Search Results

Search found 13488 results on 540 pages for 'calculator date calculation'.

Page 405/540 | < Previous Page | 401 402 403 404 405 406 407 408 409 410 411 412  | Next Page >

• making sure "expiration_date - X" falls on a valid "date_of_price" (if not, use the next valid date_

  - by bobbyh

  I have two tables. The first table has two columns: ID and date_of_price. The date_of_price field skips weekend days and bank holidays when markets are closed. table: trading_dates ID date_of_price 1 8/7/2008 2 8/8/2008 3 8/11/2008 4 8/12/2008 The second table also has two columns: ID and expiration_date. The expiration_date field is the one day in each month when options expire. table: expiration_dates ID expiration_date 1 9/20/2008 2 10/18/2008 3 11/22/2008 I would like to do a query that subtracts a certain number of days from the expiration dates, with the caveat that the resulting date must be a valid date_of_price. If not, then the result should be the next valid date_of_price. For instance, say we are subtracting 41 days from the expiration_date. 41 days prior to 9/20/2008 is 8/10/2008. Since 8/10/2008 is not a valid date_of_price, we have to skip 8/10/2008. The query should return 8/11/2008, which is the next valid date_of_price. Any advice would be appreciated! :-)

  Read the article

• Can I test for the end of the content of a text/plain file with Selenium or javascript?

  - by fool4jesus

  I have a page that results in a text/plain file being displayed in the browser that looks like this: ... Admin Site Administration 2010-04-21 22:26:34 [email protected] Test Site Bob Smith 2010-04-21 22:27:09 [email protected] Admin Site Administration 2010-04-21 22:29:26 [email protected] I am trying to write a Selenium test against this that verifies the last line of the file has "[email protected]" at the end. How would you do this? I can't depend on the date/time as this is a login report that is constantly getting updated - all I want is to ensure that the last line ends with that email address. And I can't figure out how to do it using Selenium expressions, DOM, or XPath.

  Read the article

• Storing day and month (without year)

  - by Sasha

  I'm having trouble with figuring out the best way to store some data in my database. I've got to store DD/MM dates in a database, but I'm not sure of the best way to store this so that it can be easily sorted and searched. Basically a user will be able to save important dates in the format DD/MM, which they will be reminded of closer to the day. The DATE data type doesn't seem completely appropriate as it includes year, but I can't think of another way of storing this data. It would be possible to include a specific year to the end of all occasions, but this almost doesn't seem right.

  Read the article

• How does Sentry aggregate errors?

  - by Hugo Rodger-Brown

  I am using Sentry (in a django project), and I'd like to know how I can get the errors to aggregate properly. I am logging certain user actions as errors, so there is no underlying system exception, and am using the culprit attribute to set a friendly error name. The message is templated, and contains a common message ("User 'x' was unable to perform action because 'y'"), but is never exactly the same (different users, different conditions). Sentry clearly uses some set of attributes under the hood to determine whether to aggregate errors as the same exception, but despite having looked through the code, I can't work out how. Can anyone short-cut my having to dig further into the code and tell me what properties I need to set in order to manage aggregation as I would like? [UPDATE 1: event grouping] This line appears in sentry.models.Group: class Group(MessageBase): """ Aggregated message which summarizes a set of Events. """ ... class Meta: unique_together = (('project', 'logger', 'culprit', 'checksum'),) ... Which makes sense - project, logger and culprit I am setting at the moment - the problem is checksum. I will investigate further, however 'checksum' suggests that binary equivalence, which is never going to work - it must be possible to group instances of the same exception, with differenct attributes? [UPDATE 2: event checksums] The event checksum comes from the sentry.manager.get_checksum_from_event method: def get_checksum_from_event(event): for interface in event.interfaces.itervalues(): result = interface.get_hash() if result: hash = hashlib.md5() for r in result: hash.update(to_string(r)) return hash.hexdigest() return hashlib.md5(to_string(event.message)).hexdigest() Next stop - where do the event interfaces come from? [UPDATE 3: event interfaces] I have worked out that interfaces refer to the standard mechanism for describing data passed into sentry events, and that I am using the standard sentry.interfaces.Message and sentry.interfaces.User interfaces. Both of these will contain different data depending on the exception instance - and so a checksum will never match. Is there any way that I can exclude these from the checksum calculation? (Or at least the User interface value, as that has to be different - the Message interface value I could standardise.) [UPDATE 4: solution] Here are the two get_hash functions for the Message and User interfaces respectively: # sentry.interfaces.Message def get_hash(self): return [self.message] # sentry.interfaces.User def get_hash(self): return [] Looking at these two, only the Message.get_hash interface will return a value that is picked up by the get_checksum_for_event method, and so this is the one that will be returned (hashed etc.) The net effect of this is that the the checksum is evaluated on the message alone - which in theory means that I can standardise the message and keep the user definition unique. I've answered my own question here, but hopefully my investigation is of use to others having the same problem. (As an aside, I've also submitted a pull request against the Sentry documentation as part of this ;-)) (Note to anyone using / extending Sentry with custom interfaces - if you want to avoid your interface being use to group exceptions, return an empty list.)

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• CompareValidator works in listview's editItemTemplate but not in insertitemtemplate

  - by Sam

  Hi, I have a validation problem I have a listview, in the edit item template I have two composite controls with a textbox inside I put a comparevalidator on it <asp:CompareValidator ID="myCompareValidator" runat="server" ControlToValidate="mycompositecontrol1" ControlToCompare="mycompositecontrol2" Operator="GreaterThanEqual" Type="Date" Display="Dynamic" ErrorMessage="there is an error !" Text="!" ValidationGroup="myValidationGroup" /> It works great ! so I do exactly the same operation in the InserItemTemplate (It's a copy/paste) but this time, it doesn't work, I have no error message in my validationsummary and near my control to validate! If you know that problem, help me please thanks in advance

  Read the article

• Offset time for DST in one specific timezone using JavaScript

  - by Shannon

  I need to offset the time by an hour if it's currently DST in the Pacific Time Zone. How can I determine the current daylight savings status of the Pacific Time Zone, regardless of the user's local timezone? Here's what I have so far. "dst" in line 4 is just a placeholder for a function that would tell me if daylight savings time is active in that zone. function checkTime() { var d = new Date(); var hour = d.getUTCHours(); var offset = dst ? 7 : 8; // is pacific time currently in daylight savings? // is it currently 6 AM, 2 PM, or 10 PM? if (hour === ((6 + offset) % 24) || hour === ((14 + offset) % 24) || hour === ((22 + offset) % 24)) { // do stuff } } checkTime();

  Read the article

• Facing a problem when i am making a setup of Windows Service.

  - by prateeksaluja20

  i am trying to make a setup of windows service.but when i was building the setup the output is like that.. ------ Build started: Project: TwitterService, Configuration: Debug Any CPU ------ TwitterService - C:\Users\Globus-n2\Desktop\LatestTweetMati\TwitterService\bin\Debug\TwitterService.exe ------ Starting pre-build validation for project 'Setup' ------ ------ Pre-build validation for project 'Setup' completed ------ ------ Build started: Project: Setup, Configuration: Debug ------ Building file 'C:\Users\Globus-n2\Desktop\LatestTweetMati\Setup\Debug\Setup.msi'... Packaging file 'TwitterService.exe.config'... Packaging file 'GlobusLib.dll'... Packaging file 'TwitterService.exe'... Packaging file 'GlobusTwitterLib.dll'... ========== Build: 1 succeeded or up-to-date, 1 failed, 0 skipped ========== setup is failed i am not getting any error.i have tried to make a new copy but still problem remain.i have tried to add those dll again but problem is not solved.can any one please help me to solve this problem.il really very thankful if any one try to solve this problem.

  Read the article

• how to fetch a range of files from an FTP server using C#

  - by user260076

  hello all, i'm stuck at a point where i am using a wildcard parameter with the FtpWebRequest object as suck FtpWebRequest reqFTP = (FtpWebRequest)FtpWebRequest.Create(new Uri("ftp://" + ftpServerIP + "/" + WildCard)); now this works fine, however i now want to fetch a specific range of files. say the file naming structure is *YYYYMMDD.* and i need to fetch all the files prior to today's date. i've been searching for a wildcard pattern for that with no good results, one that will work in a simple file listing. and it doesn't look like i can use regex here. any thoughts ?

  Read the article

• JSON DATA formatting in WebAPI

  - by user1736299

  public class CalendarController : ApiController { Events[] events = new Events[] { new Events { title= "event1", start = System.DateTime.UtcNow, end = System.DateTime.UtcNow }, new Events { title= "event2", start = System.DateTime.UtcNow, end = System.DateTime.UtcNow }, new Events { title= "event3", start = System.DateTime.UtcNow, end = System.DateTime.UtcNow} }; public IEnumerable<Events> GetAllCalendar() { return events; } The JSON result for the above is [{ "title": "event1", "start": "2012-12-05T22:52:35.6471712Z", "end": "2012-12-05T22:52:35.6471712Z"}, { "title": "event2", "start": "2012-12-05T22:52:35.6471712Z", "end": "2012-12-05T22:52:35.6471712Z"}, { "title": "event3", "start": "2012-12-05T22:52:35.6471712Z", "end": "2012-12-05T22:52:35.6471712Z" }]? How to create the same JSON result without the double quotes but single quote. How to get the date in the format of ‘YYYY-MM-DD HH:MM:SS’ Thank you, Smith

  Read the article

• git, how to I go back to origin master after pulling a branch

  - by fishtoprecords

  This has to be a FAQ, but I can't find it googling. Another person created a branch, commit'd to it, and pushed it to github using git push origin newbranch I successfully pulled it down using git pull origin newbranch Now, I want to go back to the origin master version. Nothing I do seems to cause the files in the origin master to replace those in the newbranch. git checkout master git checkout origin master git pull git pull origin HEAD etc git pull origin master returns: * branch master -> FETCH_HEAD Already up-to-date. This can't be hard, but I sure can't figure it out. 'git branch' returns * master and 'git branch -r' return origin/HEAD origin/experimental origin/master

  Read the article

• sql server replication algorithm.

  - by reggie

  Anyone know how the underlying replication model in sql server works? Do they essentially depend on UTC datetime values to determine if something is new or do they keep a table of all the changes (like a table of tableID+rowid that have changed). I am building my own "replication" system and was planning on using the dates to know what to replicate. Then I started wondering what would happen if the date got off in the computer for some reason. The obvious choice is to keep a log of the changes as you go and once you replicate those changes, you remove from the log of changes. But thats a lot of extra work, instead of just checking dates. I figure if sql server replication works by just checking the dates, then that should be good enough for me. Any wisdom here? thanks

  Read the article

• How to exclude results with get_object_or_404?

  - by googletorp

  In Django you can use the exclude to create SQL similar to not equal. An example could be. Model.objects.exclude(status='deleted') Now this works great and exclude is very flexible. Since I'm a bit lazy, I would like to get that functionality when using get_object_or_404, but I haven't found a way to do this, since you cannot use exclude on get_object_or_404. What I want is to do something like this: model = get_object_or_404(pk=id, status__exclude='deleted') But unfortunately this doesn't work as there isn't an exclude query filter or similar. The best I've come up with so far is doing something like this: object = get_object_or_404(pk=id) if object.status == 'deleted': return HttpResponseNotfound('text') Doing something like that, really defeats the point of using get_object_or_404, since it no longer is a handy one-liner. Alternatively I could do: object = get_object_or_404(pk=id, status__in=['list', 'of', 'items']) But that wouldn't be very maintainable, as I would need to keep the list up to date. I'm wondering if I'm missing some trick or feature in django to use get_object_or_404 to get the desired result?

  Read the article

• How to automate login to Google API to get OAuth 2.0 token to access known user account

  - by keyser_sozay

  Ok, so this question has been asked before here. In the response/answer to the question, the user tells him to store the token in the application (session and not db, although it doesn't matter where you store it). After going through the documentation on Google, it seems that the token has an expiration date after which it is no longer valid. Now, we could obviously automatically refresh the token every fixed interval, thereby prolonging the lifespan of the token, but for some reason, this manual process feels like a hack. My questions is: Is this most effective (/generally accepted) way to access google calendar/app data for a known user account by manually logging in and persisting the token in the application? Or is there another mechanism that allows us to programmatically login to this user account and go through the OAuth steps?

  Read the article

• Android strace in Real device

  - by Martin Solac

  I have the following situation, I want to monitor the system calls on Android phones so I made an script to do that. With Android Emulator works perfectly (writes the traces of the application in a specific file on my Ubuntu). The problem is when I attach a real phone to analyze it, it says the following in the result file: ptrace attach failed: Operation not permitted I'm using this code to get it, but I don't understand why it works on the emulator and not in the rooted real device. This is the comand I use in perl: system("$dirTools/adb -s $Device shell strace -p $PID[1]>$dirRecordDataSet/$Date/$appName &"); Any suggestion? Thanks in advance

  Read the article

• Data access strategy for a site like SO - sorted SQL queries and simultaneous updates that affect th

  - by Kaleb Brasee

  I'm working on a Grails web app that would be similar in access patterns to StackOverflow or MyLifeIsAverage - users can vote on entries, and their votes are used to sort a list of entries based on the number of votes. Votes can be placed while the sorted select queries are being performed. Since the selects would lock a large portion of the table, it seems that normal transaction locking would cause updates to take forever (given enough traffic). Has anyone worked on an app with a data access pattern such as this, and if so, did you find a way to allow these updates and selects to happen more or less concurrently? Does anyone know how sites like SO approach this? My thought was to make the sorted selects dirty reads, since it is acceptable if they're not completely up to date all of the time. This is my only idea for possibly improving performance of these selects and updates, but I thought someone might know a better way.

  Read the article

• Copy VSS structure to server with asp.net

  - by Tyzak

  i want to copy the structure (with the documents) from our vss server to an webserver. Therefore i want to create an application which is on this webserver. i want to use asp.net. i don't know what exactly i need therefore : I have to build somekind of connection? then go throw the structure and copy it somehow : ? important: i want to copy the documents with the right creation date ( it changes when i just copy the doc.) are there APIs for asp.net <- vss?

  Read the article

• Is it possible to create an efficient UDF alternative to Excel's CUBEVALUE function?

  - by bright

  We'd like to create a simpler alternative to Excel's CUBEVALUE function for retrieving data from an OLAP server. The details aren't critical, but briefly, our function will "know" the source connection and accept a very simple ticker-like parameter and a date, in place of CUBEVALUE's MDX-style parameters. This is for internal use within our firm, just FYI. However, Excel has optimized CUBEVALUE so that calls to the OLAP server are batched. Question: Is there a way to code the new function so that it can similarly batch calls rather than issue a separate query for each cell?

  Read the article

• Problem getting value from "Checkbox group value prompt"

  - by Veer

  Hi, I've value prompt with ui:checkbox group parameter: p_IsLastMonth Name: Prompt_IsLastMonth ItemCount: 1; UseValue:Yes, DisplayValue: LastMonth? and two Date Prompts. Whenever the checkbox is checked, the UseValue 'Yes' is passed to the parameter 'p_IsLastMonth'. But whenever the checkbox is left as it is, it results in an error. Element 'selectOptions' is not valid for content model: 'All(style,defaultSelections,conditionalStyles,conditionalRender,XMLAttributes)' I also tried giving a default value. But the default value has to be in the collection. But i want only one checkbox to be displayed. I tried with html checkbox. But i'm not able to send the value 'either yes or no' to the parameter through javascript because however the finish button overrides the value. Any help?

  Read the article

• Has anybody used the WB B-tree library?

  - by Chris B

  I stumbled across the WB on-disk B-tree library: http://people.csail.mit.edu/jaffer/WB It seems like it could be useful for my purposes (swapping data to disk during very large statistical calculations that do not fit in memory), but I was wondering how stable it is. Reading the manual, it seems worringly 'researchy' - there are sections labelled [NOT IMPLEMENTED] etc. But maybe the manual is just out-of-date. So, is this library useable? Am I better off looking at Tokyo Cabinet, MemcacheDB, etc.? By the way I am working in Java.

  Read the article

• What is the current standard for authenticating Http requests (REST, Xml over Http)?

  - by CodeToGlory

  The standard should solve the following Authentication challenges like- Replay attacks Man in the Middle Plaintext attacks Dictionary attacks Brute force attacks Spoofing by counterfeit servers I have already looked at Amazon Web Services and that is one possibility. More importantly there seems to be two most common approaches: Use apiKey which is encoded in a similar fashion like AWS but is a post parameter to a request Use Http AuthenticationHeader and use a similar signature like AWS. Signature is typically obtained by signing a date stamp with an encrypted shared secret. This signature is therefore passed either as an apiKey or in the Http AuthenticationHeader. I would like to know weigh both the options from the community, who may have used one or more and would also like to explore other options that I am not considering. I would also use HTTPS to secure my services.

  Read the article

• Sorting Objects in NSArray

  - by Sam Budda

  I have an NSArray with 3 objects in it. Each object is made up of 5 values. How can I sort by Date with in the objects? result: ( gg, "2012-10-28 01:34:00 +0000", "Church Bells", "pin_red", 1 )( iu, "2008-09-22 17:32:00 +0000", "Birthday Song", "pin_red", 1 )( "my birthday woo hoo", "2012-09-04 19:27:00 +0000", "Birthday Song", "pin_blue", 1 ) The results I am looking for - Sorted Array should look like this. ( iu, "2008-09-22 17:32:00 +0000", "Birthday Song", "pin_red", 1 ) ( "my birthday woo hoo", "2012-09-04 19:27:00 +0000", "Birthday Song", "pin_blue", 1 ) ( gg, "2012-10-28 01:34:00 +0000", "Church Bells", "pin_red", 1 ) I am getting this array from my nsdictionary object. dictionary = [[NSMutableDictionary alloc] initWithContentsOfFile:stringsPlistPath]; stringsMutableArray = [[NSMutableArray alloc] initWithObjects:nil]; for (id key in dictionary) { [stringsMutableArray addObject:[dictionary objectForKey:key]]; }

  Read the article

• Return nullable datetime from scalar, stored procedure

  - by molgan

  Hello I have a function that returns a date from a stored procedure, and it all works great til the value is NULL, how can I fix this so it works with null aswell? public DateTime? GetSomteDate(int SomeID) { DateTime? LimitDate= null; if (_entities.Connection.State == System.Data.ConnectionState.Closed) _entities.Connection.Open(); using (EntityCommand c = new EntityCommand("MyEntities.GetSomeDate", (EntityConnection)this._entities.Connection)) { c.CommandType = System.Data.CommandType.StoredProcedure; EntityParameter paramSomeID = new EntityParameter("SomeID", System.Data.DbType.Int32); paramSomeID.Direction = System.Data.ParameterDirection.Input; paramSomeID.Value = SomeID; c.Parameters.Add(paramSomeID); var x = c.ExecuteScalar(); if (x != null) LimitDate = (DateTime)x; return LimitDate.Value; }; }

  Read the article

• getting number of hours until the next event

  - by Andrew Heath

  I've got a table with this data: [ID] [event_name] [last_event] 1 stats 2011-01-01 01:47:32 last_event is a timestamp. The event occurs every 48 hours (it's a cron job). I'd like to show my users the number of hours until the event executes again. So far I've got: SELECT (lastFinish + INTERVAL 48 HOUR) FROM `cron_status` which gives me the exact time and date of the next occurence: 2011-01-03 01:47:32. So I figured if I subtracted the current datetime... SELECT ((lastFinish + INTERVAL 48 HOUR) - SYSDATE()) FROM `cron_status` which (I think?) gives me the difference in unix time: 1980015. But if I divide that by 3600 to convert the seconds to hours... SELECT (((lastFinish + INTERVAL 48 HOUR) - SYSDATE())/3600) FROM `cron_status` I get numbers an order of magnitude too high: 549.99. Where am I going wrong? The target is returning the number of hours until the next execution. Thank you!

  Read the article

• llvm/clang re-compilation with itself

  - by teppic

  After reading many questions on here, I decided to give clang a go, and installed the svn version on Ubuntu 12.04 (64bit). I was expecting issues, but it all installed smoothly with no warnings. I noticed though that when re-running the configure script, if clang/clang++ is in your path it will choose this over gcc/g++ for its own compilation. Is it a good idea to recompile llvm/clang with itself? I know this is absolutely standard with gcc, but I've read that clang's C++ implementation isn't quite good enough yet (maybe this is out of date info...).

  Read the article

< Previous Page | 401 402 403 404 405 406 407 408 409 410 411 412  | Next Page >