Search Results

Search found 183 results on 8 pages for 'chr'.

Page 4/8 | < Previous Page | 1 2 3 4 5 6 7 8  | Next Page >

  • mcrypt decoding errors

    - by Kyle Hudson
    Hi, I have a few issues with the following php functions (part of a bigger class). //encode public function acc_pw_enc($text, $key) { $text_num = str_split($text, 8); $text_num = 8 - strlen($text_num[count($text_num)-1]); for ($i=0; $i < $text_num; $i++) { $text = $text . chr($text_num); } $cipher = mcrypt_module_open(MCRYPT_TRIPLEDES, '', 'cbc', ''); mcrypt_generic_init($cipher, $key, 'fYfhHeDm'); $decrypted = mcrypt_generic($cipher, $text); mcrypt_generic_deinit($cipher); return base64_encode($decrypted); } //decode public function acc_pw_dec($encrypted_text, $key) { $cipher = mcrypt_module_open(MCRYPT_TRIPLEDES, '', 'cbc', ''); mcrypt_generic_init($cipher, $key, 'fYfhHeDm'); $decrypted = mdecrypt_generic($cipher, base64_decode($encrypted_text)); mcrypt_generic_deinit($cipher); $last_char = substr($decrypted, -1); for($i=0; $i < 8-1; $i++) { if(chr($i) == $last_char) { $decrypted = substr($decrypted, 0, strlen($decrypted)-$i); break; } } return rtrim($decrypted); //str_replace("?", "", $decrypted); } So for exampe if i encrypt the string 'liloMIA01' with the salt/key 'yBevuZoMy' i will get '7A30ZkEjYbDcAXLgGE/6nQ=='. I get liloMIA01 as the decrypted value, i tried using rtrim but it didn't work.

    Read the article

  • RFC: Whitespace's Assembly Mnemonics

    - by Noctis Skytower
    Request For Comment regarding Whitespace's Assembly Mnemonics What follows in a first generation attempt at creating mnemonics for a whitespace assembly language. STACK ===== push number copy copy number swap away away number MATH ==== add sub mul div mod HEAP ==== set get FLOW ==== part label call label goto label zero label less label back exit I/O === ochr oint ichr iint In the interest of making improvements to this small and simple instruction set, this is a second attempt. hold N Push the number onto the stack copy Duplicate the top item on the stack copy N Copy the nth item on the stack (given by the argument) onto the top of the stack swap Swap the top two items on the stack drop Discard the top item on the stack drop N Slide n items off the stack, keeping the top item add Addition sub Subtraction mul Multiplication div Integer Division mod Modulo save Store load Retrieve L: Mark a location in the program call L Call a subroutine goto L Jump unconditionally to a label if=0 L Jump to a label if the top of the stack is zero if<0 L Jump to a label if the top of the stack is negative return End a subroutine and transfer control back to the caller exit End the program print chr Output the character at the top of the stack print int Output the number at the top of the stack input chr Read a character and place it in the location given by the top of the stack input int Read a number and place it in the location given by the top of the stack What is the general consensus on the following revised list for Whitespace's assembly instructions? They definitely come from thinking outside of the box and trying to come up with a better mnemonic set than last time. When the previous python interpreter was written, it was completed over two contiguous, rushed evenings. This rewrite deserves significantly more time now that it is the summer. Of course, the next version of Whitespace (0.4) may have its instructions revised even more, but this is just a redesign of what originally was done in a few hours. Hopefully, the instructions make more sense to those new to programming jargon.

    Read the article

  • EXPORT AS INSERT STATEMENTS: But in SQL Plus the line overrides 2500 characters!

    - by The chicken in the kitchen
    Hello, I have to export an Oracle table as INSERT STATEMENTS. But the INSERT STATEMENTS so generated, override 2500 characters. I am obliged to execute them in SQL Plus, so I receive an error message. This is my Oracle table: CREATE TABLE SAMPLE_TABLE ( C01 VARCHAR2 (5 BYTE) NOT NULL, C02 NUMBER (10) NOT NULL, C03 NUMBER (5) NOT NULL, C04 NUMBER (5) NOT NULL, C05 VARCHAR2 (20 BYTE) NOT NULL, c06 VARCHAR2 (200 BYTE) NOT NULL, c07 VARCHAR2 (200 BYTE) NOT NULL, c08 NUMBER (5) NOT NULL, c09 NUMBER (10) NOT NULL, c10 VARCHAR2 (80 BYTE), c11 VARCHAR2 (200 BYTE), c12 VARCHAR2 (200 BYTE), c13 VARCHAR2 (4000 BYTE), c14 VARCHAR2 (1 BYTE) DEFAULT 'N' NOT NULL, c15 CHAR (1 BYTE), c16 CHAR (1 BYTE) ); ASSUMPTIONS: a) I am OBLIGED to export table data as INSERT STATEMENTS; I am allowed to use UPDATE statements, in order to avoid the SQL*Plus error "sp2-0027 input is too long(2499 characters)"; b) I am OBLIGED to use SQL*Plus to execute the script so generated. c) Please assume that every record can contain special characters: CHR(10), CHR(13), and so on; d) I CAN'T use SQL Loader; e) I CAN'T export and then import the table: I can only add the "delta" using INSERT / UPDATE statements through SQL Plus.

    Read the article

  • How can I automatically elevate a COM interface used for automation?

    - by Jim Flood
    I have a Windows service built with ATL to expose a LocalServer32 COM interface for a set of admin commands used for configuring the service, and these can be used from VBScript for example: Set myObj = WScript.CreateObject("MySvc.Administrator") myObj.DoSomething() I want DoSomething to run elevated, and I would like the UAC prompt to come up automatically when this is called by the VBScript. Is this possible? I know I can run the script in an elevated command shell, and that I can use objShell.ShellExecute WScript.FullName, Chr(34) & WScript.ScriptFullName & Chr(34), vbNullString, "runas" for example, to run the VBScript itself elevated, and either of those work fine -- the COM method finds itself elevated. However, AFAIK getting an elevated Explorer window on the desktop is convoluted (it's not as simple as right-clicking Start/Accessories/Windows Explorer/Run as Administrator, which doesn't actually elevate.) I want a user in the local admin group to be able to drag-and-drop files and folders onto the script, and then have the script call the admin COM interface with those pathnames as arguments. (And I am hoping for something simpler than monkeying around with the args and using ShellExecute "runas".) I've tried setting UAC Execution Level to requireAdministrator in the service EXE's manifest, and setting Elevated/Enabled = 1 and LocalizedString in the registry for the MySvc.Administrator class, and these don't do the trick.

    Read the article

  • Need help with PHP URL encoding/decoding

    - by Kenan
    On one page I'm "masking"/encoding URL which is passed to another page, there I decode URL and start file delivering to user. I found some function for encoding/decoding URL's, but sometime encoded URL contains "+" or "/" and decoded link is broken. I must use "folder structure" for link, can not use QueryString! Here is encoding function: $urll = 'SomeUrl.zip'; $key = '123'; $result = ''; for($i=0; $i<strlen($urll); $i++) { $char = substr($urll, $i, 1); $keychar = substr($key, ($i % strlen($key))-1, 1); $char = chr(ord($char)+ord($keychar)); $result.=$char; } $result = urlencode(base64_encode($result)); echo '<a href="/user/download/'.$result.'/">PC</a>'; Here is decoding: $urll = 'segment_3'; //Don't worry for this one its CMS retrieving 3rd "folder" $key = '123'; $resultt = ''; $string = ''; $string = base64_decode(urldecode($urll)); for($i=0; $i<strlen($string); $i++) { $char = substr($string, $i, 1); $keychar = substr($key, ($i % strlen($key))-1, 1); $char = chr(ord($char)-ord($keychar)); $resultt.=$char; } echo '<br />DEC: '. $resultt; So how to encode and decode url. Thanks

    Read the article

  • regular expression code

    - by Gaia Andreoletti
    Deal all, I need to find match between two tab delimited files files like this: File 1: ID1 1 65383896 65383896 G C PCNXL3 ID1 2 56788990 55678900 T A ACT1 ID1 1 56788990 55678900 T A PRO55 File 2 ID2 34 65383896 65383896 G C MET5 ID2 2 56788990 55678900 T A ACT1 ID2 2 56788990 55678900 T A HLA what I would like to do is to retrive the matching line between the two file. What I would like to match is everyting after the gene ID So far I have written this code but unfortunately perl keeps giving me the error: use of "Use of uninitialized value in pattern match (m//)" Could you please help me figure out where i am doing it wrong? Thank you in advance! use strict; open (INA, $ARGV[0]) || die "cannot to open gene file"; open (INB, $ARGV[1]) || die "cannot to open coding_annotated.var files"; my @sample1 = <INA>; my @sample2 = <INB>; foreach my $line (@sample1) { my @tab = split (/\t/, $line); my $chr = $tab[1]; my $start = $tab[2]; my $end = $tab[3]; my $ref = $tab[4]; my $alt = $tab[5]; my $name = $tab[6]; foreach my $item (@sample2){ my @fields = split (/\t/,$item); if ($fields[1]=~ m/$chr(.*)/ && $fields[2]=~ m/$start(.*)/ && $fields[4]=~ m/$ref(.*)/ && $fields[5]=~ m/$alt(.*)/&& $fields[6]=~ m/$name(.*)/){ print $line,"\n",$item; } } }

    Read the article

  • Ruby Challenge - efficiently change the last character of every word in a sentence to a capital

    - by emson
    Hi All I recently was challenged to write some Ruby code to change the last character of every word in a sentence into a capital. Such that the string: "script to convert the last letter of every word to a capital" becomes "scripT tO converT thE lasT letteR oF everY worD tO A capitaL" This was my optimal solution however I'm sure you wizards have much better solutions and I would be really interested to hear them. "script to convert the last letter of every word to a capital".split.map{|w|w<<w.slice!(-1).chr.upcase}.join' ' For those interested as to what is going on here is an explanation. split will split the sentence up into an array, the default delimiter is a space and with Ruby you don't need to use brackets here. map the array from split is passed to map which opens a block and process each word (w) in the array. the block slice!(s) off the last character of the word and converts it to a chr (a character not ASCII code) and then capitalises upcase it. This character is now appended << to the word which is missing the sliced last letter. Finally the array of words is now join together with a ' ' to reform the sentence. Enjoy

    Read the article

  • ASP Force Download

    - by Thomas Clayson
    In PHP I can do: header("Content-type: application/octet-stream") and then anything that I output is downloaded instead of showing in the browser. Is there a similar way to do this in ASP? I have seen about all the file streaming and such using ADODB.Stream, but that doesn't seem to work for me and always requires another file to load the content from. Bit of an ASP noob, so go easy on me. :p All I want to do is have a script that outputs a CSV and that will force download instead of showing in the browser. Thanks EDIT here is my script currently: reportingForce.aspx.vb Public Class reportingForce Inherits System.Web.UI.Page Dim FStream Protected Sub Page_Load(ByVal sender As Object, ByVal e As System.EventArgs) Handles Me.Load Response.Buffer = True Response.ContentType = "application/octet-stream" Response.AddHeader("Content-disposition", "attachment; filename=" & Chr(34) & "my output file.csv" & Chr(34)) Response.Write("1,2,3,4,5" & vbCrLf) Response.Write("5,6,7,8,9" & vbCrLf) End Sub End Class reportingForce.aspx Hello,World

    Read the article

  • VB.Net - Launch app on Windows startup

    - by Queops
    We all now the tricky folders where your application runs when you publish your VB.NET to other people, but I won't give up on the benefits of the system (auto-update, you know). Problem is: Program is supposed to startup, or not, with Windows if the user wishes so. I'm saving program preferences into My.Settings. All fine with that. If you debug it it will save the values between sessions. The problem is after deployment. I installed the program on a testing machine. Application works okay, the settings load, if it's the user launching it by themselfs (using shortcut on desktop for example). Now upon restarting the program does indeed start up as I want it to but the My.Settings don't show up! It's like the config file has been erased. If I close program and re-open by clicking shorcut it loads the settings just fine though. So I wonder what's the problem? This is the code I use to save the registry key: regKey = Registry.CurrentUser.OpenSubKey("SOFTWARE\Microsoft\Windows\CurrentVersion\Run", True) regKey.SetValue("ScapeTracker", Chr(34) & Application.ExecutablePath & Chr(34) & " startup") Does what it's supposed to. The startup parameter is needed so the program knows if it's launched on startup on not (to show up on tray and idle there until user decides to use it). So the problem is that I can't use the settings upon restart of Windows, so I'm assuming the VB.Net applications have some extra parameters when launching? How can I solve this?

    Read the article

  • a php script to get lat/long from google maps using CellID

    - by user296516
    Hi guys, I have found this script that supposedly connects to google maps and gets lat/long coordinates, based on CID/LAC/MNC/MCC info. But I can't really make it work... where do I input CID/LAC/MNC/MCC ? <?php $data = "\x00\x0e". // Function Code? "\x00\x00\x00\x00\x00\x00\x00\x00". //Session ID? "\x00\x00". // Contry Code "\x00\x00". // Client descriptor "\x00\x00". // Version "\x1b". // Op Code? "\x00\x00\x00\x00". // MNC "\x00\x00\x00\x00". // MCC "\x00\x00\x00\x03". "\x00\x00". "\x00\x00\x00\x00". //CID "\x00\x00\x00\x00". //LAC "\x00\x00\x00\x00". //MNC "\x00\x00\x00\x00". //MCC "\xff\xff\xff\xff". // ?? "\x00\x00\x00\x00" // Rx Level? ; if ($_REQUEST["myl"] != "") { $temp = split(":", $_REQUEST["myl"]); $mcc = substr("00000000".dechex($temp[0]),-8); $mnc = substr("00000000".dechex($temp[1]),-8); $lac = substr("00000000".dechex($temp[2]),-8); $cid = substr("00000000".dechex($temp[3]),-8); } else { $mcc = substr("00000000".$_REQUEST["mcc"],-8); $mnc = substr("00000000".$_REQUEST["mnc"],-8); $lac = substr("00000000".$_REQUEST["lac"],-8); $cid = substr("00000000".$_REQUEST["cid"],-8); } $init_pos = strlen($data); $data[$init_pos - 38]= pack("H*",substr($mnc,0,2)); $data[$init_pos - 37]= pack("H*",substr($mnc,2,2)); $data[$init_pos - 36]= pack("H*",substr($mnc,4,2)); $data[$init_pos - 35]= pack("H*",substr($mnc,6,2)); $data[$init_pos - 34]= pack("H*",substr($mcc,0,2)); $data[$init_pos - 33]= pack("H*",substr($mcc,2,2)); $data[$init_pos - 32]= pack("H*",substr($mcc,4,2)); $data[$init_pos - 31]= pack("H*",substr($mcc,6,2)); $data[$init_pos - 24]= pack("H*",substr($cid,0,2)); $data[$init_pos - 23]= pack("H*",substr($cid,2,2)); $data[$init_pos - 22]= pack("H*",substr($cid,4,2)); $data[$init_pos - 21]= pack("H*",substr($cid,6,2)); $data[$init_pos - 20]= pack("H*",substr($lac,0,2)); $data[$init_pos - 19]= pack("H*",substr($lac,2,2)); $data[$init_pos - 18]= pack("H*",substr($lac,4,2)); $data[$init_pos - 17]= pack("H*",substr($lac,6,2)); $data[$init_pos - 16]= pack("H*",substr($mnc,0,2)); $data[$init_pos - 15]= pack("H*",substr($mnc,2,2)); $data[$init_pos - 14]= pack("H*",substr($mnc,4,2)); $data[$init_pos - 13]= pack("H*",substr($mnc,6,2)); $data[$init_pos - 12]= pack("H*",substr($mcc,0,2)); $data[$init_pos - 11]= pack("H*",substr($mcc,2,2)); $data[$init_pos - 10]= pack("H*",substr($mcc,4,2)); $data[$init_pos - 9]= pack("H*",substr($mcc,6,2)); if ((hexdec($cid) > 0xffff) && ($mcc != "00000000") && ($mnc != "00000000")) { $data[$init_pos - 27] = chr(5); } else { $data[$init_pos - 24]= chr(0); $data[$init_pos - 23]= chr(0); } $context = array ( 'http' => array ( 'method' => 'POST', 'header'=> "Content-type: application/binary\r\n" . "Content-Length: " . strlen($data) . "\r\n", 'content' => $data ) ); $xcontext = stream_context_create($context); $str=file_get_contents("http://www.google.com/glm/mmap",FALSE,$xcontext); if (strlen($str) > 10) { $lat_tmp = unpack("l",$str[10].$str[9].$str[8].$str[7]); $lat = $lat_tmp[1]/1000000; $lon_tmp = unpack("l",$str[14].$str[13].$str[12].$str[11]); $lon = $lon_tmp[1]/1000000; echo "Lat=$lat <br> Lon=$lon"; } else { echo "Not found!"; } ?> also I found this one http://code.google.com/intl/ru/apis/gears/geolocation_network_protocol.html , but it isn't php.

    Read the article

  • Can this PHP version of SPICE be improved?

    - by Noctis Skytower
    I do not know much about PHP's standard library of functions and was wondering if the following code can be improved in any way. The implementation should yield the same results, the API should remain as it is, but ways to make is more PHP-ish would be greatly appreciated. This is a custom encryption library. Code <?php /*************************************** Create random major and minor SPICE key. ***************************************/ function crypt_major() { $all = range("\x00", "\xFF"); shuffle($all); $major_key = implode("", $all); return $major_key; } function crypt_minor() { $sample = array(); do { array_push($sample, 0, 1, 2, 3); } while (count($sample) != 256); shuffle($sample); $list = array(); for ($index = 0; $index < 64; $index++) { $b12 = $sample[$index * 4] << 6; $b34 = $sample[$index * 4 + 1] << 4; $b56 = $sample[$index * 4 + 2] << 2; $b78 = $sample[$index * 4 + 3]; array_push($list, $b12 + $b34 + $b56 + $b78); } $minor_key = implode("", array_map("chr", $list)); return $minor_key; } /*************************************** Create the SPICE key via the given name. ***************************************/ function named_major($name) { srand(crc32($name)); return crypt_major(); } function named_minor($name) { srand(crc32($name)); return crypt_minor(); } /*************************************** Check validity for major and minor keys. ***************************************/ function _check_major($key) { if (is_string($key) && strlen($key) == 256) { foreach (range("\x00", "\xFF") as $char) { if (substr_count($key, $char) == 0) { return FALSE; } } return TRUE; } return FALSE; } function _check_minor($key) { if (is_string($key) && strlen($key) == 64) { $indexs = array(); foreach (array_map("ord", str_split($key)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($indexs, ($byte >> $shift) & 3); } } $dict = array_count_values($indexs); foreach (range(0, 3) as $index) { if ($dict[$index] != 64) { return FALSE; } } return TRUE; } return FALSE; } /*************************************** Create encode maps for encode functions. ***************************************/ function _encode_map_1($major) { return array_map("ord", str_split($major)); } function _encode_map_2($minor) { $map_2 = array(array(), array(), array(), array()); $list = array(); foreach (array_map("ord", str_split($minor)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($list, ($byte >> $shift) & 3); } } for ($byte = 0; $byte < 256; $byte++) { array_push($map_2[$list[$byte]], chr($byte)); } return $map_2; } /*************************************** Create decode maps for decode functions. ***************************************/ function _decode_map_1($minor) { $map_1 = array(); foreach (array_map("ord", str_split($minor)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($map_1, ($byte >> $shift) & 3); } } return $map_1; }function _decode_map_2($major) { $map_2 = array(); $temp = array_map("ord", str_split($major)); for ($byte = 0; $byte < 256; $byte++) { $map_2[$temp[$byte]] = chr($byte); } return $map_2; } /*************************************** Encrypt or decrypt the string with maps. ***************************************/ function _encode($string, $map_1, $map_2) { $cache = ""; foreach (str_split($string) as $char) { $byte = $map_1[ord($char)]; foreach (range(6, 0, 2) as $shift) { $cache .= $map_2[($byte >> $shift) & 3][mt_rand(0, 63)]; } } return $cache; } function _decode($string, $map_1, $map_2) { $cache = ""; $temp = str_split($string); for ($iter = 0; $iter < strlen($string) / 4; $iter++) { $b12 = $map_1[ord($temp[$iter * 4])] << 6; $b34 = $map_1[ord($temp[$iter * 4 + 1])] << 4; $b56 = $map_1[ord($temp[$iter * 4 + 2])] << 2; $b78 = $map_1[ord($temp[$iter * 4 + 3])]; $cache .= $map_2[$b12 + $b34 + $b56 + $b78]; } return $cache; } /*************************************** This is the public interface for coding. ***************************************/ function encode_string($string, $major, $minor) { if (is_string($string)) { if (_check_major($major) && _check_minor($minor)) { $map_1 = _encode_map_1($major); $map_2 = _encode_map_2($minor); return _encode($string, $map_1, $map_2); } } return FALSE; } function decode_string($string, $major, $minor) { if (is_string($string) && strlen($string) % 4 == 0) { if (_check_major($major) && _check_minor($minor)) { $map_1 = _decode_map_1($minor); $map_2 = _decode_map_2($major); return _decode($string, $map_1, $map_2); } } return FALSE; } ?> This is a sample showing how the code is being used. Hex editors may be of help with the input / output. Example <?php # get and process all of the form data @ $input = htmlspecialchars($_POST["input"]); @ $majorname = htmlspecialchars($_POST["majorname"]); @ $minorname = htmlspecialchars($_POST["minorname"]); @ $majorkey = htmlspecialchars($_POST["majorkey"]); @ $minorkey = htmlspecialchars($_POST["minorkey"]); @ $output = htmlspecialchars($_POST["output"]); # process the submissions by operation # CREATE @ $operation = $_POST["operation"]; if ($operation == "Create") { if (strlen($_POST["majorname"]) == 0) { $majorkey = bin2hex(crypt_major()); } if (strlen($_POST["minorname"]) == 0) { $minorkey = bin2hex(crypt_minor()); } if (strlen($_POST["majorname"]) != 0) { $majorkey = bin2hex(named_major($_POST["majorname"])); } if (strlen($_POST["minorname"]) != 0) { $minorkey = bin2hex(named_minor($_POST["minorname"])); } } # ENCRYPT or DECRYPT function is_hex($char) { if ($char == "0"): return TRUE; elseif ($char == "1"): return TRUE; elseif ($char == "2"): return TRUE; elseif ($char == "3"): return TRUE; elseif ($char == "4"): return TRUE; elseif ($char == "5"): return TRUE; elseif ($char == "6"): return TRUE; elseif ($char == "7"): return TRUE; elseif ($char == "8"): return TRUE; elseif ($char == "9"): return TRUE; elseif ($char == "a"): return TRUE; elseif ($char == "b"): return TRUE; elseif ($char == "c"): return TRUE; elseif ($char == "d"): return TRUE; elseif ($char == "e"): return TRUE; elseif ($char == "f"): return TRUE; else: return FALSE; endif; } function hex2bin($str) { if (strlen($str) % 2 == 0): $string = strtolower($str); else: $string = strtolower("0" . $str); endif; $cache = ""; $temp = str_split($str); for ($index = 0; $index < count($temp) / 2; $index++) { $h1 = $temp[$index * 2]; if (is_hex($h1)) { $h2 = $temp[$index * 2 + 1]; if (is_hex($h2)) { $cache .= chr(hexdec($h1 . $h2)); } else { return FALSE; } } else { return FALSE; } } return $cache; } if ($operation == "Encrypt" || $operation == "Decrypt") { # CHECK FOR ANY ERROR $errors = array(); if (strlen($_POST["input"]) == 0) { $output = ""; } $binmajor = hex2bin($_POST["majorkey"]); if (strlen($_POST["majorkey"]) == 0) { array_push($errors, "There must be a major key."); } elseif ($binmajor == FALSE) { array_push($errors, "The major key must be in hex."); } elseif (_check_major($binmajor) == FALSE) { array_push($errors, "The major key is corrupt."); } $binminor = hex2bin($_POST["minorkey"]); if (strlen($_POST["minorkey"]) == 0) { array_push($errors, "There must be a minor key."); } elseif ($binminor == FALSE) { array_push($errors, "The minor key must be in hex."); } elseif (_check_minor($binminor) == FALSE) { array_push($errors, "The minor key is corrupt."); } if ($_POST["operation"] == "Decrypt") { $bininput = hex2bin(str_replace("\r", "", str_replace("\n", "", $_POST["input"]))); if ($bininput == FALSE) { if (strlen($_POST["input"]) != 0) { array_push($errors, "The input data must be in hex."); } } elseif (strlen($bininput) % 4 != 0) { array_push($errors, "The input data is corrupt."); } } if (count($errors) != 0) { # ERRORS ARE FOUND $output = "ERROR:"; foreach ($errors as $error) { $output .= "\n" . $error; } } elseif (strlen($_POST["input"]) != 0) { # CONTINUE WORKING if ($_POST["operation"] == "Encrypt") { # ENCRYPT $output = substr(chunk_split(bin2hex(encode_string($_POST["input"], $binmajor, $binminor)), 58), 0, -2); } else { # DECRYPT $output = htmlspecialchars(decode_string($bininput, $binmajor, $binminor)); } } } # echo the form with the values filled echo "<P><TEXTAREA class=maintextarea name=input rows=25 cols=25>" . $input . "</TEXTAREA></P>\n"; echo "<P>Major Name:</P>\n"; echo "<P><INPUT id=textbox1 name=majorname value=\"" . $majorname . "\"></P>\n"; echo "<P>Minor Name:</P>\n"; echo "<P><INPUT id=textbox1 name=minorname value=\"" . $minorname . "\"></P>\n"; echo "<DIV style=\"TEXT-ALIGN: center\"><INPUT class=submit type=submit value=Create name=operation>\n"; echo "</DIV>\n"; echo "<P>Major Key:</P>\n"; echo "<P><INPUT id=textbox1 name=majorkey value=\"" . $majorkey . "\"></P>\n"; echo "<P>Minor Key:</P>\n"; echo "<P><INPUT id=textbox1 name=minorkey value=\"" . $minorkey . "\"></P>\n"; echo "<DIV style=\"TEXT-ALIGN: center\"><INPUT class=submit type=submit value=Encrypt name=operation> \n"; echo "<INPUT class=submit type=submit value=Decrypt name=operation> </DIV>\n"; echo "<P>Result:</P>\n"; echo "<P><TEXTAREA class=maintextarea name=output rows=25 readOnly cols=25>" . $output . "</TEXTAREA></P></DIV></FORM>\n"; ?>

    Read the article

  • How can this PHP code be improved? What should be changed?

    - by Noctis Skytower
    This is a custom encryption library. I do not know much about PHP's standard library of functions and was wondering if the following code can be improved in any way. The implementation should yield the same results, the API should remain as it is, but ways to make is more PHP-ish would be greatly appreciated. Code <?php /*************************************** Create random major and minor SPICE key. ***************************************/ function crypt_major() { $all = range("\x00", "\xFF"); shuffle($all); $major_key = implode("", $all); return $major_key; } function crypt_minor() { $sample = array(); do { array_push($sample, 0, 1, 2, 3); } while (count($sample) != 256); shuffle($sample); $list = array(); for ($index = 0; $index < 64; $index++) { $b12 = $sample[$index * 4] << 6; $b34 = $sample[$index * 4 + 1] << 4; $b56 = $sample[$index * 4 + 2] << 2; $b78 = $sample[$index * 4 + 3]; array_push($list, $b12 + $b34 + $b56 + $b78); } $minor_key = implode("", array_map("chr", $list)); return $minor_key; } /*************************************** Create the SPICE key via the given name. ***************************************/ function named_major($name) { srand(crc32($name)); return crypt_major(); } function named_minor($name) { srand(crc32($name)); return crypt_minor(); } /*************************************** Check validity for major and minor keys. ***************************************/ function _check_major($key) { if (is_string($key) && strlen($key) == 256) { foreach (range("\x00", "\xFF") as $char) { if (substr_count($key, $char) == 0) { return FALSE; } } return TRUE; } return FALSE; } function _check_minor($key) { if (is_string($key) && strlen($key) == 64) { $indexs = array(); foreach (array_map("ord", str_split($key)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($indexs, ($byte >> $shift) & 3); } } $dict = array_count_values($indexs); foreach (range(0, 3) as $index) { if ($dict[$index] != 64) { return FALSE; } } return TRUE; } return FALSE; } /*************************************** Create encode maps for encode functions. ***************************************/ function _encode_map_1($major) { return array_map("ord", str_split($major)); } function _encode_map_2($minor) { $map_2 = array(array(), array(), array(), array()); $list = array(); foreach (array_map("ord", str_split($minor)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($list, ($byte >> $shift) & 3); } } for ($byte = 0; $byte < 256; $byte++) { array_push($map_2[$list[$byte]], chr($byte)); } return $map_2; } /*************************************** Create decode maps for decode functions. ***************************************/ function _decode_map_1($minor) { $map_1 = array(); foreach (array_map("ord", str_split($minor)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($map_1, ($byte >> $shift) & 3); } } return $map_1; }function _decode_map_2($major) { $map_2 = array(); $temp = array_map("ord", str_split($major)); for ($byte = 0; $byte < 256; $byte++) { $map_2[$temp[$byte]] = chr($byte); } return $map_2; } /*************************************** Encrypt or decrypt the string with maps. ***************************************/ function _encode($string, $map_1, $map_2) { $cache = ""; foreach (str_split($string) as $char) { $byte = $map_1[ord($char)]; foreach (range(6, 0, 2) as $shift) { $cache .= $map_2[($byte >> $shift) & 3][mt_rand(0, 63)]; } } return $cache; } function _decode($string, $map_1, $map_2) { $cache = ""; $temp = str_split($string); for ($iter = 0; $iter < strlen($string) / 4; $iter++) { $b12 = $map_1[ord($temp[$iter * 4])] << 6; $b34 = $map_1[ord($temp[$iter * 4 + 1])] << 4; $b56 = $map_1[ord($temp[$iter * 4 + 2])] << 2; $b78 = $map_1[ord($temp[$iter * 4 + 3])]; $cache .= $map_2[$b12 + $b34 + $b56 + $b78]; } return $cache; } /*************************************** This is the public interface for coding. ***************************************/ function encode_string($string, $major, $minor) { if (is_string($string)) { if (_check_major($major) && _check_minor($minor)) { $map_1 = _encode_map_1($major); $map_2 = _encode_map_2($minor); return _encode($string, $map_1, $map_2); } } return FALSE; } function decode_string($string, $major, $minor) { if (is_string($string) && strlen($string) % 4 == 0) { if (_check_major($major) && _check_minor($minor)) { $map_1 = _decode_map_1($minor); $map_2 = _decode_map_2($major); return _decode($string, $map_1, $map_2); } } return FALSE; } ?> This is a sample showing how the code is being used. Hex editors may be of help with the input / output. Example <?php # get and process all of the form data @ $input = htmlspecialchars($_POST["input"]); @ $majorname = htmlspecialchars($_POST["majorname"]); @ $minorname = htmlspecialchars($_POST["minorname"]); @ $majorkey = htmlspecialchars($_POST["majorkey"]); @ $minorkey = htmlspecialchars($_POST["minorkey"]); @ $output = htmlspecialchars($_POST["output"]); # process the submissions by operation # CREATE @ $operation = $_POST["operation"]; if ($operation == "Create") { if (strlen($_POST["majorname"]) == 0) { $majorkey = bin2hex(crypt_major()); } if (strlen($_POST["minorname"]) == 0) { $minorkey = bin2hex(crypt_minor()); } if (strlen($_POST["majorname"]) != 0) { $majorkey = bin2hex(named_major($_POST["majorname"])); } if (strlen($_POST["minorname"]) != 0) { $minorkey = bin2hex(named_minor($_POST["minorname"])); } } # ENCRYPT or DECRYPT function is_hex($char) { if ($char == "0"): return TRUE; elseif ($char == "1"): return TRUE; elseif ($char == "2"): return TRUE; elseif ($char == "3"): return TRUE; elseif ($char == "4"): return TRUE; elseif ($char == "5"): return TRUE; elseif ($char == "6"): return TRUE; elseif ($char == "7"): return TRUE; elseif ($char == "8"): return TRUE; elseif ($char == "9"): return TRUE; elseif ($char == "a"): return TRUE; elseif ($char == "b"): return TRUE; elseif ($char == "c"): return TRUE; elseif ($char == "d"): return TRUE; elseif ($char == "e"): return TRUE; elseif ($char == "f"): return TRUE; else: return FALSE; endif; } function hex2bin($str) { if (strlen($str) % 2 == 0): $string = strtolower($str); else: $string = strtolower("0" . $str); endif; $cache = ""; $temp = str_split($str); for ($index = 0; $index < count($temp) / 2; $index++) { $h1 = $temp[$index * 2]; if (is_hex($h1)) { $h2 = $temp[$index * 2 + 1]; if (is_hex($h2)) { $cache .= chr(hexdec($h1 . $h2)); } else { return FALSE; } } else { return FALSE; } } return $cache; } if ($operation == "Encrypt" || $operation == "Decrypt") { # CHECK FOR ANY ERROR $errors = array(); if (strlen($_POST["input"]) == 0) { $output = ""; } $binmajor = hex2bin($_POST["majorkey"]); if (strlen($_POST["majorkey"]) == 0) { array_push($errors, "There must be a major key."); } elseif ($binmajor == FALSE) { array_push($errors, "The major key must be in hex."); } elseif (_check_major($binmajor) == FALSE) { array_push($errors, "The major key is corrupt."); } $binminor = hex2bin($_POST["minorkey"]); if (strlen($_POST["minorkey"]) == 0) { array_push($errors, "There must be a minor key."); } elseif ($binminor == FALSE) { array_push($errors, "The minor key must be in hex."); } elseif (_check_minor($binminor) == FALSE) { array_push($errors, "The minor key is corrupt."); } if ($_POST["operation"] == "Decrypt") { $bininput = hex2bin(str_replace("\r", "", str_replace("\n", "", $_POST["input"]))); if ($bininput == FALSE) { if (strlen($_POST["input"]) != 0) { array_push($errors, "The input data must be in hex."); } } elseif (strlen($bininput) % 4 != 0) { array_push($errors, "The input data is corrupt."); } } if (count($errors) != 0) { # ERRORS ARE FOUND $output = "ERROR:"; foreach ($errors as $error) { $output .= "\n" . $error; } } elseif (strlen($_POST["input"]) != 0) { # CONTINUE WORKING if ($_POST["operation"] == "Encrypt") { # ENCRYPT $output = substr(chunk_split(bin2hex(encode_string($_POST["input"], $binmajor, $binminor)), 58), 0, -2); } else { # DECRYPT $output = htmlspecialchars(decode_string($bininput, $binmajor, $binminor)); } } } # echo the form with the values filled echo "<P><TEXTAREA class=maintextarea name=input rows=25 cols=25>" . $input . "</TEXTAREA></P>\n"; echo "<P>Major Name:</P>\n"; echo "<P><INPUT id=textbox1 name=majorname value=\"" . $majorname . "\"></P>\n"; echo "<P>Minor Name:</P>\n"; echo "<P><INPUT id=textbox1 name=minorname value=\"" . $minorname . "\"></P>\n"; echo "<DIV style=\"TEXT-ALIGN: center\"><INPUT class=submit type=submit value=Create name=operation>\n"; echo "</DIV>\n"; echo "<P>Major Key:</P>\n"; echo "<P><INPUT id=textbox1 name=majorkey value=\"" . $majorkey . "\"></P>\n"; echo "<P>Minor Key:</P>\n"; echo "<P><INPUT id=textbox1 name=minorkey value=\"" . $minorkey . "\"></P>\n"; echo "<DIV style=\"TEXT-ALIGN: center\"><INPUT class=submit type=submit value=Encrypt name=operation> \n"; echo "<INPUT class=submit type=submit value=Decrypt name=operation> </DIV>\n"; echo "<P>Result:</P>\n"; echo "<P><TEXTAREA class=maintextarea name=output rows=25 readOnly cols=25>" . $output . "</TEXTAREA></P></DIV></FORM>\n"; ?> What should be editted for better memory efficiency or faster execution?

    Read the article

  • How can this PHP code be improved? What should change?

    - by Noctis Skytower
    This is a custom encryption library. I do not know much about PHP's standard library of functions and was wondering if the following code can be improved in any way. The implementation should yield the same results, the API should remain as it is, but ways to make is more PHP-ish would be greatly appreciated. Code <?php /*************************************** Create random major and minor SPICE key. ***************************************/ function crypt_major() { $all = range("\x00", "\xFF"); shuffle($all); $major_key = implode("", $all); return $major_key; } function crypt_minor() { $sample = array(); do { array_push($sample, 0, 1, 2, 3); } while (count($sample) != 256); shuffle($sample); $list = array(); for ($index = 0; $index < 64; $index++) { $b12 = $sample[$index * 4] << 6; $b34 = $sample[$index * 4 + 1] << 4; $b56 = $sample[$index * 4 + 2] << 2; $b78 = $sample[$index * 4 + 3]; array_push($list, $b12 + $b34 + $b56 + $b78); } $minor_key = implode("", array_map("chr", $list)); return $minor_key; } /*************************************** Create the SPICE key via the given name. ***************************************/ function named_major($name) { srand(crc32($name)); return crypt_major(); } function named_minor($name) { srand(crc32($name)); return crypt_minor(); } /*************************************** Check validity for major and minor keys. ***************************************/ function _check_major($key) { if (is_string($key) && strlen($key) == 256) { foreach (range("\x00", "\xFF") as $char) { if (substr_count($key, $char) == 0) { return FALSE; } } return TRUE; } return FALSE; } function _check_minor($key) { if (is_string($key) && strlen($key) == 64) { $indexs = array(); foreach (array_map("ord", str_split($key)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($indexs, ($byte >> $shift) & 3); } } $dict = array_count_values($indexs); foreach (range(0, 3) as $index) { if ($dict[$index] != 64) { return FALSE; } } return TRUE; } return FALSE; } /*************************************** Create encode maps for encode functions. ***************************************/ function _encode_map_1($major) { return array_map("ord", str_split($major)); } function _encode_map_2($minor) { $map_2 = array(array(), array(), array(), array()); $list = array(); foreach (array_map("ord", str_split($minor)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($list, ($byte >> $shift) & 3); } } for ($byte = 0; $byte < 256; $byte++) { array_push($map_2[$list[$byte]], chr($byte)); } return $map_2; } /*************************************** Create decode maps for decode functions. ***************************************/ function _decode_map_1($minor) { $map_1 = array(); foreach (array_map("ord", str_split($minor)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($map_1, ($byte >> $shift) & 3); } } return $map_1; }function _decode_map_2($major) { $map_2 = array(); $temp = array_map("ord", str_split($major)); for ($byte = 0; $byte < 256; $byte++) { $map_2[$temp[$byte]] = chr($byte); } return $map_2; } /*************************************** Encrypt or decrypt the string with maps. ***************************************/ function _encode($string, $map_1, $map_2) { $cache = ""; foreach (str_split($string) as $char) { $byte = $map_1[ord($char)]; foreach (range(6, 0, 2) as $shift) { $cache .= $map_2[($byte >> $shift) & 3][mt_rand(0, 63)]; } } return $cache; } function _decode($string, $map_1, $map_2) { $cache = ""; $temp = str_split($string); for ($iter = 0; $iter < strlen($string) / 4; $iter++) { $b12 = $map_1[ord($temp[$iter * 4])] << 6; $b34 = $map_1[ord($temp[$iter * 4 + 1])] << 4; $b56 = $map_1[ord($temp[$iter * 4 + 2])] << 2; $b78 = $map_1[ord($temp[$iter * 4 + 3])]; $cache .= $map_2[$b12 + $b34 + $b56 + $b78]; } return $cache; } /*************************************** This is the public interface for coding. ***************************************/ function encode_string($string, $major, $minor) { if (is_string($string)) { if (_check_major($major) && _check_minor($minor)) { $map_1 = _encode_map_1($major); $map_2 = _encode_map_2($minor); return _encode($string, $map_1, $map_2); } } return FALSE; } function decode_string($string, $major, $minor) { if (is_string($string) && strlen($string) % 4 == 0) { if (_check_major($major) && _check_minor($minor)) { $map_1 = _decode_map_1($minor); $map_2 = _decode_map_2($major); return _decode($string, $map_1, $map_2); } } return FALSE; } ?> This is a sample showing how the code is being used. Hex editors may be of help with the input / output. Example <?php # get and process all of the form data @ $input = htmlspecialchars($_POST["input"]); @ $majorname = htmlspecialchars($_POST["majorname"]); @ $minorname = htmlspecialchars($_POST["minorname"]); @ $majorkey = htmlspecialchars($_POST["majorkey"]); @ $minorkey = htmlspecialchars($_POST["minorkey"]); @ $output = htmlspecialchars($_POST["output"]); # process the submissions by operation # CREATE @ $operation = $_POST["operation"]; if ($operation == "Create") { if (strlen($_POST["majorname"]) == 0) { $majorkey = bin2hex(crypt_major()); } if (strlen($_POST["minorname"]) == 0) { $minorkey = bin2hex(crypt_minor()); } if (strlen($_POST["majorname"]) != 0) { $majorkey = bin2hex(named_major($_POST["majorname"])); } if (strlen($_POST["minorname"]) != 0) { $minorkey = bin2hex(named_minor($_POST["minorname"])); } } # ENCRYPT or DECRYPT function is_hex($char) { if ($char == "0"): return TRUE; elseif ($char == "1"): return TRUE; elseif ($char == "2"): return TRUE; elseif ($char == "3"): return TRUE; elseif ($char == "4"): return TRUE; elseif ($char == "5"): return TRUE; elseif ($char == "6"): return TRUE; elseif ($char == "7"): return TRUE; elseif ($char == "8"): return TRUE; elseif ($char == "9"): return TRUE; elseif ($char == "a"): return TRUE; elseif ($char == "b"): return TRUE; elseif ($char == "c"): return TRUE; elseif ($char == "d"): return TRUE; elseif ($char == "e"): return TRUE; elseif ($char == "f"): return TRUE; else: return FALSE; endif; } function hex2bin($str) { if (strlen($str) % 2 == 0): $string = strtolower($str); else: $string = strtolower("0" . $str); endif; $cache = ""; $temp = str_split($str); for ($index = 0; $index < count($temp) / 2; $index++) { $h1 = $temp[$index * 2]; if (is_hex($h1)) { $h2 = $temp[$index * 2 + 1]; if (is_hex($h2)) { $cache .= chr(hexdec($h1 . $h2)); } else { return FALSE; } } else { return FALSE; } } return $cache; } if ($operation == "Encrypt" || $operation == "Decrypt") { # CHECK FOR ANY ERROR $errors = array(); if (strlen($_POST["input"]) == 0) { $output = ""; } $binmajor = hex2bin($_POST["majorkey"]); if (strlen($_POST["majorkey"]) == 0) { array_push($errors, "There must be a major key."); } elseif ($binmajor == FALSE) { array_push($errors, "The major key must be in hex."); } elseif (_check_major($binmajor) == FALSE) { array_push($errors, "The major key is corrupt."); } $binminor = hex2bin($_POST["minorkey"]); if (strlen($_POST["minorkey"]) == 0) { array_push($errors, "There must be a minor key."); } elseif ($binminor == FALSE) { array_push($errors, "The minor key must be in hex."); } elseif (_check_minor($binminor) == FALSE) { array_push($errors, "The minor key is corrupt."); } if ($_POST["operation"] == "Decrypt") { $bininput = hex2bin(str_replace("\r", "", str_replace("\n", "", $_POST["input"]))); if ($bininput == FALSE) { if (strlen($_POST["input"]) != 0) { array_push($errors, "The input data must be in hex."); } } elseif (strlen($bininput) % 4 != 0) { array_push($errors, "The input data is corrupt."); } } if (count($errors) != 0) { # ERRORS ARE FOUND $output = "ERROR:"; foreach ($errors as $error) { $output .= "\n" . $error; } } elseif (strlen($_POST["input"]) != 0) { # CONTINUE WORKING if ($_POST["operation"] == "Encrypt") { # ENCRYPT $output = substr(chunk_split(bin2hex(encode_string($_POST["input"], $binmajor, $binminor)), 58), 0, -2); } else { # DECRYPT $output = htmlspecialchars(decode_string($bininput, $binmajor, $binminor)); } } } # echo the form with the values filled echo "<P><TEXTAREA class=maintextarea name=input rows=25 cols=25>" . $input . "</TEXTAREA></P>\n"; echo "<P>Major Name:</P>\n"; echo "<P><INPUT id=textbox1 name=majorname value=\"" . $majorname . "\"></P>\n"; echo "<P>Minor Name:</P>\n"; echo "<P><INPUT id=textbox1 name=minorname value=\"" . $minorname . "\"></P>\n"; echo "<DIV style=\"TEXT-ALIGN: center\"><INPUT class=submit type=submit value=Create name=operation>\n"; echo "</DIV>\n"; echo "<P>Major Key:</P>\n"; echo "<P><INPUT id=textbox1 name=majorkey value=\"" . $majorkey . "\"></P>\n"; echo "<P>Minor Key:</P>\n"; echo "<P><INPUT id=textbox1 name=minorkey value=\"" . $minorkey . "\"></P>\n"; echo "<DIV style=\"TEXT-ALIGN: center\"><INPUT class=submit type=submit value=Encrypt name=operation> \n"; echo "<INPUT class=submit type=submit value=Decrypt name=operation> </DIV>\n"; echo "<P>Result:</P>\n"; echo "<P><TEXTAREA class=maintextarea name=output rows=25 readOnly cols=25>" . $output . "</TEXTAREA></P></DIV></FORM>\n"; ?> What should be editted for better memory efficiency or faster execution?

    Read the article

  • What can be improved in this PHP code?

    - by Noctis Skytower
    This is a custom encryption library. I do not know much about PHP's standard library of functions and was wondering if the following code can be improved in any way. The implementation should yield the same results, the API should remain as it is, but ways to make is more PHP-ish would be greatly appreciated. Code <?php /*************************************** Create random major and minor SPICE key. ***************************************/ function crypt_major() { $all = range("\x00", "\xFF"); shuffle($all); $major_key = implode("", $all); return $major_key; } function crypt_minor() { $sample = array(); do { array_push($sample, 0, 1, 2, 3); } while (count($sample) != 256); shuffle($sample); $list = array(); for ($index = 0; $index < 64; $index++) { $b12 = $sample[$index * 4] << 6; $b34 = $sample[$index * 4 + 1] << 4; $b56 = $sample[$index * 4 + 2] << 2; $b78 = $sample[$index * 4 + 3]; array_push($list, $b12 + $b34 + $b56 + $b78); } $minor_key = implode("", array_map("chr", $list)); return $minor_key; } /*************************************** Create the SPICE key via the given name. ***************************************/ function named_major($name) { srand(crc32($name)); return crypt_major(); } function named_minor($name) { srand(crc32($name)); return crypt_minor(); } /*************************************** Check validity for major and minor keys. ***************************************/ function _check_major($key) { if (is_string($key) && strlen($key) == 256) { foreach (range("\x00", "\xFF") as $char) { if (substr_count($key, $char) == 0) { return FALSE; } } return TRUE; } return FALSE; } function _check_minor($key) { if (is_string($key) && strlen($key) == 64) { $indexs = array(); foreach (array_map("ord", str_split($key)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($indexs, ($byte >> $shift) & 3); } } $dict = array_count_values($indexs); foreach (range(0, 3) as $index) { if ($dict[$index] != 64) { return FALSE; } } return TRUE; } return FALSE; } /*************************************** Create encode maps for encode functions. ***************************************/ function _encode_map_1($major) { return array_map("ord", str_split($major)); } function _encode_map_2($minor) { $map_2 = array(array(), array(), array(), array()); $list = array(); foreach (array_map("ord", str_split($minor)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($list, ($byte >> $shift) & 3); } } for ($byte = 0; $byte < 256; $byte++) { array_push($map_2[$list[$byte]], chr($byte)); } return $map_2; } /*************************************** Create decode maps for decode functions. ***************************************/ function _decode_map_1($minor) { $map_1 = array(); foreach (array_map("ord", str_split($minor)) as $byte) { foreach (range(6, 0, 2) as $shift) { array_push($map_1, ($byte >> $shift) & 3); } } return $map_1; }function _decode_map_2($major) { $map_2 = array(); $temp = array_map("ord", str_split($major)); for ($byte = 0; $byte < 256; $byte++) { $map_2[$temp[$byte]] = chr($byte); } return $map_2; } /*************************************** Encrypt or decrypt the string with maps. ***************************************/ function _encode($string, $map_1, $map_2) { $cache = ""; foreach (str_split($string) as $char) { $byte = $map_1[ord($char)]; foreach (range(6, 0, 2) as $shift) { $cache .= $map_2[($byte >> $shift) & 3][mt_rand(0, 63)]; } } return $cache; } function _decode($string, $map_1, $map_2) { $cache = ""; $temp = str_split($string); for ($iter = 0; $iter < strlen($string) / 4; $iter++) { $b12 = $map_1[ord($temp[$iter * 4])] << 6; $b34 = $map_1[ord($temp[$iter * 4 + 1])] << 4; $b56 = $map_1[ord($temp[$iter * 4 + 2])] << 2; $b78 = $map_1[ord($temp[$iter * 4 + 3])]; $cache .= $map_2[$b12 + $b34 + $b56 + $b78]; } return $cache; } /*************************************** This is the public interface for coding. ***************************************/ function encode_string($string, $major, $minor) { if (is_string($string)) { if (_check_major($major) && _check_minor($minor)) { $map_1 = _encode_map_1($major); $map_2 = _encode_map_2($minor); return _encode($string, $map_1, $map_2); } } return FALSE; } function decode_string($string, $major, $minor) { if (is_string($string) && strlen($string) % 4 == 0) { if (_check_major($major) && _check_minor($minor)) { $map_1 = _decode_map_1($minor); $map_2 = _decode_map_2($major); return _decode($string, $map_1, $map_2); } } return FALSE; } ?> This is a sample showing how the code is being used. Hex editors may be of help with the input / output. Example <?php # get and process all of the form data @ $input = htmlspecialchars($_POST["input"]); @ $majorname = htmlspecialchars($_POST["majorname"]); @ $minorname = htmlspecialchars($_POST["minorname"]); @ $majorkey = htmlspecialchars($_POST["majorkey"]); @ $minorkey = htmlspecialchars($_POST["minorkey"]); @ $output = htmlspecialchars($_POST["output"]); # process the submissions by operation # CREATE @ $operation = $_POST["operation"]; if ($operation == "Create") { if (strlen($_POST["majorname"]) == 0) { $majorkey = bin2hex(crypt_major()); } if (strlen($_POST["minorname"]) == 0) { $minorkey = bin2hex(crypt_minor()); } if (strlen($_POST["majorname"]) != 0) { $majorkey = bin2hex(named_major($_POST["majorname"])); } if (strlen($_POST["minorname"]) != 0) { $minorkey = bin2hex(named_minor($_POST["minorname"])); } } # ENCRYPT or DECRYPT function is_hex($char) { if ($char == "0"): return TRUE; elseif ($char == "1"): return TRUE; elseif ($char == "2"): return TRUE; elseif ($char == "3"): return TRUE; elseif ($char == "4"): return TRUE; elseif ($char == "5"): return TRUE; elseif ($char == "6"): return TRUE; elseif ($char == "7"): return TRUE; elseif ($char == "8"): return TRUE; elseif ($char == "9"): return TRUE; elseif ($char == "a"): return TRUE; elseif ($char == "b"): return TRUE; elseif ($char == "c"): return TRUE; elseif ($char == "d"): return TRUE; elseif ($char == "e"): return TRUE; elseif ($char == "f"): return TRUE; else: return FALSE; endif; } function hex2bin($str) { if (strlen($str) % 2 == 0): $string = strtolower($str); else: $string = strtolower("0" . $str); endif; $cache = ""; $temp = str_split($str); for ($index = 0; $index < count($temp) / 2; $index++) { $h1 = $temp[$index * 2]; if (is_hex($h1)) { $h2 = $temp[$index * 2 + 1]; if (is_hex($h2)) { $cache .= chr(hexdec($h1 . $h2)); } else { return FALSE; } } else { return FALSE; } } return $cache; } if ($operation == "Encrypt" || $operation == "Decrypt") { # CHECK FOR ANY ERROR $errors = array(); if (strlen($_POST["input"]) == 0) { $output = ""; } $binmajor = hex2bin($_POST["majorkey"]); if (strlen($_POST["majorkey"]) == 0) { array_push($errors, "There must be a major key."); } elseif ($binmajor == FALSE) { array_push($errors, "The major key must be in hex."); } elseif (_check_major($binmajor) == FALSE) { array_push($errors, "The major key is corrupt."); } $binminor = hex2bin($_POST["minorkey"]); if (strlen($_POST["minorkey"]) == 0) { array_push($errors, "There must be a minor key."); } elseif ($binminor == FALSE) { array_push($errors, "The minor key must be in hex."); } elseif (_check_minor($binminor) == FALSE) { array_push($errors, "The minor key is corrupt."); } if ($_POST["operation"] == "Decrypt") { $bininput = hex2bin(str_replace("\r", "", str_replace("\n", "", $_POST["input"]))); if ($bininput == FALSE) { if (strlen($_POST["input"]) != 0) { array_push($errors, "The input data must be in hex."); } } elseif (strlen($bininput) % 4 != 0) { array_push($errors, "The input data is corrupt."); } } if (count($errors) != 0) { # ERRORS ARE FOUND $output = "ERROR:"; foreach ($errors as $error) { $output .= "\n" . $error; } } elseif (strlen($_POST["input"]) != 0) { # CONTINUE WORKING if ($_POST["operation"] == "Encrypt") { # ENCRYPT $output = substr(chunk_split(bin2hex(encode_string($_POST["input"], $binmajor, $binminor)), 58), 0, -2); } else { # DECRYPT $output = htmlspecialchars(decode_string($bininput, $binmajor, $binminor)); } } } # echo the form with the values filled echo "<P><TEXTAREA class=maintextarea name=input rows=25 cols=25>" . $input . "</TEXTAREA></P>\n"; echo "<P>Major Name:</P>\n"; echo "<P><INPUT id=textbox1 name=majorname value=\"" . $majorname . "\"></P>\n"; echo "<P>Minor Name:</P>\n"; echo "<P><INPUT id=textbox1 name=minorname value=\"" . $minorname . "\"></P>\n"; echo "<DIV style=\"TEXT-ALIGN: center\"><INPUT class=submit type=submit value=Create name=operation>\n"; echo "</DIV>\n"; echo "<P>Major Key:</P>\n"; echo "<P><INPUT id=textbox1 name=majorkey value=\"" . $majorkey . "\"></P>\n"; echo "<P>Minor Key:</P>\n"; echo "<P><INPUT id=textbox1 name=minorkey value=\"" . $minorkey . "\"></P>\n"; echo "<DIV style=\"TEXT-ALIGN: center\"><INPUT class=submit type=submit value=Encrypt name=operation> \n"; echo "<INPUT class=submit type=submit value=Decrypt name=operation> </DIV>\n"; echo "<P>Result:</P>\n"; echo "<P><TEXTAREA class=maintextarea name=output rows=25 readOnly cols=25>" . $output . "</TEXTAREA></P></DIV></FORM>\n"; ?> What should be editted for better memory efficiency or faster execution?

    Read the article

  • Cross-language Extension Method Calling

    - by Tom Hines
    Extension methods are a concise way of binding functions to particular types. In my last post, I showed how Extension methods can be created in the .NET 2.0 environment. In this post, I discuss calling the extensions from other languages. Most of the differences I find between the Dot Net languages are mainly syntax.  The declaration of Extensions is no exception.  There is, however, a distinct difference with the framework accepting excensions made with C++ that differs from C# and VB.  When calling the C++ extension from C#, the compiler will SOMETIMES say there is no definition for DoCPP with the error: 'string' does not contain a definition for 'DoCPP' and no extension method 'DoCPP' accepting a first argument of type 'string' could be found (are you missing a using directive or an assembly reference?) If I recompile, the error goes away. The strangest problem with calling the C++ extension from C# is that I first must make SOME type of reference to the class BEFORE using the extension or it will not be recognized at all.  So, if I first call the DoCPP() as a static method, the extension works fine later.  If I make a dummy instantiation of the class, it works.  If I have no forward reference of the class, I get the same error as before and recompiling does not fix it.  It seems as if this none of this is supposed to work across the languages. I have made a few work-arounds to get the examples to compile and run. Note the following examples: Extension in C# using System; namespace Extension_CS {    public static class CExtension_CS    {  //in C#, the "this" keyword is the key.       public static void DoCS(this string str)       {          Console.WriteLine("CS\t{0:G}\tCS", str);       }    } } Extension in C++ /****************************************************************************\  * Here is the C++ implementation.  It is the least elegant and most quirky,  * but it works. \****************************************************************************/ #pragma once using namespace System; using namespace System::Runtime::CompilerServices;     //<-Essential // Reference: System.Core.dll //<- Essential namespace Extension_CPP {        public ref class CExtension_CPP        {        public:               [Extension] // or [ExtensionAttribute] /* either works */               static void DoCPP(String^ str)               {                      Console::WriteLine("C++\t{0:G}\tC++", str);               }        }; } Extension in VB ' Here is the VB implementation.  This is not as elegant as the C#, but it's ' functional. Imports System.Runtime.CompilerServices ' Public Module modExtension_VB 'Extension methods can be defined only in modules.    <Extension()> _       Public Sub DoVB(ByVal str As String)       Console.WriteLine("VB" & Chr(9) & "{0:G}" & Chr(9) & "VB", str)    End Sub End Module   Calling program in C# /******************************************************************************\  * Main calling program  * Intellisense and VS2008 complain about the CPP implementation, but with a  * little duct-tape, it works just fine. \******************************************************************************/ using System; using Extension_CPP; using Extension_CS; using Extension_VB; // vitual namespace namespace TestExtensions {    public static class CTestExtensions    {       /**********************************************************************\        * For some reason, this needs a direct reference into the C++ version        * even though it does nothing than add a null reference.        * The constructor provides the fake usage to please the compiler.       \**********************************************************************/       private static CExtension_CPP x = null;   // <-DUCT_TAPE!       static CTestExtensions()       {          // Fake usage to stop compiler from complaining          if (null != x) {} // <-DUCT_TAPE       }       static void Main(string[] args)       {          string strData = "from C#";          strData.DoCPP();          strData.DoCS();          strData.DoVB();       }    } }   Calling program in VB  Imports Extension_CPP Imports Extension_CS Imports Extension_VB Imports System.Runtime.CompilerServices Module TestExtensions_VB    <Extension()> _       Public Sub DoCPP(ByVal str As String)       'Framework does not treat this as an extension, so use the static       CExtension_CPP.DoCPP(str)    End Sub    Sub Main()       Dim strData As String = "from VB"       strData.DoCS()       strData.DoVB()       strData.DoCPP() 'fake    End Sub End Module  Calling program in C++ // TestExtensions_CPP.cpp : main project file. #include "stdafx.h" using namespace System; using namespace Extension_CPP; using namespace Extension_CS; using namespace Extension_VB; void main(void) {        /*******************************************************\         * Extension methods are called like static methods         * when called from C++.  There may be a difference in         * syntax when calling the VB extension as VB Extensions         * are embedded in Modules instead of classes        \*******************************************************/     String^ strData = "from C++";     CExtension_CPP::DoCPP(strData);     CExtension_CS::DoCS(strData);     modExtension_VB::DoVB(strData); //since Extensions go in Modules }

    Read the article

  • XmlWriter and lower ASCII characters

    - by Rick Strahl
    Ran into an interesting problem today on my CodePaste.net site: The main RSS and ATOM feeds on the site were broken because one code snippet on the site contained a lower ASCII character (CHR(3)). I don't think this was done on purpose but it was enough to make the feeds fail. After quite a bit of debugging and throwing in a custom error handler into my actual feed generation code that just spit out the raw error instead of running it through the ASP.NET MVC and my own error pipeline I found the actual error. The lovely base exception and error trace I got looked like this: Error: '', hexadecimal value 0x03, is an invalid character. at System.Xml.XmlUtf8RawTextWriter.InvalidXmlChar(Int32 ch, Byte* pDst, Boolean entitize)at System.Xml.XmlUtf8RawTextWriter.WriteElementTextBlock(Char* pSrc, Char* pSrcEnd)at System.Xml.XmlUtf8RawTextWriter.WriteString(String text)at System.Xml.XmlWellFormedWriter.WriteString(String text)at System.Xml.XmlWriter.WriteElementString(String localName, String ns, String value)at System.ServiceModel.Syndication.Rss20FeedFormatter.WriteItemContents(XmlWriter writer, SyndicationItem item, Uri feedBaseUri)at System.ServiceModel.Syndication.Rss20FeedFormatter.WriteItem(XmlWriter writer, SyndicationItem item, Uri feedBaseUri)at System.ServiceModel.Syndication.Rss20FeedFormatter.WriteItems(XmlWriter writer, IEnumerable`1 items, Uri feedBaseUri)at System.ServiceModel.Syndication.Rss20FeedFormatter.WriteFeed(XmlWriter writer)at System.ServiceModel.Syndication.Rss20FeedFormatter.WriteTo(XmlWriter writer)at CodePasteMvc.Controllers.ApiControllerBase.GetFeed(Object instance) in C:\Projects2010\CodePaste\CodePasteMvc\Controllers\ApiControllerBase.cs:line 131 XML doesn't like extended ASCII Characters It turns out the issue is that XML in general does not deal well with lower ASCII characters. According to the XML spec it looks like any characters below 0x09 are invalid. If you generate an XML document in .NET with an embedded &#x3; entity (as mine did to create the error above), you tend to get an XML document error when displaying it in a viewer. For example, here's what the result of my  feed output looks like with the invalid character embedded inside of Chrome which displays RSS feeds as raw XML by default: Other browsers show similar error messages. The nice thing about Chrome is that you can actually view source and jump down to see the line that causes the error which allowed me to track down the actual message that failed. If you create an XML document that contains a 0x03 character the XML writer fails outright with the error: '', hexadecimal value 0x03, is an invalid character. The good news is that this behavior is overridable so XML output can at least be created by using the XmlSettings object when configuring the XmlWriter instance. In my RSS configuration code this looks something like this:MemoryStream ms = new MemoryStream(); var settings = new XmlWriterSettings() { CheckCharacters = false }; XmlWriter writer = XmlWriter.Create(ms,settings); and voila the feed now generates. Now generally this is probably NOT a good idea, because as mentioned above these characters are illegal and if you view a raw XML document you'll get validation errors. Luckily though most RSS feed readers however don't care and happily accept and display the feed correctly, which is good because it got me over an embarrassing hump until I figured out a better solution. How to handle extended Characters? I was glad to get the feed fixed for the time being, but now I was still stuck with an interesting dilemma. CodePaste.net accepts user input for code snippets and those code snippets can contain just about anything. This means that ASP.NET's standard request filtering cannot be applied to this content. The code content displayed is encoded before display so for the HTML end the CHR(3) input is not really an issue. While invisible characters are hardly useful in user input it's not uncommon that odd characters show up in code snippets. You know the old fat fingering that happens when you're in the middle of a coding session and those invisible characters do end up sometimes in code editors and then end up pasted into the HTML textbox for pasting as a Codepaste.net snippet. The question is how to filter this text? Looking back at the XML Charset Spec it looks like all characters below 0x20 (space) except for 0x09 (tab), 0x0A (LF), 0x0D (CR) are illegal. So applying the following filter with a RegEx should work to remove invalid characters:string code = Regex.Replace(item.Code, @"[\u0000-\u0008,\u000B,\u000C,\u000E-\u001F]", ""); Applying this RegEx to the code snippet (and title) eliminates the problems and the feed renders cleanly.© Rick Strahl, West Wind Technologies, 2005-2012Posted in .NET  XML   Tweet !function(d,s,id){var js,fjs=d.getElementsByTagName(s)[0];if(!d.getElementById(id)){js=d.createElement(s);js.id=id;js.src="//platform.twitter.com/widgets.js";fjs.parentNode.insertBefore(js,fjs);}}(document,"script","twitter-wjs"); (function() { var po = document.createElement('script'); po.type = 'text/javascript'; po.async = true; po.src = 'https://apis.google.com/js/plusone.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(po, s); })();

    Read the article

  • File Folder copy

    - by Dario Dias
    Below is the VBScript code. If the file/s or folder exist I get scripting error, "File already exists". How to fix that? How to create folder only if it does not exist and copy files only that are new or do not exist in source path? How to insert the username (Point 1) after "Welcome" and at (Poin 3) instead of user cancelled? Can the buttons be changed to Copy,Update,Cancel instead of Yes,No,Cancel? (Point 2) The code: Set objFSO = CreateObject("Scripting.FileSystemObject") Set wshShell = WScript.CreateObject( "WScript.Shell" ) strUserName = wshShell.ExpandEnvironmentStrings( "%USERNAME%" ) Message = " Welcome to the AVG Update Module" & vbCR '1* Message = Message & " *****************************" & vbCR & vbCR Message = Message & " Click Yes to Copy Definition Files" & vbCR & vbCR Message = Message & " OR " & vbCR & vbCR Message = Message & " Click No to Update Definition Files." & vbCR & vbCR Message = Message & " Click Cancel (ESC) to Exit." & vbCR & vbCR X = MsgBox(Message, vbYesNoCancel, "AVG Update Module") '2* 'Yes Selected Script If X = 6 then objFSO.FolderExists("E:\Updates") if TRUE then objFSO.CreateFolder ("E:\Updates") objFSO.CopyFile "c:\Docume~1\alluse~1\applic~1\avg8\update\download\*.*", "E:\Updates\" , OverwriteFiles MsgBox "Files Copied Succesfully.", vbInformation, "Copy Success" End If 'No Selected Script If X = 7 then objFSO.FolderExists("Updates") if TRUE then objFSO.CreateFolder("Updates") objFSO.CopyFile "E:\Updates\*.*", "Updates", OverwriteFiles Message = "Files Updated Successfully." & vbCR & vbCR Message = Message & "Click OK to Launch AVG GUI." & vbCR & vbCR Message = Message & "Click Cancel (ESC) to Exit." & vbCR & vbCR Y = MsgBox(Message, vbOKCancel, "Update Success") If Y = 1 then Set WshShell = CreateObject("WScript.Shell") WshShell.Run chr(34) & "C:\Progra~1\avg\avg8\avgui.exe" & Chr(34), 0 Set WshShell = Nothing End if If Y = 3 then WScript.Quit End IF 'Cancel Selection Script If X = 2 then MsgBox "No Files have been Copied/Updated.", vbExclamation, "User Cancelled" '3* End if

    Read the article

  • How could a quine in my programming language look?

    - by ads
    I have created a turing-complete programming language (already proven) so it must be possible to write a quine for it, right? But all quines I know store their source code in a string and then replace a special character in it using something like chr and ord. My language only has the following Basic arithmetics Int and string types Variables == operator Conditional gotos I have no idea how I could write a quine as I have no real string manipulation available, I can only output constant strings. Yet, it is 100% turing-complete.

    Read the article

  • Would someone mind giving suggestions for this new assembly language?

    - by Noctis Skytower
    Greetings! Last semester in college, my teacher in the Computer Languages class taught us the esoteric language named Whitespace. In the interest of learning the language better with a very busy schedule (midterms), I wrote an interpreter and assembler in Python. An assembly language was designed to facilitate writing programs easily, and a sample program was written with the given assembly mnemonics. Now that it is summer, a new project has begun with the objective being to rewrite the interpreter and assembler for Whitespace 0.3, with further developments coming afterwards. Since there is so much extra time than before to work on its design, you are presented here with an outline that provides a revised set of mnemonics for the assembly language. This post is marked as a wiki for their discussion. Have you ever had any experience with assembly languages in the past? Were there some instructions that you thought should have been renamed to something different? Did you find yourself thinking outside the box and with a different paradigm than in which the mnemonics were named? If you can answer yes to any of those questions, you are most welcome here. Subjective answers are appreciated! hold N Push the number onto the stack copy Duplicate the top item on the stack copy N Copy the nth item on the stack (given by the argument) onto the top of the stack swap Swap the top two items on the stack drop Discard the top item on the stack drop N Slide n items off the stack, keeping the top item add Addition sub Subtraction mul Multiplication div Integer Division mod Modulo save Store load Retrieve L: Mark a location in the program call L Call a subroutine goto L Jump unconditionally to a label if=0 L Jump to a label if the top of the stack is zero if<0 L Jump to a label if the top of the stack is negative return End a subroutine and transfer control back to the caller exit End the program print chr Output the character at the top of the stack print int Output the number at the top of the stack input chr Read a character and place it in the location given by the top of the stack input int Read a number and place it in the location given by the top of the stack Question: How would you redesign, rewrite, or rename the previous mnemonics and for what reasons?

    Read the article

  • Can anyone explain me the source code of python "import this"?

    - by byterussian
    If you open a Python interpreter, and type "import this", as you know, it prints: The Zen of Python, by Tim Peters Beautiful is better than ugly. Explicit is better than implicit. Simple is better than complex. Complex is better than complicated. Flat is better than nested. Sparse is better than dense. Readability counts. Special cases aren't special enough to break the rules. Although practicality beats purity. Errors should never pass silently. Unless explicitly silenced. In the face of ambiguity, refuse the temptation to guess. There should be one-- and preferably only one --obvious way to do it. Although that way may not be obvious at first unless you're Dutch. Now is better than never. Although never is often better than *right* now. If the implementation is hard to explain, it's a bad idea. If the implementation is easy to explain, it may be a good idea. Namespaces are one honking great idea -- let's do more of those! In the python source(Lib/this.py) this text is generated by a curios piece of code: s = """Gur Mra bs Clguba, ol Gvz Crgref Ornhgvshy vf orggre guna htyl. Rkcyvpvg vf orggre guna vzcyvpvg. Fvzcyr vf orggre guna pbzcyrk. Pbzcyrk vf orggre guna pbzcyvpngrq. Syng vf orggre guna arfgrq. Fcnefr vf orggre guna qrafr. Ernqnovyvgl pbhagf. Fcrpvny pnfrf nera'g fcrpvny rabhtu gb oernx gur ehyrf. Nygubhtu cenpgvpnyvgl orngf chevgl. Reebef fubhyq arire cnff fvyragyl. Hayrff rkcyvpvgyl fvyraprq. Va gur snpr bs nzovthvgl, ershfr gur grzcgngvba gb thrff. Gurer fubhyq or bar-- naq cersrenoyl bayl bar --boivbhf jnl gb qb vg. Nygubhtu gung jnl znl abg or boivbhf ng svefg hayrff lbh'er Qhgpu. Abj vf orggre guna arire. Nygubhtu arire vf bsgra orggre guna *evtug* abj. Vs gur vzcyrzragngvba vf uneq gb rkcynva, vg'f n onq vqrn. Vs gur vzcyrzragngvba vf rnfl gb rkcynva, vg znl or n tbbq vqrn. Anzrfcnprf ner bar ubaxvat terng vqrn -- yrg'f qb zber bs gubfr!""" d = {} for c in (65, 97): for i in range(26): d[chr(i+c)] = chr((i+13) % 26 + c) print "".join([d.get(c, c) for c in s])

    Read the article

  • Text Obfuscation using base64_encode()

    - by user271619
    I'm playing around with encrypt/decrypt coding in php. Interesting stuff! However, I'm coming across some issues involving what text gets encrypted into. Here's 2 functions that encrypt and decrypt a string. It uses an Encryption Key, which I set as something obscure. I actually got this from a php book. I modified it slightly, but not to change it's main goal. I created a small example below that anyone can test. But, I notice that some characters show up as the "encrypted" string. Characters like "=" and "+". Sometimes I pass this encrypted string via the url. Which may not quite make it to my receiving scripts. I'm guessing the browser does something to the string if certain characters are seen. I'm really only guessing. is there another function I can use to ensure the browser doesn't touch the string? or does anyone know enough php bas64_encode() to disallow certain characters from being used? I'm really not going to expect the latter as a possibility. But, I'm sure there's a work-around. enjoy the code, whomever needs it! define('ENCRYPTION_KEY', "sjjx6a"); function encrypt($string) { $result = ''; for($i=0; $i<strlen($string); $i++) { $char = substr($string, $i, 1); $keychar = substr(ENCRYPTION_KEY, ($i % strlen(ENCRYPTION_KEY))-1, 1); $char = chr(ord($char)+ord($keychar)); $result.=$char; } return base64_encode($result)."/".rand(); } function decrypt($string){ $exploded = explode("/",$string); $string = $exploded[0]; $result = ''; $string = base64_decode($string); for($i=0; $i<strlen($string); $i++) { $char = substr($string, $i, 1); $keychar = substr(ENCRYPTION_KEY, ($i % strlen(ENCRYPTION_KEY))-1, 1); $char = chr(ord($char)-ord($keychar)); $result.=$char; } return $result; } echo $encrypted = encrypt("reaplussign.jpg"); echo "<br>"; echo decrypt($encrypted);

    Read the article

  • C++ program Telephone Directory from a file

    - by Stacy Doyle
    I am writing a program for a phone directory. The user inputs a name and the program searches the file and either outputs the number or an error because the persons name is not in the file. The program should also ask the user if they would like to continue using the program and look up another number. So far runs and asks for the name and then prints the error message that I put in place saying that the name is not in the database. I am guessing that I must not really be having my program look in the file but not sure what to do also don't know how to get the program to run again if the user chooses to continue. #include <iostream> #include <fstream> #include <string> #include <iomanip> using namespace std; char chr; int main() { string first; string last; string number; string firstfile; string lastfile; string numberfile; int cont; ifstream infile; infile.open("name and numbers.dat"); //opening the file infile>>firstfile>>lastfile>>numberfile; cout<<"Enter a first and last name."<<endl; //Asking user for the input cin>>first>>last; //input the data { if(first==firstfile && last==lastfile) //if the entered information matches the information in the file cout<<first<<" "<<last<<"'s number is "<<numberfile<<endl; //this is printed else cout<<"Sorry that is not in our database."<<endl; //if the information doesn't match this is printed } cout<<"Would you like to search for another name? Y or N"<<endl; //user is asked if they would like to continue cin>>cont; infile.close(); //close file cin>>chr; return 0; }

    Read the article

  • Copying metadata over a database link in Oracle 10g

    - by Tunde
    Thanks in advance for your help experts. I want to be able to copy over database objects from database A into database B with a procedure created on database B. I created a database link between the two and have tweaked the get_ddl function of the dbms_metadata to look like this: create or replace function GetDDL ( p_name in MetaDataPkg.t_string p_type in MetaDataPkg.t_string ) return MetaDataPkg.t_longstring is -- clob v_clob clob; -- array of long strings c_SYSPrefix constant char(4) := 'SYS_'; c_doublequote constant char(1) := '"'; v_longstrings metadatapkg.t_arraylongstring; v_schema metadatapkg.t_string; v_fullength pls_integer := 0; v_offset pls_integer := 0; v_length pls_integer := 0; begin SELECT DISTINCT OWNER INTO v_schema FROM all_objects@ENTORA where object_name = upper(p_name); -- get DDL v_clob := dbms_metadata.get_ddl(p_type, upper(p_name), upper(v_schema)); -- get CLOB length v_fullength := dbms_lob.GetLength(v_clob); for nIndex in 1..ceil(v_fullength / 32767) loop v_offset := v_length + 1; v_length := least(v_fullength - (nIndex - 1) * 32767, 32767); dbms_lob.read(v_clob, v_length, v_offset, v_longstrings(nIndex)); -- Remove table’s owner from DDL string: v_longstrings(nIndex) := replace( v_longstrings(nIndex), c_doublequote || user || c_doublequote || '.', '' ); -- Remove the following from DDL string: -- 1) "new line" characters (chr(10)) -- 2) leading and trailing spaces v_longstrings(nIndex) := ltrim(rtrim(replace(v_longstrings(nIndex), chr(10), ''))); end loop; -- close CLOB if (dbms_lob.isOpen(v_clob) > 0) then dbms_lob.close(v_clob); end if; return v_longstrings(1); end GetDDL; so as to remove the schema prefix that usually comes with metadata. I get a null value whenever I run this function over the database link with the following queries. select getddl( 'TABLE', 'TABLE1') from user_tables@ENTORA where table_name = 'TABLE1'; select getddl( 'TABLE', 'TABLE1') from dual@ENTORA; t_string is varchar2(30) t_longstring is varchar2(32767) and type t_ArrayLongString is table of t_longstring I would really appreciate it if any one could help. Many thanks.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 1 2 3 4 5 6 7 8  | Next Page >