Search Results

Search found 13488 results on 540 pages for 'calculator date calculation'.

Page 403/540 | < Previous Page | 399 400 401 402 403 404 405 406 407 408 409 410  | Next Page >

• select rows with unidentical column values using R

  - by Bazon

  Hi Guys, I need to create a new data frame that excludes dams that appear in "dam1" and "dam2" columns on the same fosdate (fostering date). I tried df <- df[df$dam1!=df$dam2,] but did not work. Dam1 and dam2 are factors which are the ids's of mothers. my df: fosdate dam1 dam2 8/09/2009 2Z523 2Z523 30/10/2009 1W509 5C080 30/10/2009 1W509 5C640 30/10/2009 1W509 1W509 1/10/2009 1W311 63927 The new data frame that I need to get is: dfnew: fosdate dam1 dam2 30/10/2009 1W509 5C080 30/10/2009 1W509 5C640 1/10/2009 1W311 63927 Would appreciate any help! Bazon

  Read the article

• My Lucene queries only ever find one hit

  - by Bob

  I'm getting started with Lucene.Net (stuck on version 2.3.1). I add sample documents with this: Dim indexWriter = New IndexWriter(indexDir, New Standard.StandardAnalyzer(), True) Dim doc = Document() doc.Add(New Field("Title", "foo", Field.Store.YES, Field.Index.TOKENIZED, Field.TermVector.NO)) doc.Add(New Field("Date", DateTime.UtcNow.ToString, Field.Store.YES, Field.Index.TOKENIZED, Field.TermVector.NO)) indexWriter.AddDocument(doc) indexWriter.Close() I search for documents matching "foo" with this: Dim searcher = New IndexSearcher(indexDir) Dim parser = New QueryParser("Title", New StandardAnalyzer()) Dim Query = parser.Parse("foo") Dim hits = searcher.Search(Query) Console.WriteLine("Number of hits = " + hits.Length.ToString) No matter how many times I run this, I only ever get one result. Any ideas?

  Read the article

• What to Learn: Rails 1.2.4 -> Rails 3

  - by Saterus

  I've recently convinced my management that our outdated version of Rails is slowing us down enough to warrant an upgrade. The approach we're taking is to start a fresh project with current technology rather than a painful upgrade. Our requirements for the project have changed and this will be much easier. The biggest problem is actually that my knowledge of Rails is out of date. I've dealt only with Rails 1.2.4 while the rest of the world has moved on long ago. What topics have I missed by being buried in my work instead of keeping up with the current Rails fashion? I'm hesitant to dig through blogs at random because I'm not sure how much has changed between the intervening versions of Rails. It's no use to learn Rails 2.1-2.3 specific stuff that is no longer useful for Rails 3.

  Read the article

• A good approach to db planing for reporting service

  - by Itay Moav

  The scenario: Big system (~200 tables). 60,000 users. Complex reports that will require me to do multiple queries for each report and even those will be complex queries with inner queries all over the place + some processing in PHP. I have seen an approach, which I am not sure about: Having one centralized, de-normalized, table that registers any activity in the system which is reportable. This table will hold mostly foreign keys, so she should be fairly compact and fast. So, for example (My system is a virtual learning management system), A user enrolls to course, the table stores the user id, date, course id, organization id, activity type (enrollment). Of course I also store this data in a normalized DB, which the actual application uses. Pros I see: easy, maintainable queries and code to process data and fast retrieval. Cons: there is a danger of the de-normalized table to be out of sync with the real DB. Is this approach worth considering, or (preferably from experience) is total $#%#%t?

  Read the article

• How to match this with a regex?

  - by andrei miko

  I just wanna use a regex to match something from my products file. I have them in this way "Something here","a link here","website here","date here(eg. 11/12/2012)","description1 here","**description2 here**","some other text here","here also", and so on ... I wanna match with a regex only description 2. I tried this: (?<=[0-9][0-9][0-9][0-9]).*(?=",") but it wasn't good because it was getting me description1, description2 and some quotes also. Thanks in advance.

  Read the article

• What Web design tool would make a good CityDesk replacement?

  - by Joshua Fox

  I am looking for a tool for building static template-based web sites, your typical brochure-ware for a non-profit or a personal site. I have used CityDesk, but that is out-of-date, unsupported, and has certain problems. Of course there are lots of tools out there, but I cannot find anything similar to CityDesk: WYSIWYG as well as HTML coding a templating system not overdesigned like, say, Dreamweaver built for developers who understand HTML/JS/CSS but easier to use than hand-coding of PHP, Ruby, or other templates in a text editor supporting the editing of pages by non-developers preferably free I'd also like it to be CSS-aware; and to have lots of free templates available. Or alternatively, static template-based sites are often developed nowadays on the Web using a CMS like Django; is that the way to go? Edit: Namo, DreamWeaver, NetObjects Fusion, Coffee Cup, Evrsoft First Page, and Microsoft Expression might be candidates. I'll appreciate comments on these based on the criteria above.

  Read the article

• MySQL easy question CURDATE()

  - by Tristan

  I want to compare two results one is stored in the first query, and the other is exactly the same as the first, but i want only to recieve data < today "SELECT s.GSP_nom as nom, timestamp, COUNT(s.GSP_nom) as nb_votes, AVG(v.vote+v.prix+v.serviceClient+v.interface+v.interface+v.services)/6 as moy FROM votes_serveur AS v INNER JOIN serveur AS s ON v.idServ = s.idServ WHERE s.valide = 1 AND v.date < CURDATE() ROUP BY s.GSP_nom HAVING nb_votes > 9 ORDER BY moy DESC LIMIT 0,15"; is that correct ? thank you

  Read the article

• How to model dependency injection in UML ?

  - by hjo1620

  I have a Contract class. The contract is valid 1 Jan 2010 - 31 Dec 2010. It can be in state Active or Passive, depending on which date I ask the instance for it's state. ex. if I ask 4 July 2010, it's in state Active, but if I ask 1 Jan 2011, it's in state Passive. Instances are created using constructor dependency injection, i.e. they are either Active or Passive already when created, null is not allowed as a parameter for the internal state member. One initial/created vertex is drawn in UML. I have two arrows, leading out from the initial vertex, one leading to state Active and the other to state Passive. Is this a correct representation of dependency injection in UML ? This is related to http://stackoverflow.com/questions/2779922/how-model-statemachine-when-state-is-dependent-on-a-function which initiated the question on how to model DI in general, in UML.

  Read the article

• Group MySQL Data into Arbitrarily Sized Time Buckets

  - by Eric J.

  How do I count the number of records in a MySQL table based on a timestamp column per unit of time where the unit of time is arbitrary? Specifically, I want to count how many record's timestamps fell into 15 minute buckets during a given interval. I understand how to do this in buckets of 1 second, 1 minute, 1 hour, 1 day etc. using MySQL date functions, e.g. SELECT YEAR(datefield) Y, MONTH(datefield) M, DAY(datefield) D, COUNT(*) Cnt FROM mytable GROUP BY YEAR(datefield), MONTH(datefield), DAY(datefield) but how can I group by 15 minute buckets?

  Read the article

• Comparing an id to id of different tables rows mysql

  - by jett

  So I am trying to retrieve all interests from someone, and be able to list them. This works with the following query. SELECT *,( SELECT GROUP_CONCAT(interest_id SEPARATOR ",") FROM people_interests WHERE person_id = people.id ) AS interests FROM people WHERE id IN ( SELECT person_id FROM people_interests WHERE interest_id = '.$site->db->clean($_POST['showinterest_id']).' ) ORDER BY lastname, firstname In this one which I am having trouble with, I want to select only those who happen to have their id in the table named volleyballplayers. The table just has an id, person_id, team_id, and date fields. SELECT *,( SELECT GROUP_CONCAT(interest_id SEPARATOR ",") FROM people_interests WHERE person_id = people.id ) AS interests FROM people WHERE id IN ( SELECT person_id FROM people_interests WHERE volleyballplayers.person_id = person_id ) ORDER BY lastname, firstname I just want to make sure that only the people who are in the volleyballplayers table show up, but I am getting an error saying that Unknown column 'volleyballplayers.person_id' in 'where clause' although I am quite sure of the name of table and I know the column is named person_id.

  Read the article

• Customising Symfony Admin Generator Form

  - by Rich

  Hi, I've generated the backend of my application, and am now just 'jazzing' the forms up (adding correct labels, validation rules etc). One thing I'd like to do is add a map (Google) which updates the marker as an address is entered into the form, then allows the user to drag it to correct the lat/lng should it be a little off. My question is, how can I customise the output of the form - I've read the docs (1.0,1.1,1.2 also) and it all seems very confusing. Customising forms not generated with the admin generator I know how to do using renderRow(); etc; but finding a way to add a little bit of HTML to the forms is making my eyes hurt! There's so much out of date stuff on the web regarding Symfony it's hard to know what to trust! If anyone can point me in the right direction that'd be great. Best Regards, Rich

  Read the article

• Data access strategy for a site like SO - sorted SQL queries and simultaneous updates that affect th

  - by Kaleb Brasee

  I'm working on a Grails web app that would be similar in access patterns to StackOverflow or MyLifeIsAverage - users can vote on entries, and their votes are used to sort a list of entries based on the number of votes. Votes can be placed while the sorted select queries are being performed. Since the selects would lock a large portion of the table, it seems that normal transaction locking would cause updates to take forever (given enough traffic). Has anyone worked on an app with a data access pattern such as this, and if so, did you find a way to allow these updates and selects to happen more or less concurrently? Does anyone know how sites like SO approach this? My thought was to make the sorted selects dirty reads, since it is acceptable if they're not completely up to date all of the time. This is my only idea for possibly improving performance of these selects and updates, but I thought someone might know a better way.

  Read the article

• Cannot execute cut-n-paste VBScripts

  - by IcedDante

  I have been going mad trying to figure out why my scripts weren't working, until I started copying and pasting sample source code directly from a few websites only to have it fail there as well. I am getting the following error in my VBScripts: C:\temp\vbs\script.vbs(19, 53) Microsoft VBScript compilation error: Expected statement' For a line of code that looks like this: wdoc.Application.Selection.Find.Execute Replace:=wdReplaceAll This is interfacing with Microsft Word in Office 2007 to conduct a search and replace. Index 53 point directly to the := part of the assignment. Since this type of syntax doesn't work on my machine and I am using it from several websites, I was wondering if the cscript.exe I use is out of date. Am I not calling cscript properly?

  Read the article

• In Ruby Compare 2 lines in a log file which BOTH contain the SAME "WORD" but ONLY print out the line

  - by kamal

  here are sample lines Apr 9 11:53:26 skip [2244]: [2244] ab-cd-ef:cc [INFO] A recoverable error has occurred some other log lines .. .... Apr 9 12:53:26 skip [2244]: [2244] ab-cd-ef:cc [INFO] A recoverable error has occurred now the LATEST line would have to be one with the latest Date String, and THAT is the one that needs to be printed, plus the NEXT time the parser runs on the log file, somehow the previous LATEST line has to be compared with the Existing latest one, and it CAN e the case, that NOTHING Changed and the OLD line is STILL the latest one, OR there is a NEW line, but ONLY the NEW log line should be printed and NOT if there is NO NEW log Entry.

  Read the article

• Javascript alert instead of redirect in PHP mail script

  - by JCHASE11

  Thanks to Col. Shrapnel I am using a VERY basic PHP script to send emails. The form is located here. This is the script: <?php mail('[email protected]','Live Date Submission',implode("\n\n",$_POST)); header("Location: thankyou.html"); ?> When a user submits the form, they are redirected to a thankyou.html page. I want to edit the code to display a javascript alert, instead of a redirect. I don't have much PHP knowledge, so how would I edit this code to return a alert instead of a redirect?

  Read the article

• Using now() in a <asp:textbox>

  - by Anthony

  Can anyone help. I am using a formview in VS 2005. I have different elements in my form databound to a database and I am performing an INSERT SQL statement. No problem. The problem is that I am trying to enter the current date into the SQL statement and I am having a problem. I can add <%now()% to the "Text" property of the asp:Textbox. But when I do, then I can't bind the textbox to a specific database column. How do I do both???? I can do this: <asp:TextBox ID="TextBox2" runat="server" Text='<%# Bind("Initiate_Date") %>' ></asp:TextBox> Or this: <asp:TextBox ID="TextBox2" runat="server" Text='<%# now() %>' ></asp:TextBox> But I don't know how to do both.

  Read the article

• how to fetch a range of files from an FTP server using C#

  - by user260076

  hello all, i'm stuck at a point where i am using a wildcard parameter with the FtpWebRequest object as suck FtpWebRequest reqFTP = (FtpWebRequest)FtpWebRequest.Create(new Uri("ftp://" + ftpServerIP + "/" + WildCard)); now this works fine, however i now want to fetch a specific range of files. say the file naming structure is *YYYYMMDD.* and i need to fetch all the files prior to today's date. i've been searching for a wildcard pattern for that with no good results, one that will work in a simple file listing. and it doesn't look like i can use regex here. any thoughts ?

  Read the article

• Excel isn't reading sql exported csv properly

  - by mhopkins321

  I have a batch file that calls sqlcmd to run a command and then export the data as a csv. When viewed in a cell the trasancted date for example shows 35:30.0 but if you click on it the formula bar shows 1/1/1900 2:45:00 PM. I need the full timestamp to show in the cell. Any ideas? The batch file is the following sqlcmd -S server -U username -P password -d database -i "D:\path\sqlScript.sql" -s "," > D:\path\report.csv -I -W -k 1 The script is the following. Now I currently have them cast as varchars, but that's simply because i've tried to change it a bit. Varchar doesn't work either. SET NOCOUNT ON; select top(10)BO.Status, cast(tradeDate AS varchar) AS Trade_Date, CAST(closingTime AS varchar) AS Closing_Time, CAST(openingTime AS varchar) AS openingTime FROM GIANT COMPLICATED JOINS OF ALL SORTS OF TABLES

  Read the article

• SSRS and hiding other selections once a parameter is selected

  - by KristiLee

  I am learning SSRS so this is probably an extremely easy solution. I have a bunch of reports that were rebuilt to match some old Access reports. For each report, we have to be able to run Current, Last, Next or Adhoc dates. Is there an easy way if a user selects Adhoc to then show the parameters selections for Start and End Date for the Adhoc selection? Right now, I have people who select Current and then go and put in dates. WHERE (:AGNT='--AllNoFilter--' OR AGNT =:AGNT) AND (:DateRunOption <> 'CM' OR TO_CHAR(MONTH_END_DT, 'Month YYYY') = TO_CHAR(CURRENT_DATE, 'Month YYYY')) AND (:DateRunOption <> 'LM' OR TO_CHAR(MONTH_END_DT, 'Month YYYY') = TO_CHAR(ADD_MONTHS(CURRENT_DATE, -1), 'Month YYYY')) AND (:DateRunOption <> 'AD' OR MONTH_END_DT>= :BeginDateFrom) AND (:DateRunOption <> 'AD' OR MONTH_END_DT<= :BeginDateTo) Thank you for any assistance you can provide

  Read the article

• postgres SQL - pg_class question

  - by Sachin Chourasiya

  PostgreSQL stores statistics about tables in the system table called pg_class. The query planner accesses this table for every query. These statistics may only be updated using the analyze command. If the analyze command is not run often, the statistics in this table may not be accurate and the query planner may make poor decisions which can degrade system performance. Another strategy is for the query planner to generate these statistics for each query (including selects, inserts, updates, and deletes). This approach would allow the query planner to have the most up-to-date statistics possible. Why postgres always rely on pg_class instead?

  Read the article

• Is there a method I can use across controllers and if so, how do I use it?

  - by Angela

  I have several controllers that take an instance of different classes each (Email, Call, Letter, etc) and they all have to go through this same substitution: @email.message.gsub!("{FirstName}", @contact.first_name) @email.message.gsub!("{Company}", @contact.company_name) @email.message.gsub!("{Colleagues}", @colleagues.to_sentence) @email.message.gsub!("{NextWeek}", (Date.today + 7.days).strftime("%A, %B %d")) @email.message.gsub!("{ContactTitle}", @contact.title ) So, for example, @call.message for Call, @letter.message for Letter, etcetera. This isn't very dry. I'd like to have something like def messagesub(asset) @asset.message.gsub.... end or something like that so I can just use messagesub method in each controller.

  Read the article

• Help with method logic in Java, hw

  - by Crystal

  I have a Loan class that in its printPayment method, it prints the amortization table of a loan for a hw assignment. We are also to implement a print first payment method, and a print last payment method. Since my calculation is done in the printPayment method, I didn't know how I could get the value in the first or last iteration of the loop and print that amount out. One way I can think of is to write a new method that might return that value, but I wasn't sure if there was a better way. Here is my code: public abstract class Loan { public void setClient(Person client) { this.client = client; } public Person getClient() { return client; } public void setLoanId() { loanId = nextId; nextId++; } public int getLoanId() { return loanId; } public void setInterestRate(double interestRate) { this.interestRate = interestRate; } public double getInterestRate() { return interestRate; } public void setLoanLength(int loanLength) { this.loanLength = loanLength; } public int getLoanLength() { return loanLength; } public void setLoanAmount(double loanAmount) { this.loanAmount = loanAmount; } public double getLoanAmount() { return loanAmount; } public void printPayments() { double monthlyInterest; double monthlyPrincipalPaid; double newPrincipal; int paymentNumber = 1; double monthlyInterestRate = interestRate / 1200; double monthlyPayment = loanAmount * (monthlyInterestRate) / (1 - Math.pow((1 + monthlyInterestRate),( -1 * loanLength))); System.out.println("Payment Number | Interest | Principal | Loan Balance"); // amortization table while (loanAmount >= 0) { monthlyInterest = loanAmount * monthlyInterestRate; monthlyPrincipalPaid = monthlyPayment - monthlyInterest; newPrincipal = loanAmount - monthlyPrincipalPaid; loanAmount = newPrincipal; System.out.printf("%d, %.2f, %.2f, %.2f", paymentNumber++, monthlyInterest, monthlyPrincipalPaid, loanAmount); } } /* //method to print first payment public double getFirstPayment() { } method to print last payment public double getLastPayment() { }*/ private Person client; private int loanId; private double interestRate; private int loanLength; private double loanAmount; private static int nextId = 1; } Thanks!

  Read the article

• Add column from another table matching results from first MySQL query

  - by Nemi

  This is my query for available rooms in choosen period: SELECT rooms.room_id FROM rooms WHERE rooms.room_id NOT IN ( SELECT reservations.room_id FROM reservations WHERE ( reservations.arrivaldate >= $arrival_datetime AND reservations.departuredate <= $departure_datetime) OR ( reservations.arrivaldate <= $arrival_datetime AND reservations.departuredate >= $arrival_datetime ) OR ( reservations.arrivaldate <= $departure_datetime AND reservations.departuredate >= $departure_datetime ) ); How to add average room price column for selected period(from $arrival_datetime to $departure_datetime) from another table (room_prices_table), for every room_id returned from above query. So I need to look in columns whos name is same as room_id... room_prices_table: date room0001 room0002 room0003 ... Something like SELECT AVG(room0003) FROM room_prices_table WHERE datum IS BETWEEN $arrival_datetime AND $departure_datetime ??

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Storing day and month (without year)

  - by Sasha

  I'm having trouble with figuring out the best way to store some data in my database. I've got to store DD/MM dates in a database, but I'm not sure of the best way to store this so that it can be easily sorted and searched. Basically a user will be able to save important dates in the format DD/MM, which they will be reminded of closer to the day. The DATE data type doesn't seem completely appropriate as it includes year, but I can't think of another way of storing this data. It would be possible to include a specific year to the end of all occasions, but this almost doesn't seem right.

  Read the article

< Previous Page | 399 400 401 402 403 404 405 406 407 408 409 410  | Next Page >