Search Results

Search found 13669 results on 547 pages for 'left handed'.

Page 392/547 | < Previous Page | 388 389 390 391 392 393 394 395 396 397 398 399  | Next Page >

• Making always-on-top windows follow the same MRU order as other windows

  - by nitro2k01

  Note: I'm using Windows 7 with the classical alt-tab style, ie the registry key AltTabSettings set to 1. I want to use MRU (most recently used) ordering of windows in the alt-tab list. However, because the windows are ordered in the Z order of the windows rather than actual MRU, this sometimes gives a different order after switching from an always-on-top application. Example: I have applications A, B and C open. A is set to always-on-top while the others aren't. A is focused. I now press alt-tab and application B is focused. I now press alt-tab but instead of application A receiving focus, application C does. Since A has a higher Z order, it's now left of application B, despite being the most recently used, and application C is placed right of B and is the one first getting focus by the cursor. To switch to application A, I need to press shift+alt-tab or cycle through all the other open windows. This is annoying when flicking focus back and forth between an always-on-top application and one that isn't always-on-top. Is there a way to make the alt-tab ordering strictly MRU?

  Read the article

• How to completely disable laptop sound?

  - by Alvaro Rodriguez

  I have a HP Pavillion DV7 laptop with win 8 pro. The laptop has an unidentified problem with sound drivers or hardware that sometimes causes volume to constantly jiggle up and down. This is very annoying because of these consequences: Renders mute unusable - as the volume changes the sound unmutes automatically Causes an annoying win 8 "surface UI" notification to appear constantly in the upper left corner, which is distracting enough by itself, but more importantly Renders the whole "surface UI" unusable, because it loses focus whenever the sound changing notification appears When the jiggling happens, the laptop also loses the ability to redirect sound to earphones - sound comes out of the speakers even if earphones are connected. To solve these issues I want to completely disable sound in the laptop (I've tried reinstalling drivers several times to no end). I have tried disabling all sound related drivers and devices in the Device Manager but Windows re-enables those automatically whenever I restart the laptop. The BIOS doesn't have any settings to disable sound hardware either. Please don't suggest having the laptop sound serviced or fixed. It's not worth the expense. I just want to remove sound support so I can use it normally. It is very unusable as it is now.

  Read the article

• Internal but no external Citrix Access?

  - by leeand00

  We recently had to reload our configuration of Citrix on our server Server1, and since we have, we can access Citrix internally, but not externally. Normally we access Citrix from http://remote.xyz.org/Citrix/XenApp but since the configuration was reloaded we are met with a Service Unavailable message. Internally accessing the Citrix web application from http://localhost/Citrix/XenApp/ on Server1 we are able to access the web application. And also from machines on our local network using http://Server1/Citrix/XenApp/. I have gone into the Citrix Access Management Console and from the tree pane on the left clicked on Citrix Access Management Console->Citrix Resources->Configuration Tools->Web Interface->http://remote.xyz.org/Citrix/PNAgent Citrix Access Management Console->Citrix Resources->Configuration Tools->Web Interface->http://remote.xyz.org/Citrix/XenApp, which in both cases displays a screen that reads Secure client access. Here it offers me several options: Direct, Alternate, Translated, Gateway Direct, Gateway Alternate, Gateway Translated. I know that I can change the method of use by clicking Manage secure client access->Edit secure client access settings which opens a window that reads "Specify Access Methods", and below that reads "Specify details of the DMZ settings, including IP address, mask, and associated access method", I don't know what the original settings were, and I also don't know how our DMZ is configured so that I can specify the correct settings, to give access to our external users on the http://remote.xyz.org/Citrix/XenApp site. We have a vendor who setup our DMZ and does not allow us access to the gateway to see these settings. What sorts of questions should I ask them to restore remote access?

  Read the article

• Find Search Replace from landmark to landmark - including everything in between

  - by Erick Tronboll

  Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

  Read the article

• How to Move SMS from iPhone to Mac?

  - by seda16

  SMS is the main form to Communicate with others, you would saved many messages on your iPhone. Well, there're many reasons you need to backup your iPhone sms to the Mac. For example, your family or friends have sent you some important and you want to save them on your iPhone in case you delete them by accident, or you just need to backup your sms for other use. So today let's talk about how to move sms from iPhone to Mac. It would be very easy if you use an app to help you, I always use the iPhone to Mac transfer on Amacsoft to copy sms from iPhone to Mac. Now let me tell you how to use this great app: Step 1:Connect iPhone to Mac First of all, you need to install and launch the iPhone to Mac transfer, then connect your iPhone to Mac. The iPhone to Mac transfer would recognise your iPhone automatically. And all information of your iPhone will be shown on an interface. Step 2:Select sms and Start the Export Now you can see many choice on the left, find "SMS" and click it, all sms on your iPhone will be listed on the right. Select and check those you want to move, then just click "Export" on the top to start the transfer. Wait just a few a minute the transfer will be done. Great! You have finish the transfer now, it's really very easy, right? I believe it won't be a problem if you want to transfer your sms from iPhone to Mac. By the way you can also use this Amacsoft iPhone to Mac transfer to move other kind of files , like photos, songs etc. If you're a windows user, you can use iPhone to PC transfer on this web to move sms from iPhone to your PC just with the same steps, good luck!

  Read the article

• Heavy Apache memory usage

  - by Ree

  Recently I've noticed that httpd processes started to consume massive amounts of memory - after some time pretty much using almost all of the 2GB of RAM the server has and I don't have any memory left for other stuff. Here's what top tells me: 26409 apache 15 0 276m 152m 28m S 0 7.4 0:59.12 httpd 26408 apache 15 0 278m 151m 28m S 0 7.4 1:03.80 httpd 26410 apache 15 0 277m 149m 26m S 0 7.3 0:57.22 httpd 26405 apache 15 0 276m 148m 25m S 0 7.3 0:59.20 httpd 26411 apache 16 0 276m 146m 23m S 0 7.2 1:09.18 httpd 17549 apache 15 0 276m 144m 23m S 0 7.0 0:36.34 httpd 22095 apache 15 0 276m 136m 14m S 0 6.6 0:30.56 httpd It seems to me that each httpd process does not free the memory after handling a request. So they all sit at ~270MB which is BAD. Is there a way for me to know where all the memory goes and why it stays that way? I haven't done any server tweaking lately, so I'm sure it's not me who messed something up (haven't had the problem before). The server is used to serve PHP apps. EDIT: Apache is configured with prefork module and MaxRequestsPerChild is set to 4000.

  Read the article

• Toshiba Qosmio: Battery Stuck at 60%, does not Charges, PC can't power up, can't remain on with out

  - by Fellknight

  Just like the tittle says, now let me try to give some more detail about the symptoms; The battery is stuck at 60 percent (68% at the moment of this writing).When hovering over the battery icon in Windows 7 Home Premium x64 it reads:"68% available (plugged in, charging)", there's no x or any sing the OS is displaying any error. No matter how much time left connected to the AC adapter the battery doesn't charge, it seems however it continues to discharge at its normal rate when disconnected from the laptop (about 1% each 2 weeks). Now this last symptom is the one i find most strange it "seems" the laptop somehow isn't recognizing the battery because even with the remaining charge of 60%(ish) the laptop wont power up or remain on if disconnected from its AC adapter(if it's on and is unplugged it will immediately turn off). Meaning that even with the battery attached correctly in its right place is as if running the laptop with no battery at all. Toshiba's Utilities haven't detected anything strange (or anything for that matter) with the battery or the hardware. The laptop when in use is connected 90% of the time to a Belkin surge protector (like my 1TB EHD). The protector is working correctly (green light on) and the 1TB HD too, thus a power surge having damaged it's very unlikely. Thnx in advance

  Read the article

• How to count the most recent value based on multiple criteria?

  - by Andrew

  I keep a log of phone calls like the following where the F column is LVM = Left Voice Mail, U = Unsuccessful, S = Successful. A1 1 B1 Smith C1 John D1 11/21/2012 E1 8:00 AM F1 LVM A2 2 B2 Smith C2 John D2 11/22/2012 E1 8:15 AM F2 U A3 3 B3 Harvey C3 Luke D3 11/22/2012 E1 8:30 AM F3 S A4 4 B4 Smith C4 John D4 11/22/2012 E1 9:00 AM F4 S A5 5 B5 Smith C5 John D5 11/23/2012 E5 8:00 AM F5 LVM This is a small sample. I actually have over 700 entries. In my line of work, it is important to know how many unsuccessful (LVM or U) calls I have made since the last Successful one (S). Since values in the F column can repeat, I need to take into consideration both the B and C column. Also, since I can make a successful call with a client and then be trying to contact them again, I need to be able to count from the last successful call. My G column is completely open which is where I would like to put a running total for each client (G5 would = 1 ideally while G4 = 0, G3 = 0, G2 = 2, G1 = 1 but I want these values calculated automatically so that I do not have scroll through 700 names).

  Read the article

• Backup, Migrate or Clone Failing CentOS 4 (LVM)

  - by Hegelworm

  Hello there, I've been running a BlueQuartz CentOS 4 system (Nuonce.net distro) for a few years now and although the hard drive (Deskstar) has always been a bit noisy, on a few recent occasions I've heard it having trouble spinning up. Basically, I want to clone this drive to a similar sized one (80 Gig). I've spent many hours reading upon dd, dd_rescue, rsync, clonezilla and LVM mirroring yet the sheer number of options and nightmarish accounts has left me frozen - unable to make an informed decision as to how to start. I've made a few attempts. dd failed after about 2 hours, as, although the drives appeared to be identical on the surface (ATA Seagate Barracudas, Thai not Chinese), the destination drive is slightly smaller. My most recent attempt involved using a Debian CD to format the new drive and then rsync-ing everything over and editing the new drive's grub and fstab to reflect the changes. No joy here either as I hadn't chosen LVM when partitioning the destination drive and it wouldn't boot. As you can probably tell, I'm out of my depth here and a panic-invoking mixture of caution and frustration has prompted me to sign up here. The server itself, although not strictly a production environment, has a very specific installation of Festival, LAME and ffMpeg and provides the back-end for a Text-to-Speech jQuery plugin that I've built over the last 2 years. I'm also planning to rebuild the whole TTS system on Debian as the existing CentOS system still has PHP4 etc. For now though, I'd really like to just shift everything over to a new drive. As this is my first post, please feel free to lay any house rules on me that I might've overlooked; I've been hovering around StackOverflow for a while now but have only just signed up. Many thanks.

  Read the article

• Odd IIS FTP Failure

  - by Monkey Boson

  We're running a script on our production box that zips up our database and FTPs it to a backup box every night. Our production box is running Redhat Enterprise 5. Our backup box is running Windows XP Pro / IIS 5.1. Both machines are on the same VLAN (not sure if this is imporatant). The backup file usually clocks in at around 3GB. Every now and again (~5% of the time), the backup script fails. The shell script on the "client side" - which looks at return codes - never identifies any problem since ftp always returns 0. On the "server side", IIS writes out a log that looks like this: #Software: Microsoft Internet Information Services 5.1 #Version: 1.0 #Date: 2009-08-08 07:04:25 #Fields: time c-ip cs-method cs-uri-stem sc-status sc-win32-status 07:04:25 192.168.111.235 [15]USER backup 331 0 07:04:25 192.168.111.235 [15]PASS - 230 0 07:05:54 192.168.111.235 [15]created backup_20090808.zip 426 10035 07:06:16 192.168.111.235 [15]QUIT - 426 0 Now, I know that 426 means "Connection closed, transfer aborted", which is sort-of a catch-all for "IIS was not happy". The real puzzler is the wincode: 10035 (WSAEWOULDBLOCK -- Resource temporarily unavailable). My understanding is that this code is normal when using non-blocking socket calls - which would almost certainly be used by any FTP Server implementation. My first guess that it might be a timeout issue doesn't make sense, since we're only talking about a few minutes here and the timeout was left at the default 900 s. Does anybody have any ideas about what is causing this problem, and how it may be fixed? Thanks!

  Read the article

• Understanding what needs to be in place for a server to send outgoing email from a linux box

  - by Matt

  I am attempting to configure an openSuse 11.1 box to send outgoing email for a domain that the same server is hosting. I don't understand enough about smtp servers and the like to know what needs to be in place and working. The system already had Postfix installed, and I confirmed it was running via a > sudo /etc/init.d/postfix status I examined the Postfix config file in /etc/main.cf and configured a couple of items regarding the domain/host name and such, but left it largely default. I attempted to send an email from the command line with the following command: > echo "test 123" | mail -s "test subject" [email protected] Where differentdomain.com was not the same domain as the one best hosted on the server. However, the email never reaches the target account. Any suggestions? EDIT: In the postfix log, (/var/log/mail.info, there's nothing in .err) I see that postfix is trying to connect to what appears to be a different smtp server on our network, with a connection refused: connect to ourdomain.com.inbound15.mxlogic.net[our ip address]:25: Connection refused However, I can't figure out why it is 1) trying to connect to that server and 2) not just sending the messages itself... I mean, isn't postfix an smtp server? I did a grep -ri on ourdomain from /etc and see no configuration files anywhere telling it to do this. Why is it?

  Read the article

• Variable size encrypted container

  - by Cray

  Is there an application similar to TrueCrypt, but the one that can make variable size containers opposed to fixed-size or only-growing-to-certain-amount containers which can be made by TrueCrypt? I want this container to be able to be mounted to a drive/folder, and the size of the outer container not be much different from the total size of all the files that I put into the mounted folder, while still providing strong encryption. If to put it in other words, I want a program like truecrypt, which not only automatically grows the container if I put in new files, but also decreases it's size if some files are deleted. I know there are some issues of course, and it would not work 100% as truecrypt, because it basically works on the sector level of the disk, giving all the filesystem-control to the OS, and so when I remove a file, it might as well be left there, or there might be some fragmentation issues that would stop just truncating the volume from working, but perhaps a program can be built in some other way? Instead of providing sector-level interface, it would provide filesystem-level interface? A filesystem inside a file which would support shrinking when files are deleted?

  Read the article

• I can't download or stream for more then 3 sec, and then the conection activity just dies

  - by JMHein

  Just got a new internet connection installed at my sisters place, but it randomly just stops working. At first it was only affecting flash videos. they would randomly just stop buffering. I did a lot of research on this and found that there can be many things that cause this exact trouble. I then tried IE and some flash would stream fine, but still random deaths. So I told my brother in law to reset the router and modem and that fixed the problem for them but not my laptop. I then started trying to fix the flash problem only to fined that downloads of any kind were affected. Now it is so bad that 50% of page loads will never finish because the connection drops to 0% usage with in a split sec. I can't get flash reinstalled because the installer is trying to download but the download dies at 8% I tried up loading a large file by FTP to a web server with no troubles. Yet any activity on my end that takes longer then about 1 sec to finish, just never finishes I can watch the network log in the taskmanager and it spikes for ruffly one sec then drops back to zero and when I go back to the web page it says it is still loading and no matter how long I let it sit it never does any thing more till I reload then it will again create a very short spike of activity on the connection and then drop to zero. Also if I start a download and it does drop off I can restart the download where it left off and get up to 100Kb/s for around the same one sec then it drops to around 14Kb/s then zero a sec latter... I am running Win 7 home prem x64 with FF11 and IE8 I have simply tried every thing I can short of calling up the ISP which very likely will get me no where fast. any advice on what step to take to figure this out would be nice. I am not even sure it is not just an ISP problem. (at least I should be able to get flash reinstalled once I get back home)

  Read the article

• Extract large zip file (50 GB) on Mac OS X

  - by chingjun

  I was trying to move the files to another hard drive. So I archived all my photos in one large ZIP file using the Mac OS X built-in compress function. But the file failed to extract. I've tried many programs, but none of the programs I tried were able to extract the file. I've tried Mac OS X's extract utility, StuffIt Expander, 7-Zip (command line), all failed. Mac's archive utility and StuffIt don't seem to support large files, and 7-Zip's command line version gave an error stating unsupported archive. I have no luck in Windows either as many of my files have Chinese filenames, and couldn't extract to the correct name under Windows. Are there some programs that can support large files, can handle files compressed using Mac OS X's compress function, and can support UTF-8 filename? With or without GUI is fine. Update Well, I had made the wrong decision to compress the files, and it's already too late. I thought I should be able to extract the file if I could compress it. It's too late, the original copies are gone, only a large ZIP file left here. I have tried using 'unzip', but it says End-of-central-directory signature not found. I guess it doesn't have large file support as well. I would try the Windows Vista method as stated by SuperMagic, but I need to borrow a computer for that. Anyway, thank you everyone, but please provide more suggestions on what software that could possibly extract that file.

  Read the article

• Setting up a Pagefile and Partition in Server 2008

  - by Brett Powell

  I am setting up 18 new machines for our company, and I have instructions from my new boss on setting up a Pagefile and Partition. I have looked at their existing machines to base the new setups off of, but there is no consistency between any 2 machines, which has left me extremely frustrated to say the least. My instructions are... 1) Set a static pagefile (use recommended value as max/min), set it on SSD if SSD available. 2) Make 3 partitions: C: is used for OS and install files D: is used for backups on machines with a SSD. On machines without SSD create a D: partition for pagefile (2*installed RAM for partition size) E: must be the partition hosting user files I have never messed with Pagefiles before, and looking at their existing machines is offering no help. My questions are... 1) As the machines I am setting up have no SSD (just 2 SATA drives) does it sound like the Pagefile should be setup on the C: (primary) drive or the D:? The instructions are vague so I have no idea. 2) As C: and D: are both Physical drives, does it sound like C: should be partitioned out to create the E: drive or D:? Thanks for any help I can get. I am extremely stressed out under a massive workload right now, and these vague instructions are quite infuriating.

  Read the article

• Workstations cannot see new MS Server 2008 domain, but can access DHCP.

  - by Radix

  The XP Pro workstations do not see the new replacement domain upon boot; they only see their cached entry for the old (server 2003) domain controller. The old_server is not connected to the network. I have DHCP working with the same scope as the old_server. In my "before-asking" search for a solution I came across the following two articles, and I recall doing things as suggested by the articles. http://www.windowsreference.com/windows-server-2008/how-to-setup-dhcp-server-in-windows-server-2008-step-by-step-guide/ http://www.windowsreference.com/windows-server-2008/step-by-step-guide-for-windows-server-2008-domain-controller-and-dns-server-setup/ The only possible issue is: I was under the impression that the domain netbios needed to match the DC's netbios. The DC netbios is city01 while the domain's FQDN is city.domain.org (I think this is mistaken and should have been just domain.org) But, the second link led me to a post which I believe answers my question. I did as they instructed by opening Local Area Connection Properties, then selecting TCP/IPv4 and setting the sole preferred DNS server to the local hosts static IP (10.10.1.1). Search for "Your problems should clear up" for the post I'm referencing: http://forums.techarena.in/active-directory/1032797.htm Have I misunderstood their instructions? I am hoping to reach the point where I can define users and user groups. Also, does TechNet have a single theoretical overview document I could read. I really don't like treating comps as magic. I will be watching this closely and will quickly answer any questions. If I've left anything out it is because I did not know it was needed. PS: I am loath to ask obviously basic questions, but I am tired and wish to fix this before tomorrow. Also, this is my first server installation, thank you for your help.

  Read the article

• Where is my free space?

  - by Andrey

  A week ago I got a low disk space warning on my Vista x64 Ultimate box - 60 Mb free on the disk C; I cleaned up some downloaded msdn images and got 20 Gb freed up. Three days ago I got another notification, it looked suspicious but I didnt have time to deal with it and just moved some heavy stuff to another drive to free up about 17 Gb.... Today morning - 53Mb left on drive C, again! Now it looks really suspecious, so I downloaded TreeSize to see what's taking up the space, just to see it reporting only 121 GB out of 200 GB used, in other words I suppose to have about 79 Gb free. Then I went to Folder Options, enabled viewing of system and hidden files, rerun teh tool to see another 5 Gb added (which is expected). Then I open disk C in windows explorer, select all and right click Properties, to see it reporting teh same amount of files - 126 Gb. But when I look at Drive C properties, it reports that 200GB of 200 Gb are taken. I just scanned the drive with two different antiviruses - Symantec and AVG and found no viruses... I'm a little confused at this point, any ideas where is my free space, woudl be highly appreciated! Thank you! Andrey

  Read the article

• How can a Linux Administrator improve their shell scripting and automation skills?

  - by ewwhite

  In my organization, I work with a group of NOC staff, budding junior engineers and a handful of senior engineers; all with a focus on Linux. One interesting step in the way the company grows talent is that there's a path from the NOC to the senior engineering ranks. Viewing the talent pool as a relative newcomer, I see that there's a split in the skill sets that tends to grow over time... There are engineers who know one or several particular technologies well and are constantly immersed... e.g. MySQL, firewalls, SAN storage, load balancers... There are others who are generalists and can navigate multiple technologies. All learn enough Linux (commands, processes) to do what they need and use on a daily basis. A differentiating factor between some of the staff is how well they embrace scripting, automation and configuration management methodologies. For instance, we have two engineers who do the bulk of Amazon AWS CloudFormation work, and another who handles most of the Puppet infrastructure. Perhaps a quarter of the engineers are adept at BASH shell scripting. Looking at this in the context of the incredibly high demand for DevOps skills in the job market, I'm curious how other organizations foster the development of these skills and grow their internal talent. Scripting doesn't seem like a particularly-teachable concept. How does a sysadmin improve their shell scripting? Is there still a place for engineers who do not/cannot keep up in the DevOps paradigm? Are we simply to assume that some people will be left behind as these technologies evolve? Is that okay?

  Read the article

• Best way to mount 3-4 monitor like this?

  - by jasondavis

  I just purchased 2 HP 2009m widescreen monitors, they are not the biggest thing on the block, they are like 19-20" and are only around 150-200$ so I think they are perfect. I bought 2 of them just to make sure I like them, with the full intention of purchasing more to make either a tripple or quad display. I now I am stuck trying to decide, if I purchase 1 more to have a tripple display I would then like to just wrap the third monitor to either the rigth or left side, I could do this without a mount most likely pretty easy. If I decide to go with 2 more monitors to make a quad display then I would like to add the 2 new monitor directly above the 2 that I have now. So it would make a grid of 2 wide and 2 high. I have posted a few photos belwo to show them now with the 2 I have, you will notice that I have them tilted inwards to make more of a "V" shape instead of them being side by side and "STRAIGHT". Now if I decide to make thegrid of 4 then I will need to buy or build a stand to hold them all tightly together (no whitespace or gap between the grid of monitors) but I would like to still have both rows invert to make the slight "V". Do you know of any existing stands I could purchase that would hold all 4 monitors without making them be STARIGHT without the "V" shape? Any tips appreciated please, also they do have holes in the back for VESA. a few photos... (they are from iphone and lighting made them note very good but you can see what I am working with here)

  Read the article

• How to tackle dell support system? [closed]

  - by Nishant Kumar

  We have purchased a Dell Optiplex 9010 SSFV for our organization's work. Since the first installation two of the USB keyboard keys were not working properly. I had to press those keys two times simultaneously, on first time keys did not work and for for second time it printed two characters (as it were buffering first character.) Two keys that were not working properly: Hexangrave (Below the ESC key: `) Double Quotes (Left the enter key ") We registered our complaint with DELL and they suggested (with some hard to understand and weird ENGLISH accent) some test and tricks, such as switching to different ports, checking keyboard on different PC, and it worked well with diff. PC(with Windows 7 Home Premium installed). It was clear that it is an OS fault, hence they suggested to re-install OS. Problem began here, we have a project on the run and currently a video editing project setup on our system, so can't re-install system in hurry and also DELL persons were not providing any other solution such as updating keyboard driver, etc. Arguments I am a Software Engg. and don't think it is a feasible solution to re-install entire system for simple problems. This prob is coming since the fresh system installation, so I don't think it will solve the problem. Finally, I had to find solution myself and got it here, now I want to show my disappointment to dell persons or at least tell them that they should improve there support system to not advice to re-install entire system for that simple problems. Notes We have purchased 5 years NEXT business day support from DELL for around 8000 INR (Not for that kind of solutions from DELL). So can anyone tell me how to tackle dell support system officially, so that they will pay more attention in near future. Thanks

  Read the article

• HP LaserJet 2550 has a carousel motor error

  - by Arlen Beiler

  I have a LaserJet 2550, and it's worked pretty good for a long time (except for some slowness a while back, spooling I think), but just recently it suddenly quit working. We moved this summer, but left it at our other place, and just recently when my Dad went over there to try to print something out, it didn't work. When you turn it on, you hear the fan give a false start (basically a quick pulse), and the carousel goes through its usual thing. Then it starts up in earnest like it's getting ready to print something. All of a sudden it just stops. Everything stops, and the three lower lights are steady. When I push the Go button, the Go light (bottom of the 3) turns off, but the other two stay on. I looked it up on the HP website and it says it is a carousel motor problem. I called HP, but they said it is out of warranty. I've opened the cover and held the switch with a screw driver so I could watch it, and it goes through its thing like I described (doesn't seem to make a difference whether the imaging drum is in or not), then when it stops it kind of seems to jump back a little bit (the carousel). I hope this all makes sense (I know you like details), and hopefully you also know what to do to fix it. Thanks.

  Read the article

• XAMPP CURL not working!

  - by MiffTheFox

  Nope, it's not. Windows Vista Home Premium x32: Relevant section of php.ini: ; Windows Extensions ; Note that ODBC support is built in, so no dll is needed for it. ; Note that many DLL files are located in the extensions/ (PHP 4) ext/ (PHP 5) ; extension folders as well as the separate PECL DLL download (PHP 5). ; Be sure to appropriately set the extension_dir directive. ;extension=php_apc.dll ;extension=php_apd.dll ;extension=php_bcompiler.dll ;extension=php_bitset.dll ;extension=php_blenc.dll ;extension=php_bz2.dll ;extension=php_bz2_filter.dll ;extension=php_classkit.dll ;extension=php_cpdf.dll ;extension=php_crack.dll extension=php_curl.dll ;extension=php_cvsclient.dll ;extension=php_db.dll ;extension=php_dba.dll ;extension=php_dbase.dll ;extension=php_dbx.dll Proof it's not working: c:\users\miff>curl http://localhost/xampp/phpinfo.php | grep curl % Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed 100 62592 0 62592 0 0 1971k 0 --:--:-- --:--:-- --:--:-- 3319k <tr><td class="e">HTTP_USER_AGENT </td><td class="v">curl/7.16.3 (i686-pc-cygwin) libcurl/7.16.3 OpenSSL/0.9.8k zlib/1.2.3 libssh2/0.15-CVS </td></tr> <tr><td class="e">User-Agent </td><td class="v">curl/7.16.3 (i686-pc-cygwin) libcurl/7.16.3 OpenSSL/0.9.8k zlib/1.2.3 libssh2/0.15-CVS </td></tr> <tr><td class="e">_SERVER["HTTP_USER_AGENT"]</td><td class="v">curl/7.16.3 (i686-pc-cygwin) libcurl/7.16.3 OpenSSL/0.9.8k zlib/1.2.3 libssh2/0.15-CVS</td></tr> c:\users\miff>

  Read the article

• Apache2 with lighttpd as proxy

  - by andrzejp

  Hi, I am using apache2 as web server. I would like to help him lighttpd as a proxy for static content. Unfortunately I can not well set up lighttpd and apache2. (OS: Debian) Important things from lighttpd.config: server.modules = ( "mod_access", "mod_alias", "mod_accesslog", "mod_proxy", "mod_status", ) server.document-root = "/www/" server.port = 82 server.bind = "localhost" $HTTP["remoteip"] =~ "127.0.0.1" { alias.url += ( "/doc/" => "/usr/share/doc/", "/images/" => "/usr/share/images/" ) $HTTP["url"] =~ "^/doc/|^/images/" { dir-listing.activate = "enable" } } I would like to use lighttpd in only one site operating as a virtual directory on apache2. Configuration of this virtual directory: ProxyRequests Off ProxyPreserveHost On ProxyPass /images http://0.0.0.0:82/ ProxyPass /imagehosting http://0.0.0.0:82/ ProxyPass /pictures http://0.0.0.0:82/ ProxyPassReverse / http://0.0.0.0:82/ ServerName MY_VALUES ServerAlias www.MY_VALUES UseCanonicalName Off DocumentRoot /www/MYAPP/forum <Directory "/www/MYAPP/forum"> DirectoryIndex index.htm index.php AllowOverride None ... As you can see (or not;)) my service is physically located at the path: / www / myapp / forum and I would like to support lighttpd dealt with folders: / www / myapp / forum / images / www / myapp / forum / imagehosting / www / myapp / forum / pictures and left the rest (PHP scripts) for apache After running lighttpd and apache2 working party, but did not show up any images of these locations. What is wrong?

  Read the article

• SQL Server Installaion error 0x84B40000

  - by Kurtevich

  I have a problem installing SQL Server 2008 R2. Long time ago I had it installed, and then uninstalled. It was left in "Add/remove programs", but I didn't pay attention on that. I had 2005 installed. And now there is a need to install 2008. I removed 2005 and started installing 2008, but it says that space on C: is not enough. That's when I found out that "Add/remove programs" shows it occupying more than 4 gigabytes, though I used to uninstall it. So I click "Remove", it shows all those many screens and validations, shows that removal completed, but the size of Program Files folder is still more than 4 GB. I removed (from "Add\remove programs" everything that had "SQL Server" in it's name, but that main "SQL Server 2008" item is still there and still 4 GB and uninstalling does nothing. Because installation of SQL Server did not show existing instances, and I don't see any running services related to SQL server (well, almost any, more details in the end), I though that this folder contains just some leftover staff and data and deleted it manually. Then agreed to removing of the item in "Add/remove programs" and everything looks clean. Now every time I try to install SQL Server (even in the minimum configuration), I receive the following error: SQL Server Setup has encountered the following error: The specified credentials that were provided for the SQL Server service are not valid. To continue, provide a valid account and password for the SQL Server service. Error code 0x84B40000. What is this service mentioned here? This error looks like I'm trying to add features to existing server and it can't login. But the setup didn't ask me for any credentials, except one username that couldn't be changed. Here are the services shown that can be related, both disabled and pointing to non-existing executables: SQL Active Directory Helper Service SQL Full-text Filter Daemon Launcher (MSSQLSERVER) I understand that this must be because of my manual deletion, but is there a way to clean it up now?

  Read the article

• Copying symbolic links and filenames with special characters to NAS

  - by Mr E

  I have a new Western Digital My Book Live NAS. I am trying to copy files from an old drive to the NAS. I'm using Ubuntu 12.04 and I've mounted the drive by browsing the network in Nautilus and choosing a shared folder configured on the NAS. The shared folder is then automatically mounted at .gvfs/files on mybooklive. There are two problems so far: File names and directory names containing certain characters (e.g. : or |). Attempting to copy these results in the error message: cp: cannot stat `/path/to/destination.filename': Invalid argument Symbolic links. In Nautilus I get the error message: Symlinks not supported by backend My questions are: Can I connect to the NAS or configure the NAS so that I can copy my files without this problem? (In case it matters, I don't need Windows compatibility.) If not, what can I do to identify all the problem files? Can I do anything to automatically fix my filenames Please let me know if any of this needs clarification. I'm not too familiar with all of this so I may have left out some useful information.

  Read the article

< Previous Page | 388 389 390 391 392 393 394 395 396 397 398 399  | Next Page >