_curl.dll load

    - by acer
    related Questions didn't help ! i have a problem loading php_curl.dll under following circumstances: XAMPP for windows 1.7.2 Apache 2.2.12 PHP 5.3.0 mod_ssl enabled in http.conf php_curl.dll enabled in php/ext copied ssleay32.dll and libeay32.dll in system32 checked the extension by php: if (extension_loaded('curl'))- FALSE ! and all i got in apache errors.log is: [Sat May 22 15:13:20 2010] [error] an unknown filter was not added: DEFLATE can you tell me what do i have to do ??!?!?!?

    Read the article

  • [JavaScript] How can I load static configuration information

    - by Goro
    In my code, I use JavaScript for UI and PHP for back end. I also use PHP to store application settings and sometimes my UI code needs to access this information. My configuration file looks something like this (config.php): $resolution_x = 1920; $resolution_y = 1080; etc... When I need to access any of these settings form JavaScript, i simply use to substitute the value directly, but it just doesn't strike me as very robust. Are they any dangers of doing this that I am not aware of? Is there a better way of doing this? Thank you,

    Read the article

< Previous Page | 387 388 389 390 391 392 393 394 395 396 397 398  | Next Page >