Search Results

Search found 588 results on 24 pages for 'regexp grammars'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 4/24 | < Previous Page | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >

  • Regexp in iOS to find comments

    - by SteveDolphin23
    I am trying to find and process 'java-style' comments within a string in objective-C. I have a few regex snippets which almost work but I am stuck on one hurdle: different options seem to make the different styles work. For example, I am using this to match: NSArray* matches = [[NSRegularExpression regularExpressionWithPattern:expression options:NSRegularExpressionAnchorsMatchLines error:nil] matchesInString:string options:0 range:searchRange]; The options here allow me successfully find and process single line comments (//) but not multiline (/* */), if I change the option to NSRegularExpressionDotMatchesLineSeparators then I can make multiline work fine but I can't find the 'end' of a single line comment. I suppose really I need dot-matches-line-separators but I need a better way of finding the end of a single line comment? The regexp I have so far are: @"/\\*.*?\\*/" @"//.*$" it's clear to see if dot matches a line separator then the second one (single line) never 'finishes' but how do I fix this? I found some suggestions for single line that were more like: @"(\/\/[^"\n\r]*(?:"[^"\n\r]*"[^"\n\r]*)*[\r\n])" But that doesn't' seem to work at all! Thanks in advance for any pointers.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • password validator using RegExp in Flex

    - by kalyaniRavi
    I have seen several examples in Flex for passowrd validator using RegExp. But every where the validation is happend for single validation. I have a requirement, like password validations like • At least one Upper case letter • At least one numeric character • At least one special character such as @, #, $, etc. • At least one Lower case letter • password lenght minimum 6 digits • password cannot be same as user name Can anyone provide me a code for this..? I have the code only for checking the password is valid or not . check the below code. MXML CODE <mx:FormItem label="Username:" x="83" y="96" width="66"> </mx:FormItem> <mx:FormItem label="Password:" x="88" y="123" width="61"> </mx:FormItem> <mx:Button label="Login" id="btnLogin" tabIndex="2" click="login();" enabled="{formIsValid}" x="327" y="162" width="84"/> <mx:TextInput id="txtPassword" displayAsPassword="true" change="validateForm(event);" x="152" y="121" width="217"/> <mx:TextInput id="txtUserId" change="validateForm(event);" x="152" y="94" width="217"/> AS Code: private function validateForm(event:Event):void { focussedFormControl = event.target as DisplayObject; formIsValid = true; formIsEmpty = (txtUserId.text == "" && txtPassword.text == ""); validate(strVUserId); validate(strVPassword); } private function validate(validator:Validator):Boolean { var validatorSource:DisplayObject = validator.source as DisplayObject; var suppressEvents:Boolean = (validatorSource != focussedFormControl); var event:ValidationResultEvent = validator.validate(null, suppressEvents); var currentControlIsValid:Boolean = (event.type == ValidationResultEvent.VALID); formIsValid = formIsValid && currentControlIsValid; return currentControlIsValid; }

    Read the article

  • regexp target last main li in list

    - by veilig
    I need to target the starting tag of the last top level LI in a list that may or may-not contain sublists in various positions - without using CSS or Javascript. Is there a simple/elegant regexp that can help with this? I'm no guru w/ them, but it appears the need for greedy/non-greedy selectors when I'm selecting all the middle text (.*) / (.+) changes as nested lists are added and moved around in the list - and this is throwing me off. $pattern = '/^(<ul>.*)<li>(.+<\/li><\/ul>)$/'; $replacement = '$1<li id="lastLi">$3'; Perhaps there is an easier approach?? converting to XML to target the LI and then convert back? ie: Single Element <ul> <li>TARGET</li> </ul> Multiple Elements <ul> <li>foo</li> <li>TARGET</li> </ul> Nested Lists before end <ul> <li> foo <ul> <li>bar</li> </ul> <li> <li>TARGET</li> </ul> Nested List at end <ul> <li>foo</li> <li> TARGET <ul> <li>bar</li> </ul> </li> </ul>

    Read the article

  • Flex: replace all spaces with comma

    - by Treby
    im new with regexp, so can i ask for some assistance Using string.replace function what code that can replace spaces with comma Input:The quick brown fox jumps over the lazy dog. Output:The,quick,brown,fox,jumps,over,the,lazy dog. Thanks

    Read the article

  • Apache FilesMatch regexp: Can it match by the cache buster 10 digit (rails generated) following the filename?

    - by ynkr
    According to the apache FilesMatch docs: The FilesMatch directive provides for access control by filename Basically, I only want to set an expires header for resources that have a 10 digit "cache buster" id appended to the name. So, here is my attempt at such a thing in my httpd.conf <FilesMatch "(jpg|jpeg|png|gif|js|css)\?\d{10}$"> ExpiresActive On ExpiresDefault "now plus 5 minutes" </FilesMatch> And here is an example of a resource I want to match: http://localhost:3000/images/of/elvis/eating-a-bacon-sandwich.png?1306277384 Now obviously my FilesMatch regexp is not matching so I am guessing 1 of 2 things is happening. Either my regexp is wonky or the '?1231231231' cache busting part of the file is not part of what apache considers part of the filename. Can anybody confirm and/or give me a way to cache only those resources that will not persist beyond the next deploy?

    Read the article

  • Wanted: a very simple java RegExp API

    - by itsadok
    I'm tired of writing Pattern p = Pattern.compile(... Matcher m = p.matcher(str); if (m.find()) { ... Over and over again in my code. I was going to write a helper class to make it neater, but I then I wondered: is there a library that tries to provide a simpler facade for Regular Expressions in Java? I'm thinking something in the style of commons-lang and Guava.

    Read the article

  • Grep / RegExp help

    - by Calvin
    Hi everyone! I apologize if this is a really stupid question. I have data in the format: etc etc etc <span>etc etc etc</span> etc etc etc etc etc etc <span>etc etc etc</span> etc etc etc etc etc etc <span>etc etc etc</span> etc etc etc Is there a way to grep each line for a match that falls outside of the span tags?

    Read the article

  • smarter character replacement using ruby gsub and regexp

    - by agriciuc
    Hi guys! I'm trying to create permalink like behavior for some article titles and i don't want to add a new db field for permalink. So i decided to write a helper that will convert my article title from: "O "focoasa" a pornit cruciada, împotriva barbatilor zgârciti" to "o-focoasa-a-pornit-cruciada-impotriva-barbatilor-zgarciti". While i figured out how to replace spaces with hyphens and remove other special characters (other than -) using: title.gsub(/\s/, "-").gsub(/[^\w-]/, '').downcase I am wondering if there is any other way to replace a character with a specific other character from only one .gsub method call, so I won't have to chain title.gsub("a", "a") methods for all the UTF-8 special characters of my localization. I was thinking of building a hash with all the special characters and their counterparts but I haven't figured out yet how to use variables with regexps. What I was looking for is something like: title.gsub(/\s/, "-").gsub(*replace character goes here*).gsub(/[^\w-]/, '').downcase Thanks!

    Read the article

  • RegExp: want to find all links that do not end in ".html"

    - by grovel
    Hi, I'm a relative novice to regular expressions (although I've used them many times successfully). I want to find all links in a document that do not end in ".html" The regular expression I came up with is: href=\"([^"]*)(?<!html)\" In Notepad++, my editor, href=\"([^"]*)\" finds all the links (both those that end in "html" and those that do not). Why doesn't negative lookbehind work? I've also tried lookahead: href=\"[^"]*(?!html\") but that didn't work either. Can anybody help? Cheers, grovel

    Read the article

  • Basic regexp help

    - by casben79
    I am new to programming PHP and am trying to validate a field in a form. The field if for a RAL color code and so would look something like : RAL 1001. so the letters RAL and then 4 numbers. Can someone help me set them into a regular expression to validate them. i have tried this with no success: $string_exp = "/^[RAL][0-9 .-]+$/i"; What can I say but sorry for being a complete NOOB at PHP. Cheers Ben

    Read the article

  • Problem with Javascript RegExp-mask

    - by OrjanL
    I have a string that looks something like this: {theField} > YEAR (today, -3) || {theField} < YEAR (today, +3) I want it to be replaced into: {theField} > " + YEAR (today, -3) + " || {theField} < " + YEAR (today, +3) + " I have tried this: String.replace(/(.*)(YEAR|MONTH|WEEK|DAY+)(.*[)]+)/g, "$1 \" + $2 $3 + \"") But that gives me: {theField} > YEAR (today, +3) || {theField} > " + YEAR (today, +3) + " Does anyone have any ideas?

    Read the article

  • Regexp: Replace only in specific context

    - by blinry
    In a text, I would like to replace all occurrences of $word by [$word]($word) (to create a link in Markdown), but only if it is not already in a link. Example: [$word homepage](http://w00tw00t.org) should not become [[$word]($word) homepage](http://w00tw00t.org). Thus, I need to check whether $word is somewhere between [ and ] and only replace if it's not the case. Can you think of a preg_replace command for this?

    Read the article

  • Building a regexp to split a string

    - by Kivin
    I'm seeking a solution to splitting a string which contains text in the following format: "abcd efgh 'ijklm no pqrs' tuv" which will produce the following results: ['abcd', 'efgh', 'ijklm no pqrs', 'tuv'] In otherwords, it splits by whitespace unless inside of a single quoted string. I think it could be done with .NET regexps using "Lookaround" operators, particularly balancing operators. I'm not so sure about perl.

    Read the article

  • Regexp for selecting spaces between digits and decimal char

    - by Tirithen
    I want to remove spaces from strings where the space is preceeded by a digit or a "." and acceded by a digit or ".". I have strings like: "50 .10", "50 . 10", "50. 10" and I want them all to become "50.10" but with an unknown number of digits on either side. I'm trying with lookahead/lookbehind assertions like this: $row = str_replace("/(?<=[0-9]+$)\s*[.]\s*(?=[0-9]+$)/", "", $row); But it does not work...

    Read the article

  • Ruby -- looking for some sort of "Regexp unescape" method

    - by RubyNoobie
    I have a bunch of strings that appear to have been double-escaped -- eg, I have "\\014\"\\000\"\\016smoothing\"\\011mean\"\\022color\"\\011zero@\\016" but I want "\014"\000"\016smoothing"\011mean"\022color"\011zero@\016" Is there a method I can use to unescape them? I imagine that I could make a regex to remove 1 backslash from every consecutive n backslashes, but I don't have a lot of regex experience and it seems there ought to be a "more elegant" way to do it. For example, when I puts MyString it displays the output I'd like, but I don't know how I might capture that into a variable. Thanks! Edited to add context: I have this class that is being used to marshal / restore some stuff, but when I restore some old strings it spits out a type error which I've determined is because they weren't -- for some inexplicable reason -- stored as base64. They instead appear to be 'double-escaped', when I need them to be 'single-escaped' to get restored. require 'base64' class MarshaledStuff < ActiveRecord::Base validates_presence_of :marshaled_obj def contents obj = self.marshaled_obj return Marshal.restore(Base64.decode64(obj)) end def contents=(newcontents) self.marshaled_obj = Base64.encode64(Marshal.dump(newcontents)) end end

    Read the article

  • Javascript substrings multiline replace by RegExp

    - by Radek Šimko
    Hi, I'm having some troubles with matching a regular expression in multi-line string. <script> var str="Welcome to Google!\n"; str = str + "We are proud to announce that Microsoft has \n"; str = str + "one of the worst Web Developers sites in the world."; document.write(str.replace(/.*(microsoft).*/gmi, "$1")); </script> http://jsbin.com/osoli3/3/edit As you may see on the link above, the output of the code looks like this: Welcome to Google! Microsoft one of the worst Web Developers sites in the world. Which means, that the replace() method goes line by line and if there's no match in that line, it returns just the whole line... Even if it has the "m" (multiline) modifier...

    Read the article

  • Find any type of url, and replace "click here" text with regexp jquery

    - by Takács Zsolt
    Hi! I need a little script in jQ because I have to change the long urls to a shorten "click here" text. I want to change only the url text not the value of href's attrib like this: <a href="http://verylongurl.ext/ohshitwhatlongisit/yaythatstoolongforme">http://verylongurl.ext/ohshitwhatlongisit/yaythatstoolongforme</a> to.. <a href="http://verylongurl.ext/ohshitwhatlongisit/yaythatstoolongforme">click here</a> The script must work on any possible type of url for example: http: https: ftp: and so on... tyvm girls and guys! Regs!

    Read the article

  • preg_match , regexp , php , extract text from html

    - by Michael
    I'm trying to extract "Florida (FL)" from http://www.auctionarms.com/search/displayitem.cfm?itemnum=9736364&oh=216543. My code is //get location $pattern = "/(State)<\/i\:<\/td(.*)<\/td/"; preg_match_all($pattern, $htmlContent, $matches); print_r($matches); any idea why is not working ?

    Read the article

  • win32 ruby1.9 regexp and cyrillic string

    - by scriper
    #coding: utf-8 str2 = "asdf????????" p str2.encoding #<Encoding:UTF-8> p str2.scan /\p{Cyrillic}/ #found all cyrillic charachters str2.gsub!(/\w/u,'') #removes only latin characters puts str2 The question is why \w ignore cyrillic characters? I have installed latest ruby package from http://rubyinstaller.org/. Here is my output of ruby -v ruby 1.9.1p378 (2010-01-10 revision 26273) [i386-mingw32] As far as i know 1.9 oniguruma regular expression library has full support for unicode characters.

    Read the article

  • Limiting input to specified regexp with uppercase chars in IE

    - by pixelboy
    I'm trying to limit what our users will be able to type in inputs, using javascript/jquery. Problem is, I have to limit this to Uppercase chars only, and numbers. Here's what I coded previously : $(input).keydown(function(e){ if ($(input).attr("class")=="populationReference"){ var ValidPattern = /^[A-Z_0-9]*$/; var char = String.fromCharCode(e.charCode); if (!ValidPattern.test(char) && e.charCode!=0){ return false; e.preventDefault(); } } }); If Firefox supports charCode, IE doesn't. How then, could I test if the user is typing uppercase or lowercase characters ? Thanks for any help !

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >