Search Results

Search found 25203 results on 1009 pages for 'table splitting'.

Page 40/1009 | < Previous Page | 36 37 38 39 40 41 42 43 44 45 46 47  | Next Page >

  • Splitting a file before upload?

    - by Yevgeniy Brikman
    On a webpage, is it possible to split large files into chunks before the file is uploaded to the server? For example, split a 10MB file into 1MB chunks, and upload one chunk at a time while showing a progress bar? It sounds like JavaScript doesn't have any file manipulation abilities, but what about Flash and Java applets? This would need to work in IE6+, Firefox and Chrome. Update: forgot to mention that (a) we are using Grails and (b) this needs to run over https.

    Read the article

  • Effective way of String splitting C#

    - by openidsujoy
    I have a completed string like this N:Pay in Cash++RGI:40++R:200++T:Purchase++IP:N++IS:N++PD:PC++UCP:598.80++UPP:0.00++TCP:598.80++TPP:0.00++QE:1++QS:1++CPC:USD++PPC:Points++D:Y++E:Y++IFE:Y++AD:Y++IR:++MV:++CP:~ ~N:ERedemption++RGI:42++R:200++T:Purchase++IP:N++IS:N++PD:PC++UCP:598.80++UPP:0.00++TCP:598.80++TPP:0.00++QE:1++QS:1++CPC:USD++PPC:Points++D:Y++E:Y++IFE:Y++AD:Y++IR:++MV:++CP: this string is like this It's list of PO's(Payment Options) which are separated by ~~ this list may contains one or more PO contains only Key-Value Pairs which separated by : spaces are denoted by ++ I need to extract the values for Key "RGI" and "N". I can do it via for loop , I want a efficient way to do this. any help on this.

    Read the article

  • Sum of distinc rows after a 1-many table join

    - by Lock
    I have 2 tables that I am joining. Table 1 has 1-many relationship with table 2. That is, table 2 can return multiple rows for a single row of table 1. Because of this, the records of table 1 is duplicated for as many rows as are on table 2.. which is expected. Now, I have a sum on one of the columns from table 1, but because of the multiple rows that get returned on the join, the sum is obviously multiplying. Is there a way to get this number back to its original number? I tried dividing by the count of rows from table 2 but this didnt quite give me the expected result. Are there any analytical functions that could do this? I almost want something like "if this row has not yet been counted in the sum, add it to the sum"

    Read the article

  • Java splitting string by custom regex match

    - by slikz
    I am completely new to regular expressions so I'm looking for a bit of help here. I am compiling under JDK 1.5 Take this line as an example that I read from standard input: ab:Some string po:bubblegum What I would like to do is split by the two characters and colon. That is, once the line is split and put into a string array, these should be the terms: ab:Some string po:bubblegum I have this regex right now: String[] split = input.split("[..:]"); This splits at the semicolon; what I would like is for it to match two characters and a semicolon, but split at the space before that starts. Is this even possible? Here is the output from the string array: ab Some String po bubblegum I've read about Pattern.compile() as well. Is this something I should be considering?

    Read the article

  • how do I integrate the aspnet_users table (asp.net membership) into my existing database

    - by ooo
    i have a database that already has a users table COLUMNS: userID - int loginName - string First - string Last - string i just installed the asp.net membership table. Right now all of my tables are joined into my users table foreign keyed into the "userId" field How do i integrate asp.net_users table into my schema? here are the ideas i thought of: Add a membership_id field to my users table and on new inserts, include that new field in my users table. This seems like the cleanest way as i dont need to break any existing relationships. break all existing relationship and move all of the fields in my user table into the asp.net_users table. This seems like a pain but ultimately will lead to the most simple, normalized solution any thoughts?

    Read the article

  • Merging and splitting overlapping rectangles to produce non-overlapping ones

    - by uj
    I am looking for an algorithm as follows: Given a set of possibly overlapping rectangles (All of which are "not rotated", can be uniformly represented as (left,top,right,bottom) tuplets, etc...), it returns a minimal set of (non-rotated) non-overlapping rectangles, that occupy the same area. It seems simple enough at first glance, but prooves to be tricky (at least to be done efficiently). Are there some known methods for this/ideas/pointers? Methods for not necessarily minimal, but heuristicly small, sets, are interesting as well, so are methods that produce any valid output set at all.

    Read the article

  • Using an objects date (without time) for a table header instead of an objects date and time (iphone)

    - by billywilliamton
    I've been working on an iphone project and have run into an issue. Currently In the table view where it displays all the objects, I use headers based on the objects datePerformed field. The only problem is that my code apparently creates a header that contains both the date and time resulting in objects not being grouped solely by their date as I intended, but rather based on their date and time. I'm not sure if it matters, but when an object is created I use a date picker to pick the date, but not the time. I was wondering if anyone could give me any suggestions or advice. Here is the code where i set up the fetchedResultsController - (NSFetchedResultsController *)fetchedResultsController { if (fetchedResultsController != nil) { return fetchedResultsController; } // Create and configure a fetch request with the Exercise entity. NSFetchRequest *fetchRequest = [[NSFetchRequest alloc] init]; NSEntityDescription *entity = [NSEntityDescription entityForName:@"Exercise" inManagedObjectContext:managedObjectContext]; [fetchRequest setEntity:entity]; // Create the sort descriptors array using date and name NSSortDescriptor *dateDescriptor = [[NSSortDescriptor alloc] initWithKey:@"datePerformed" ascending:NO]; NSSortDescriptor *nameDescriptor = [[NSSortDescriptor alloc] initWithKey:@"name" ascending:YES]; NSArray *sortDescriptors = [[NSArray alloc] initWithObjects:dateDescriptor, nameDescriptor, nil]; [fetchRequest setSortDescriptors:sortDescriptors]; // Create and initialize the fetch results controller NSFetchedResultsController *aFetchedResultsController = [[NSFetchedResultsController alloc] initWithFetchRequest:fetchRequest managedObjectContext:managedObjectContext sectionNameKeyPath:@"datePerformed" cacheName:@"Root"]; self.fetchedResultsController = aFetchedResultsController; fetchedResultsController.delegate = self; // Memory management calls [aFetchedResultsController release]; [fetchRequest release]; [dateDescriptor release]; [nameDescriptor release]; [sortDescriptors release]; return fetchedResultsController; } Here's where I set up the table header properties - (NSString *)tableView:(UITableView *)tableView titleForHeaderInSection:(NSInteger)section { // Display the exercise' date as section headings. return [[[fetchedResultsController sections] objectAtIndex:section] name]; } Any suggestions welcome. Thanks for your time. -Billy Williamton

    Read the article

  • Splitting string into array upon token

    - by Gnutt
    I'm writing a script to perform an offsite rsync backup, and whenever the rsyncline recieves some output it goes into a single variable. I then want to split that variable into an array upon the ^M token, so that I can send them to two different logger-sessions (so I get them on seperate lines in the log). My current line to perform the rsync result=rsync --del -az -e "ssh -i $cert" $source $destination 2>&1 Result in the log, when the server is unavailable ssh: connect to host offsite port 22: Connection timed out^M rsync: connection unexpectedly closed (0 bytes received so far) [sender] rsync error: unexplained error (code 255) at io.c(601) [sender=3.0.7]

    Read the article

  • Is there a standard SQL Table design for overriding 'big picture' default values with lower level de

    - by RichardHowells
    Here's an example. Suppose we are trying to calculate a service charge. Say sales in the USA attract a 10 dollar charge, sales in the UK attract a 20 dollar charge So far it's easy - we are starting to imagine a table that lists charges by country. Now lets assume that Alaska and Hawaii are treated as special cases they are both 15 dollars That suggests a table with states, Alaska and Hawaii are charged at 15, but presumably we need 48 (redundant) rows all saying 10. This gives us a maintainance problem, our user only wants to type 10 once NOT 48 times. It does not sit well with the UK either. The UK does not have states. Suppose we throw in another couple of cross cutting rules. If you order by phone there is a 10% supplement on the charge. If you order via the web there is a 10% discount. But for some reason best known to the owners of the business the web/phone supplement/discount are not applied in Hawaii. It seems to me that this is quite a common kind of problem and there is probably a well known arrangement of tables to store the data. Most cases get handled by broad brush answers, but there are some very detailed low level variations that give rise to a huge number of theoretical combinations, most of which are not used.

    Read the article

  • Splitting html string after so many words

    - by jimbo
    Hi all, I have a string that if it is longer than lets say 10 words, I want to split it into two parts. The second part will be included else-where after a 'more' link. The string will hold html tags too though. For an example the string could be: <p>This is just a test string with more words than the <strong>amount allow</strong> before split, blah blah blah</p> So in the case I would want: $string[0] // <p>This is just a test string with more words than</p>; $string[1] // <p>the <strong>amount allow</strong> before split, blah blah blah</p>; Thanks in advance

    Read the article

  • Splitting list into a list of possible tuples

    - by user1742646
    I need to split a list into a list of all possible tuples, but I'm unsure of how to do so. For example pairs ["cat","dog","mouse"] should result in [("cat","dog"), ("cat","mouse"), ("dog","cat"), ("dog","mouse"), ("mouse","cat"), ("mouse","dog")] I was able to form the first two, but am unsure of how to get the rest. Here's what I have so far: pairs :: [a] -> [(a,a)] pairs (x:xs) = [(m,n) | m <- [x], n <- xs]

    Read the article

  • Problem with joining to an empty table

    - by Imran Omar Bukhsh
    I use the following query: select * from A LEFT JOIN B on ( A.t_id != B.t_id) to get all the records in A that are not in B. The results are fine except when table B is completely empty, but then I do not get any records, even from table A. Later It wont work yet! CREATE TABLE IF NOT EXISTS T1 ( id int(11) unsigned NOT NULL AUTO_INCREMENT, title varchar(50) CHARACTER SET utf8 COLLATE utf8_unicode_ci NOT NULL, t_id int(11) NOT NULL, PRIMARY KEY (id) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=3 ; -- -- Dumping data for table T1 INSERT INTO T1 (id, title, t_id) VALUES (1, 'apple', 1), (2, 'orange', 2); -- -- Table structure for table T2 CREATE TABLE IF NOT EXISTS T2 ( id int(11) NOT NULL AUTO_INCREMENT, title varchar(50) CHARACTER SET utf8 COLLATE utf8_unicode_ci NOT NULL, t_id int(11) NOT NULL, PRIMARY KEY (id) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=2 ; -- -- Dumping data for table T2 INSERT INTO T2 (id, title, t_id) VALUES (1, 'dad', 2); Now I want to get all records in T1 that do not have a corresponding records in T2 I try SELECT * FROM T1 LEFT OUTER JOIN T2 ON T1.t_id != T2.t_id and it won't work

    Read the article

  • Splitting up input using regular expressions in Java

    - by Joe24
    I am making a program that lets a user input a chemical for example C9H11N02. When they enter that I want to split it up into pieces so I can have it like C9, H11, N, 02. When I have it like this I want to make changes to it so I can make it C10H12N203 and then put it back together. This is what I have done so far. using the regular expression I have used I can extract the integer value, but how would I go about get C10, H11 etc..? System.out.println("Enter Data"); Scanner k = new Scanner( System.in ); String input = k.nextLine(); String reg = "\\s\\s\\s"; String [] data; data = input.split( reg ); int m = Integer.parseInt( data[0] ); int n = Integer.parseInt( data[1] );

    Read the article

  • Splitting a double in two, C#

    - by Stacey
    I'm attempting to use a double to represent a bit of a dual-value type in a database that must sometimes accept two values, and sometimes accept only one (int). So the field is a float in the database, and in my C# code, it is a double (since mapping it via EF makes it a double for some reason... ) So basically what I want to do .. let's say 2.5 is the value. I want to separate that out into 2, and 5. Is there any implicit way to go about this?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Splitting values into groups evenly

    - by Paul Knopf
    Let me try to explain the situation the best I can. Lets say I have 3 values 1, 2, 3 I tell an algorithm to split this values into x columns. Lets say x = 2 for clarification. The algorithm determines that the group of values is best put into two columns the following way. 1st column 2nd column --------------------------- 1 3 2 Each column has an even number (totals, not literals) value. Now lets say I have the following values 7, 8, 3, 1, 4 I tell the algorithm that I want the values split into 3 columns. The algorithm now tells me that the following is the best fit. 1st column 2nd column 3rd column 8 7 3 1 4 Notice how the columns arent quiet even, but it is as close as it can get. A little over and a little under is considered ok, as long as the list is AS CLOSE TO EVEN AS IT CAN BE. Anybody got any suggestions? Know any good methods of doing this?

    Read the article

  • deleting and reusing a temp table in a stored precedures

    - by Sheagorath
    Hi I need to SELECT INTO a temp table multiple times with a loop but I just can't do it, because after the table created( in SELECT into you can't simply drop the table at the end of the loop because you can't delete a table and create it again in the same batch. so how can I delete a table in a stored procedure and create it again? here is a snippet of where I am actualy using the temp table which is supposed to be a pivoting algorithm: WHILE @offset<@NumDays BEGIN SELECT bg.*, j.ID, j.time, j.Status INTO #TEMP1 FROM #TEMP2 AS bg left outer join PersonSchedule j on bg.PersonID = j.PersonID and bg.TimeSlotDateTime = j.TimeSlotDateTime and j.TimeSlotDateTime = @StartDate + @offset DROP TABLE #TEMP2; SELECT * INTO #TEMP2 FROM #TEMP1 DROP TABLE #TEMP1 SET @offset = @offset + 1 END

    Read the article

  • How to insert the recently inserteddata of a table to others DB's Table? See description...

    - by Parth
    I am using MySQL DB and I have created a PHP script for the following, now i need the idea for the below asked question.... please help... I have a table called audit trail whose structure is: id, trackid, table, operation, newvalue, oldvalue, field, changedone I have created triggers for insert/update/delete for every table of same DB, now whenever there is change in ny DB the triggers get activated and updates the Audit trail table accordingly.. I am tracking these changes so that i can use these changes to be done on production DB which is of same structure as of this test DB. Also when the admin finds that he does not need the changes recently he did for production DB then he can rollback it using the Old Data it stored in Ausittrail table of test db. Now here in audit trail table structure, there will be an insert for every single field change like-wise if a table has 4 fields then the change in that tavle will insert 4 rows in audit trail.. Coming to the question now, How can i find the latest change done from the Audit table so that I can insert these changes in Production DB.

    Read the article

  • Splitting a UL into three even lists

    - by Andy
    I am printing a menu using UL, the trouble is the order that is generated by my script is ignored because im printing the LI one after the other and they're spanning three across. So the order is 1 , 2 , 3 as opposed to 1 2 3 To counteract this i wanted to split my single UL into three that way the order would be maintained. Here is my code currently which works perfectly to print a single UL. //Category Drop Down Menu $this->CategoryDropDownMenu = '<ul id="subcatmenu">'; foreach($sitemap->CategoryMenu as $val) $this->CategoryDropDownMenu .= '<li><a href="'.$val[host].$val[link].'"><span>'.htmlspecialchars($val[title]).'</span></a></li>'; $this->CategoryDropDownMenu .= '</ul>';

    Read the article

  • how to integrate my users database table with the aspnet_users table that comes with asp.net members

    - by ooo
    i have a database that already has a users table COLUMNS: userID - int loginName - string First - string Last - string i just installed the asp.net membership table. Right now all of my tables are joined into my users table foreign keyed into the "userId" field How do i integrate asp.net_users table into my schema? here are the ideas i thought of: Add a membership_id field to my users table and on new inserts, include that new field in my users table. This seems like the cleanest way as i dont need to break any existing relationships. break all existing relationship and move all of the fields in my user table into the asp.net_users table. This seems like a pain but ultimately will lead to the most simple, normalized solution any thoughts?

    Read the article

  • Control-Break Style ADF Table - Comparing Values with Previous Row

    - by Steven Davelaar
    Sometimes you need to display data in an ADF Faces table in a control-break layout style, where rows should be "indented" when the break column has the same value as in the previous row. In the screen shot below, you see how the table breaks on both the RegionId column as well as the CountryId column. To implement this I didn't use fancy SQL statements. The table is based on a straightforward Locations ViewObject that is based on the Locations entity object and the Countries reference entity object, and the join query was automatically created by adding the reference EO. To get the indentation in the ADF Faces table, we simple use two rendered properties on the RegionId and CountryId outputText items:  <af:column sortProperty="RegionId" sortable="false"            headerText="#{bindings.LocationsView1.hints.RegionId.label}"            id="c5">   <af:outputText value="#{row.RegionId}" id="ot2"                  rendered="#{!CompareWithPreviousRowBean['RegionId']}">     <af:convertNumber groupingUsed="false"                       pattern="#{bindings.LocationsView1.hints.RegionId.format}"/>   </af:outputText> </af:column> <af:column sortProperty="CountryId" sortable="false"            headerText="#{bindings.LocationsView1.hints.CountryId.label}"            id="c1">   <af:outputText value="#{row.CountryId}" id="ot5"                  rendered="#{!CompareWithPreviousRowBean['CountryId']}"/> </af:column> The CompareWithPreviousRowBean managed bean is defined in request scope and is a generic bean that can be used for all the tables in your application that needs this layout style. As you can see the bean is a Map-style bean where we pass in the name of the attribute that should be compared with the previous row. The get method in the bean that is called returns boolean false when the attribute has the same value in the same row. Here is the code of the get method:  public Object get(Object key) {   String attrName = (String) key;   boolean isSame = false;   // get the currently processed row, using row expression #{row}   JUCtrlHierNodeBinding row = (JUCtrlHierNodeBinding) resolveExpression(getRowExpression());   JUCtrlHierBinding tableBinding = row.getHierBinding();   int rowRangeIndex = row.getViewObject().getRangeIndexOf(row.getRow());   Object currentAttrValue = row.getRow().getAttribute(attrName);   if (rowRangeIndex > 0)   {     Object previousAttrValue = tableBinding.getAttributeFromRow(rowRangeIndex - 1, attrName);     isSame = currentAttrValue != null && currentAttrValue.equals(previousAttrValue);   }   else if (tableBinding.getRangeStart() > 0)   {     // previous row is in previous range, we create separate rowset iterator,     // so we can change the range start without messing up the table rendering which uses     // the default rowset iterator     int absoluteIndexPreviousRow = tableBinding.getRangeStart() - 1;     RowSetIterator rsi = null;     try     {       rsi = tableBinding.getViewObject().getRowSet().createRowSetIterator(null);       rsi.setRangeStart(absoluteIndexPreviousRow);       Row previousRow = rsi.getRowAtRangeIndex(0);       Object previousAttrValue = previousRow.getAttribute(attrName);       isSame = currentAttrValue != null && currentAttrValue.equals(previousAttrValue);     }     finally     {       rsi.closeRowSetIterator();     }   }   return isSame; } The row expression defaults to #{row} but this can be changed through the rowExpression  managed property of the bean.  You can download the sample application here.

    Read the article

  • [PHP] building html tables from query data... faster?

    - by Andrew Heath
    With my limited experience/knowledge I am using the following structure to generate HTML tables on the fly from MySQL queries: $c = 0; $t = count($results); $table = '<table>'; while ($c < $t) { $table .= "<tr><td>$results[0]</td><td>$results[1]</td> (etc etc) </tr>"; ++$c; } $table .= '</table>'; this works, obviously. But for tables with 300+ rows there is a noticeable delay in pageload while the script builds the table. Currently the maximum results list is only about 1,100 rows, and the wait isn't long, but there's clearly a wait. Are there other methods for outputting an HTML table that are faster than my WHILE loop? (PHP only please...)

    Read the article

  • Building html tables from query data... faster?

    - by Andrew Heath
    With my limited experience/knowledge I am using the following structure to generate HTML tables on the fly from MySQL queries: $c = 0; $t = count($results); $table = '<table>'; while ($c < $t) { $table .= "<tr><td>$results[0]</td><td>$results[1]</td> (etc etc) </tr>"; ++$c; } $table .= '</table>'; this works, obviously. But for tables with 300+ rows there is a noticeable delay in pageload while the script builds the table. Currently the maximum results list is only about 1,100 rows, and the wait isn't long, but there's clearly a wait. Are there other methods for outputting an HTML table that are faster than my WHILE loop? (PHP only please...)

    Read the article

  • Database Design Question

    - by deniz
    Hi, I am designing a database for a project. I have a table that has 10 columns, most of them are used whenever the table is accessed, and I need to add 3 more rows; View Count Thumbs Up (count) Thumbs Down (Count) which will be used on %90 of the queries when the table is accessed. So, my question is that whether it is better to break the table up and create new table which will have these 3 columns + Foreign ID, or just make it 13 columns and use no joins? Since these columns will be used frequently, I guess adding 3 more columns is better, but if I need to create 10 more columns which will be used %90 of the time, should I add them as well, or create a new table and use joins? I am not sure when to break the table if the columns are used very frequently. Do you have any suggestions? Thanks in advance,

    Read the article

  • select from multiple tables with different columns

    - by Qaiser Iftikhar
    Say I got this sql schema. Table Job: id,title, type, is_enabled Table JobFileCopy: job_id,from_path,to_path Table JobFileDelete: job_id, file_path Table JobStartProcess: job_id, file_path, arguments, working_directory There are many other tables with varying number of columns and they all got foreign key job_id which is linked to id in table Job. My questions: Is this the right approach? I don't have requirement to delete anything at anytime. I will require to select and insert mostly. Secondly, what is the best approach to get the list of jobs with relevant details from all the different tables in a single database hit? e.g I would like to select top 20 jobs with details, their details can be in any table (depends on column type in table Job) which I don't know until runtime. Thanks in advance. Regards,

    Read the article

< Previous Page | 36 37 38 39 40 41 42 43 44 45 46 47  | Next Page >