Search Results

Search found 13488 results on 540 pages for 'calculator date calculation'.

Page 403/540 | < Previous Page | 399 400 401 402 403 404 405 406 407 408 409 410  | Next Page >

• What to Learn: Rails 1.2.4 -> Rails 3

  - by Saterus

  I've recently convinced my management that our outdated version of Rails is slowing us down enough to warrant an upgrade. The approach we're taking is to start a fresh project with current technology rather than a painful upgrade. Our requirements for the project have changed and this will be much easier. The biggest problem is actually that my knowledge of Rails is out of date. I've dealt only with Rails 1.2.4 while the rest of the world has moved on long ago. What topics have I missed by being buried in my work instead of keeping up with the current Rails fashion? I'm hesitant to dig through blogs at random because I'm not sure how much has changed between the intervening versions of Rails. It's no use to learn Rails 2.1-2.3 specific stuff that is no longer useful for Rails 3.

  Read the article

• Android strace in Real device

  - by Martin Solac

  I have the following situation, I want to monitor the system calls on Android phones so I made an script to do that. With Android Emulator works perfectly (writes the traces of the application in a specific file on my Ubuntu). The problem is when I attach a real phone to analyze it, it says the following in the result file: ptrace attach failed: Operation not permitted I'm using this code to get it, but I don't understand why it works on the emulator and not in the rooted real device. This is the comand I use in perl: system("$dirTools/adb -s $Device shell strace -p $PID[1]>$dirRecordDataSet/$Date/$appName &"); Any suggestion? Thanks in advance

  Read the article

• Converting datetime.ctime() values to Unicode

  - by Malcolm

  I would like to convert datetime.ctime() values to Unicode. Using Python 2.6.4 running under Windows I can set my locale to Spanish like below: import locale locale.setlocale(locale.LC_ALL, 'esp' ) Then I can pass %a, %A, %b, and %B to ctime() to get day and month names and abbreviations. import datetime dateValue = datetime.date( 2010, 5, 15 ) dayName = dateValue.strftime( '%A' ) dayName 's\xe1bado' How do I convert the 's\xe1bado' value to Unicode? Specifically what encoding do I use? I'm thinking I might do something like the following, but I'm not sure this is the right approach. codePage = locale.getdefaultlocale()[ 1 ] dayNameUnicode = unicode( dayName, codePage ) dayNameUnicode u's\xe1bado' Malcolm

  Read the article

• How to query_posts after the current timestamp and sort reverse chronologically?

  - by Jody Heavener

  I am using the following code in Wordpress to query events (custom post type) and order them by date chronologically.. query_posts( array( 'post_type' => 'events', 'showposts' => 10, 'orderby' => 'meta_value_num','meta_key' => '_ecmb_datetime' ) ); Where the meta key _ecmb_datetime is, this is the timestamp of the event. I don't want to show events that have already happened, so my question is how do I only show events happening after my current time, and how do I sort reverse chronologically? Any help is greatly appreciated

  Read the article

• How to match this with a regex?

  - by andrei miko

  I just wanna use a regex to match something from my products file. I have them in this way "Something here","a link here","website here","date here(eg. 11/12/2012)","description1 here","**description2 here**","some other text here","here also", and so on ... I wanna match with a regex only description 2. I tried this: (?<=[0-9][0-9][0-9][0-9]).*(?=",") but it wasn't good because it was getting me description1, description2 and some quotes also. Thanks in advance.

  Read the article

• Unique number generation with Java Server Faces

  - by Buddhika Ariyaratne

  I am developing an application for a medical channelling centre where multiple users reserve bookings for doctors with JSF and JPA. A sequence number is unique to the Doctor, Date and Session. I tried to get a unique sequence number from counting the previous bookings and add one, but if two requests comes at the same time, two bookings get the same number causing trouble to functionality. How can I get unique number in this case? Can I use an application wide bean to generate it? (I thought it is not practicle to get the unique number from the database sequence number as there are several doctors, sessions and daily they have to have different booking number.)

  Read the article

• How to model dependency injection in UML ?

  - by hjo1620

  I have a Contract class. The contract is valid 1 Jan 2010 - 31 Dec 2010. It can be in state Active or Passive, depending on which date I ask the instance for it's state. ex. if I ask 4 July 2010, it's in state Active, but if I ask 1 Jan 2011, it's in state Passive. Instances are created using constructor dependency injection, i.e. they are either Active or Passive already when created, null is not allowed as a parameter for the internal state member. One initial/created vertex is drawn in UML. I have two arrows, leading out from the initial vertex, one leading to state Active and the other to state Passive. Is this a correct representation of dependency injection in UML ? This is related to http://stackoverflow.com/questions/2779922/how-model-statemachine-when-state-is-dependent-on-a-function which initiated the question on how to model DI in general, in UML.

  Read the article

• Using new Image().src for click tracking

  - by razass

  I am attempting to figure out why this click tracker isn't working. The code was written by another developer so I am not entirely sure if this ever did work. function trackSponsor(o, p) { (new Image()).src = PATH_BASE + 'click/' + p + '/' + o + "?_cache=" + (+(new Date())); return false; } From what I can gather is that when this function is called it 'creates a new image' to fire a php script asynchronously. According to Firebug, the request is made however it is 'aborted' ~30ms in. The odd thing is that it will 'sometimes' work as in 1 in every 10+ regardless of the browser. I would much rather fix this so that it works instead of re-writing it as an ajax request. Any help is appreciated. Thanks in advance.

  Read the article

• Customising Symfony Admin Generator Form

  - by Rich

  Hi, I've generated the backend of my application, and am now just 'jazzing' the forms up (adding correct labels, validation rules etc). One thing I'd like to do is add a map (Google) which updates the marker as an address is entered into the form, then allows the user to drag it to correct the lat/lng should it be a little off. My question is, how can I customise the output of the form - I've read the docs (1.0,1.1,1.2 also) and it all seems very confusing. Customising forms not generated with the admin generator I know how to do using renderRow(); etc; but finding a way to add a little bit of HTML to the forms is making my eyes hurt! There's so much out of date stuff on the web regarding Symfony it's hard to know what to trust! If anyone can point me in the right direction that'd be great. Best Regards, Rich

  Read the article

• how to fetch a range of files from an FTP server using C#

  - by user260076

  hello all, i'm stuck at a point where i am using a wildcard parameter with the FtpWebRequest object as suck FtpWebRequest reqFTP = (FtpWebRequest)FtpWebRequest.Create(new Uri("ftp://" + ftpServerIP + "/" + WildCard)); now this works fine, however i now want to fetch a specific range of files. say the file naming structure is *YYYYMMDD.* and i need to fetch all the files prior to today's date. i've been searching for a wildcard pattern for that with no good results, one that will work in a simple file listing. and it doesn't look like i can use regex here. any thoughts ?

  Read the article

• Group MySQL Data into Arbitrarily Sized Time Buckets

  - by Eric J.

  How do I count the number of records in a MySQL table based on a timestamp column per unit of time where the unit of time is arbitrary? Specifically, I want to count how many record's timestamps fell into 15 minute buckets during a given interval. I understand how to do this in buckets of 1 second, 1 minute, 1 hour, 1 day etc. using MySQL date functions, e.g. SELECT YEAR(datefield) Y, MONTH(datefield) M, DAY(datefield) D, COUNT(*) Cnt FROM mytable GROUP BY YEAR(datefield), MONTH(datefield), DAY(datefield) but how can I group by 15 minute buckets?

  Read the article

• SSRS and hiding other selections once a parameter is selected

  - by KristiLee

  I am learning SSRS so this is probably an extremely easy solution. I have a bunch of reports that were rebuilt to match some old Access reports. For each report, we have to be able to run Current, Last, Next or Adhoc dates. Is there an easy way if a user selects Adhoc to then show the parameters selections for Start and End Date for the Adhoc selection? Right now, I have people who select Current and then go and put in dates. WHERE (:AGNT='--AllNoFilter--' OR AGNT =:AGNT) AND (:DateRunOption <> 'CM' OR TO_CHAR(MONTH_END_DT, 'Month YYYY') = TO_CHAR(CURRENT_DATE, 'Month YYYY')) AND (:DateRunOption <> 'LM' OR TO_CHAR(MONTH_END_DT, 'Month YYYY') = TO_CHAR(ADD_MONTHS(CURRENT_DATE, -1), 'Month YYYY')) AND (:DateRunOption <> 'AD' OR MONTH_END_DT>= :BeginDateFrom) AND (:DateRunOption <> 'AD' OR MONTH_END_DT<= :BeginDateTo) Thank you for any assistance you can provide

  Read the article

• Using now() in a <asp:textbox>

  - by Anthony

  Can anyone help. I am using a formview in VS 2005. I have different elements in my form databound to a database and I am performing an INSERT SQL statement. No problem. The problem is that I am trying to enter the current date into the SQL statement and I am having a problem. I can add <%now()% to the "Text" property of the asp:Textbox. But when I do, then I can't bind the textbox to a specific database column. How do I do both???? I can do this: <asp:TextBox ID="TextBox2" runat="server" Text='<%# Bind("Initiate_Date") %>' ></asp:TextBox> Or this: <asp:TextBox ID="TextBox2" runat="server" Text='<%# now() %>' ></asp:TextBox> But I don't know how to do both.

  Read the article

• Cannot execute cut-n-paste VBScripts

  - by IcedDante

  I have been going mad trying to figure out why my scripts weren't working, until I started copying and pasting sample source code directly from a few websites only to have it fail there as well. I am getting the following error in my VBScripts: C:\temp\vbs\script.vbs(19, 53) Microsoft VBScript compilation error: Expected statement' For a line of code that looks like this: wdoc.Application.Selection.Find.Execute Replace:=wdReplaceAll This is interfacing with Microsft Word in Office 2007 to conduct a search and replace. Index 53 point directly to the := part of the assignment. Since this type of syntax doesn't work on my machine and I am using it from several websites, I was wondering if the cscript.exe I use is out of date. Am I not calling cscript properly?

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Excel isn't reading sql exported csv properly

  - by mhopkins321

  I have a batch file that calls sqlcmd to run a command and then export the data as a csv. When viewed in a cell the trasancted date for example shows 35:30.0 but if you click on it the formula bar shows 1/1/1900 2:45:00 PM. I need the full timestamp to show in the cell. Any ideas? The batch file is the following sqlcmd -S server -U username -P password -d database -i "D:\path\sqlScript.sql" -s "," > D:\path\report.csv -I -W -k 1 The script is the following. Now I currently have them cast as varchars, but that's simply because i've tried to change it a bit. Varchar doesn't work either. SET NOCOUNT ON; select top(10)BO.Status, cast(tradeDate AS varchar) AS Trade_Date, CAST(closingTime AS varchar) AS Closing_Time, CAST(openingTime AS varchar) AS openingTime FROM GIANT COMPLICATED JOINS OF ALL SORTS OF TABLES

  Read the article

• Javascript alert instead of redirect in PHP mail script

  - by JCHASE11

  Thanks to Col. Shrapnel I am using a VERY basic PHP script to send emails. The form is located here. This is the script: <?php mail('[email protected]','Live Date Submission',implode("\n\n",$_POST)); header("Location: thankyou.html"); ?> When a user submits the form, they are redirected to a thankyou.html page. I want to edit the code to display a javascript alert, instead of a redirect. I don't have much PHP knowledge, so how would I edit this code to return a alert instead of a redirect?

  Read the article

• postgres SQL - pg_class question

  - by Sachin Chourasiya

  PostgreSQL stores statistics about tables in the system table called pg_class. The query planner accesses this table for every query. These statistics may only be updated using the analyze command. If the analyze command is not run often, the statistics in this table may not be accurate and the query planner may make poor decisions which can degrade system performance. Another strategy is for the query planner to generate these statistics for each query (including selects, inserts, updates, and deletes). This approach would allow the query planner to have the most up-to-date statistics possible. Why postgres always rely on pg_class instead?

  Read the article

• Is there a method I can use across controllers and if so, how do I use it?

  - by Angela

  I have several controllers that take an instance of different classes each (Email, Call, Letter, etc) and they all have to go through this same substitution: @email.message.gsub!("{FirstName}", @contact.first_name) @email.message.gsub!("{Company}", @contact.company_name) @email.message.gsub!("{Colleagues}", @colleagues.to_sentence) @email.message.gsub!("{NextWeek}", (Date.today + 7.days).strftime("%A, %B %d")) @email.message.gsub!("{ContactTitle}", @contact.title ) So, for example, @call.message for Call, @letter.message for Letter, etcetera. This isn't very dry. I'd like to have something like def messagesub(asset) @asset.message.gsub.... end or something like that so I can just use messagesub method in each controller.

  Read the article

• Storing day and month (without year)

  - by Sasha

  I'm having trouble with figuring out the best way to store some data in my database. I've got to store DD/MM dates in a database, but I'm not sure of the best way to store this so that it can be easily sorted and searched. Basically a user will be able to save important dates in the format DD/MM, which they will be reminded of closer to the day. The DATE data type doesn't seem completely appropriate as it includes year, but I can't think of another way of storing this data. It would be possible to include a specific year to the end of all occasions, but this almost doesn't seem right.

  Read the article

• List hits per hour from a MySQL table

  - by Axel

  I am trying to work out the hits per hour from a database. Data basically is stored as follows (with other columns) : Table Name: Hits ============================ VisitorIP TIMESTAMP ---------------------------- 15.215.65.65 123456789 I want to display total hits per hour (within the last 6 hours ) including the hours that has no hits. Example of the output: // Assuming now : 21:00 21:00 - 0 hits 20:00 - 1 hits 19:00 - 4 hits 18:00 - 0 hits 17:00 - 2 hits 16:00 - 3 hits i would love to get the data as array, Please note that the stored date is in UNIX time stamp format. and there may be some hours without any hits! Thanks

  Read the article

• a query is inserted from PHPMYAdmin but not from PHP

  - by iyad al aqel

  i'm writing a php code to insert form values in a forum values $dbServer = mysql_connect("localhost" , "root", "") ; if(!$dbServer) die ("Unable to connect"); mysql_select_db("kfumWonder"); $name= $_POST['name'] ; $password= md5($_POST['password']); $email= $_POST['email'] ; $major= $_POST['major'] ; $dateOfBirth=$_POST['dateOfBirth'] ; $webSite = $_POST['website']; $joinDate= date("Y m d") ; $query = "INSERT INTO user (name, password, email, major, dob, website, join_date) Values ('$name', '$password', '$email', '$major', '$dateOfBirth', '$webSite' , '$joinDate')" ; //echo $query ; $result = mysql_query($query) ; if (! $result ) echo " no results " ; this works perfectly fine when i took the printed query and run it in PHPMyAdmin but when i run this code nothing happens , any ideas !?

  Read the article

• Add column from another table matching results from first MySQL query

  - by Nemi

  This is my query for available rooms in choosen period: SELECT rooms.room_id FROM rooms WHERE rooms.room_id NOT IN ( SELECT reservations.room_id FROM reservations WHERE ( reservations.arrivaldate >= $arrival_datetime AND reservations.departuredate <= $departure_datetime) OR ( reservations.arrivaldate <= $arrival_datetime AND reservations.departuredate >= $arrival_datetime ) OR ( reservations.arrivaldate <= $departure_datetime AND reservations.departuredate >= $departure_datetime ) ); How to add average room price column for selected period(from $arrival_datetime to $departure_datetime) from another table (room_prices_table), for every room_id returned from above query. So I need to look in columns whos name is same as room_id... room_prices_table: date room0001 room0002 room0003 ... Something like SELECT AVG(room0003) FROM room_prices_table WHERE datum IS BETWEEN $arrival_datetime AND $departure_datetime ??

  Read the article

• Auto-generated values for columns in database

  - by Jamal

  Is it a good practice to initialize columns that we can know their values in database, for example identity columns of type unique identifier can have a default value (NEWID()), or columns that shows the record create date can have a default value (GETDATE()). Should I go through all my tables and do this whereever I am sure that I won't need to assign the value manually and the Auto-generated value is correct. I am also thinking about using linq-to-sql classes and setting the "Auto Generated Value" property of these columns to true. Maybe this is what everybody already knows or maybe I am asking a question about a fundamental issue, if so please tell me.

  Read the article

• In Ruby Compare 2 lines in a log file which BOTH contain the SAME "WORD" but ONLY print out the line

  - by kamal

  here are sample lines Apr 9 11:53:26 skip [2244]: [2244] ab-cd-ef:cc [INFO] A recoverable error has occurred some other log lines .. .... Apr 9 12:53:26 skip [2244]: [2244] ab-cd-ef:cc [INFO] A recoverable error has occurred now the LATEST line would have to be one with the latest Date String, and THAT is the one that needs to be printed, plus the NEXT time the parser runs on the log file, somehow the previous LATEST line has to be compared with the Existing latest one, and it CAN e the case, that NOTHING Changed and the OLD line is STILL the latest one, OR there is a NEW line, but ONLY the NEW log line should be printed and NOT if there is NO NEW log Entry.

  Read the article

< Previous Page | 399 400 401 402 403 404 405 406 407 408 409 410  | Next Page >