Search Results

Search found 11509 results on 461 pages for 'description logic'.

Page 422/461 | < Previous Page | 418 419 420 421 422 423 424 425 426 427 428 429  | Next Page >

  • 404 with spring 3

    - by markjason72
    hi I am going through my first lessons with spring 3.I created a dynamic web app in eclipse with the following structure. spring3mvc \src\my.spring.HelloWorldController.java \WebContent | |-----WEB-INF\jsp\hello.jsp |-----index.jsp |-----web.xml |-----WEB-INF\spring-servlet.xml |-----WEB-INF\lib\...*.jar files I created the spring-servlet.xml as below <context:component-scan base-package="my.spring" /> <bean id="viewResolver" class="org.springframework.web.servlet.view.UrlBasedViewResolver"> <property name="viewClass" value="org.springframework.web.servlet.view.JstlView" /> <property name="prefix" value="/WEB-INF/jsp/" /> <property name="suffix" value=".jsp" /> </bean> and coded the controller package my.spring; import org.springframework.stereotype.Controller; import org.springframework.web.bind.annotation.RequestMapping; import org.springframework.web.servlet.ModelAndView; @Controller public class HelloWorldController { @RequestMapping("/hello") public ModelAndView helloWorld() { String message = "Hello World, Spring 3.0!"; return new ModelAndView("hello", "message", message); } } index.jsp has a link to hello view <html> <body> <a href="hello.html">Say Hello</a> </body> </html> finally in hello.jsp I have put <html> <body> ${message} </body> </html> My web.xml has <display-name>Spring3MVC</display-name> <welcome-file-list> <welcome-file>index.jsp</welcome-file> </welcome-file-list> <servlet> <servlet-name>spring</servlet-name> <servlet-class> org.springframework.web.servlet.DispatcherServlet </servlet-class> <load-on-startup>1</load-on-startup> </servlet> <servlet-mapping> <servlet-name>spring</servlet-name> <url-pattern>*.html</url-pattern> </servlet-mapping> When I run the app on Tomcat6 server( thru eclipse),I can see the index page at http://localhost:8080/Spring3MVC/ .It displays the link to hello page.When I click on it(http://localhost:8080/Spring3MVC/hello.html),I get a 404 error. message /Spring3MVC/hello.html description The requested resource (/Spring3MVC/hello.html) is not available. Any idea how I can solve this? thanks mark.

    Read the article

  • extensible database design: automatic ALTER TABLE or serialize() field BLOB ?

    - by mario
    I want an adaptable database scheme. But still use a simple table data gateway in my application, where I just pass an $data[] array for storing. The basic columns are settled in the initial table scheme. There will however arise a couple of meta fields later (ca 10-20). I want some flexibility there and not adapt the database manually each time, or -worse- change the application logic just because of new fields. So now there are two options which seem workable yet not overkill. But I'm not sure about the scalability or database drawbacks. (1) Automatic ALTER TABLE. Whenever the $data array is to be saved, the keys are compared against the current database columns. New columns get defined before the $data is INSERTed into the table. Actually seems simple enough in test code: function save($data, $table="forum") { // columns if ($new_fields = array_diff(array_keys($data), known_fields($table))) { extend_schema($table, $new_fields, $data); } // save $columns = implode("`, `", array_keys($data)); $qm = str_repeat(",?", count(array_keys($data)) - 1); echo ("INSERT INTO `$table` (`$columns`) VALUES (?$qm);"); function known_fields($table) { return unserialize(@file_get_contents("db:$table")) ?: array("id"); function extend_schema($table, $new_fields, $data) { foreach ($new_fields as $field) { echo("ALTER TABLE `$table` ADD COLUMN `$field` VARCHAR;"); Since it is mostly meta information fields, adding them just as VARCHAR seems sufficient. Nobody will query by them anyway. So the database is really just used as storage here. However, while I might want to add a lot of new $data fields on the go, they will not always be populated. (2) serialize() fields into BLOB. Any new/extraneous meta fields could be opaque to the database. Simply sorting out the virtual fields from the real database columns is simple. And the meta fields can just be serialize()d into a blob/text field then: function ext_save($data, $table="forum") { $db_fields = array("id", "content", "flags", "ext"); // disjoin foreach (array_diff(array_keys($data),$db_fields) as $key) { $data["ext"][$key] = $data[$key]; unset($data[$key]); } $data["ext"] = serialize($data["ext"]); Unserializing and unpacking this 'ext' column on read queries is a minor overhead. The advantage is that there won't be any sparsely filled columns in the database, so I guess it's compacter and faster than the AUTO ALTER TABLE approach. Of course, this method prevents ever using one of the new fields in a WHERE or GROUP BY clause. But I think none of the possible meta fields (user_agent, author_ip, author_img, votes, hits, last_modified, ..) would/should ever be used there anyway. So I currently prefer the 'ext' blob approach, even if it's a one-way ticket. How are such columns called usually? (looking for examples/doc) Would you use XML serialization for (very theoretical) in-database queries? The adapting table scheme seems a "cleaner" interface, even if most columns might remain empty then. How does that impact speed? How many such sparse VARCHAR fields can MySQL/innodb stomach? But most importantly: Is there any standard implementation for this? A pseudo ORM with automatic ALTER TABLE tricks? Storing a simple column list seems workable, but something like pdo::getColumnMeta would be more robust.

    Read the article

  • Looking for best practise for writing a serial device communication app in C#

    - by cdotlister
    I am pretty new to serial comms, but would like advise on how to best achieve a robust application which speak to and listens to a serial device. I have managed to make use of System.IO.serialport, and successfully connected to, sent data to and recieved from my device. The way things work is this. My application connects to the Com Port and opens the port.... I then connect my device to the com port, and it detects a connectio to the PC, so sends a bit of text. it's really just copyright info, as well as the version of the firmware. I don't do anything with that, except display it in my 'activity' window. The device then waits. I can then query information, but sending a command such as 'QUERY PARAMETER1'. It then replies with something like: 'QUERY PARAMETER1\r\n\r\n76767\r\n\r\n' I then process that. I can then update it by sending 'SET PARAMETER1 12345', and it will reply with 'QUERY PARAMETER1\r\n\r\n12345\r\n\r\n'. All pretty basic. So, what I have done is created a Communication Class. this call is called in it's own thread, and sends data back to the main form... and also allows me to send messages to it. Sending data is easy. Recieving is a bit more tricky. I have employed the use of the datarecieved event, and when ever data comes in, I echo that to my screen. My problem is this: When I send a command, I feel I am being very dodgy in my handling. What I am doing is, lets say I am sending 'QUERY PARAMETER1'. I send the command to the device, I then put 'PARAMETER1' into a global variable, and I do a Thread.Sleep(100). On the data recieved, I then have a bit of logic that checks the incoming data, and sees if the string CONTAINS the value in the gloabl variable. As the reply may be 'QUERY PARAMETER1\r\n\r\n76767\r\n\r\n', it sees that it contains my parameter, parses the string, and returns the value I am looking for, but placing it into another global variable. My sending method was sleeping for 100ms. It then wakes, and checks the returned global variable. If it has data... then I'm happy, and I process the data. Problem is... if the sleep is too short.. it will fail. And I feel it's flakey.. putting stuff into variables.. then waiting... The other option is to use ReadLine instead, but that's very blocking. So I remove the datarecieved method, and instead... just send the data... then call ReadLine(). That may give me better results. There's no time, except when we connect initially, that data comes from the device, without me requesting it. So, maybe readline will be simpler and safer? Is this known as 'Blocking' reads? Also, can I set a timeout? Hopefully someone can guide me.

    Read the article

  • asp:Button is not calling server-side function

    - by Richard Neil Ilagan
    Hi guys, I know that there has been much discussion here about this topic, but none of the threads I got across helped me solve this problem. I'm hoping that mine is somewhat unique, and may actually merit a different solution. I'm instantiating an asp:Button inside a data-bound asp:GridView through template fields. Some of the buttons are supposed to call a server-side function, but for some weird reason, it doesn't. All the buttons do when you click them is fire a postback to the current page, doing nothing, effectively just reloading the page. Below is a fragment of the code: <asp:GridView ID="gv" runat="server" AutoGenerateColumns="false" CssClass="l2 submissions" ShowHeader="false"> <Columns> <asp:TemplateField> <ItemTemplate><asp:Panel ID="swatchpanel" CssClass='<%# Bind("status") %>' runat="server"></asp:Panel></ItemTemplate> <ItemStyle Width="50px" CssClass="sw" /> </asp:TemplateField> <asp:BoundField DataField="description" ReadOnly="true"> </asp:BoundField> <asp:BoundField DataField="owner" ReadOnly="true"> <ItemStyle Font-Italic="true" /> </asp:BoundField> <asp:BoundField DataField="last-modified" ReadOnly="true"> <ItemStyle Width="100px" /> </asp:BoundField> <asp:TemplateField> <ItemTemplate> <asp:Button ID="viewBtn" cssclass='<%# Bind("sid") %>' runat="server" Text="View" OnClick="viewBtnClick" /> </ItemTemplate> </asp:TemplateField> </Columns> </asp:GridView> The viewBtn above should call the viewBtnClick() function on server-side. I do have that function defined, along with a proper signature (object,EventArgs). One thing that may be of note is that this code is actually inside an ASCX, which is loaded in another ASCX, finally loaded into an ASPX. Any help or insight into the matter will be SO appreciated. Thanks! (oh, and please don't mind my trashy HTML/CSS semantics - this is still in a very,very early stage :p)

    Read the article

  • Is there limit of "join" or the "where" or length of SQL query ?

    - by Chetan sharma
    Actually i was trying to get data from elgg database based on multiple joins. It generated very big query with lots of JOIN statements and query never respond back. SELECT distinct e.* from test_entities e JOIN test_metadata m1 on e.guid = m1.entity_guid JOIN test_metastrings ms1 on ms1.id = m1.name_id JOIN test_metastrings mv1 on mv1.id = m1.value_id JOIN test_objects_entity obj on e.guid = obj.guid JOIN test_metadata m2 on e.guid = m2.entity_guid JOIN test_metastrings ms2 on ms2.id = m2.name_id JOIN test_metastrings mv2 on mv2.id = m2.value_id JOIN test_metadata m3 on e.guid = m3.entity_guid JOIN test_metastrings ms3 on ms3.id = m3.name_id JOIN test_metastrings mv3 on mv3.id = m3.value_id JOIN test_metadata m4 on e.guid = m4.entity_guid JOIN test_metastrings ms4 on ms4.id = m4.name_id JOIN test_metastrings mv4 on mv4.id = m4.value_id JOIN test_metadata m5 on e.guid = m5.entity_guid JOIN test_metastrings ms5 on ms5.id = m5.name_id JOIN test_metastrings mv5 on mv5.id = m5.value_id JOIN test_metadata m6 on e.guid = m6.entity_guid JOIN test_metastrings ms6 on ms6.id = m6.name_id JOIN test_metastrings mv6 on mv6.id = m6.value_id where ms1.string='expire_date' and mv1.string <= 1272565800 and ms2.string='homecity' and mv2.string LIKE "%dasf%" and ms3.string='schoolname' and mv3.string LIKE "%asdf%" and ms4.string='award_amount' and mv4.string <= 123 and ms5.string='no_of_awards' and mv5.string <= 7 and ms6.string='avg_rating' and mv6.string <= 2 and e.type = 'object' and e.subtype = 5 and e.site_guid = 1 and (obj.title like '%asdf%') OR (obj.description like '%asdf%') and ( (e.access_id = -2 AND e.owner_guid IN ( SELECT guid_one FROM test_entity_relationships WHERE relationship='friend' AND guid_two=5 )) OR (e.access_id IN (2,1) OR (e.owner_guid = 5) OR ( e.access_id = 0 AND e.owner_guid = 5 ) ) and e.enabled='yes') and ( (m1.access_id = -2 AND m1.owner_guid IN ( SELECT guid_one FROM test_entity_relationships WHERE relationship='friend' AND guid_two=5 )) OR (m1.access_id IN (2,1) OR (m1.owner_guid = 5) OR ( m1.access_id = 0 AND m1.owner_guid = 5 ) ) and m1.enabled='yes') and ( (m2.access_id = -2 AND m2.owner_guid IN ( SELECT guid_one FROM test_entity_relationships WHERE relationship='friend' AND guid_two=5 )) OR (m2.access_id IN (2,1) OR (m2.owner_guid = 5) OR ( m2.access_id = 0 AND m2.owner_guid = 5 ) ) and m2.enabled='yes') and ( (m3.access_id = -2 AND m3.owner_guid IN ( SELECT guid_one FROM test_entity_relationships WHERE relationship='friend' AND guid_two=5 )) OR (m3.access_id IN (2,1) OR (m3.owner_guid = 5) OR ( m3.access_id = 0 AND m3.owner_guid = 5 ) ) and m3.enabled='yes') and ( (m4.access_id = -2 AND m4.owner_guid IN ( SELECT guid_one FROM test_entity_relationships WHERE relationship='friend' AND guid_two=5 )) OR (m4.access_id IN (2,1) OR (m4.owner_guid = 5) OR ( m4.access_id = 0 AND m4.owner_guid = 5 ) ) and m4.enabled='yes') and ( (m5.access_id = -2 AND m5.owner_guid IN ( SELECT guid_one FROM test_entity_relationships WHERE relationship='friend' AND guid_two=5 )) OR (m5.access_id IN (2,1) OR (m5.owner_guid = 5) OR ( m5.access_id = 0 AND m5.owner_guid = 5 ) ) and m5.enabled='yes') and ( (m6.access_id = -2 AND m6.owner_guid IN ( SELECT guid_one FROM test_entity_relationships WHERE relationship='friend' AND guid_two=5 )) OR (m6.access_id IN (2,1) OR (m6.owner_guid = 5) OR ( m6.access_id = 0 AND m6.owner_guid = 5 ) ) and m6.enabled='yes') order by obj.title limit 0, 10 this is the query that i am running.

    Read the article

  • Displaying pic for user through a question's answer

    - by bgadoci
    Ok, I am trying to display the profile pic of a user. The application I have set up allows users to create questions and answers (I am calling answers 'sites' in the code) the view in which I am trying to do so is in the /views/questions/show.html.erb file. It might also be of note that I am using the Paperclip gem. Here is the set up: Associations Users class User < ActiveRecord::Base has_many :questions, :dependent => :destroy has_many :sites, :dependent => :destroy has_many :notes, :dependent => :destroy has_many :likes, :through => :sites , :dependent => :destroy has_many :pics, :dependent => :destroy has_many :likes, :dependent => :destroy end Questions class Question < ActiveRecord::Base has_many :sites, :dependent => :destroy has_many :notes, :dependent => :destroy has_many :likes, :dependent => :destroy belongs_to :user end Answers (sites) class Site < ActiveRecord::Base belongs_to :question belongs_to :user has_many :notes, :dependent => :destroy has_many :likes, :dependent => :destroy has_attached_file :photo, :styles => { :small => "250x250>" } end Pics class Pic < ActiveRecord::Base has_attached_file :profile_pic, :styles => { :small => "100x100" } belongs_to :user end The /views/questions/show.html.erb is rendering the partial /views/sites/_site.html.erb which is calling the Answer (site) with: <% div_for site do %> <%=h site.description %> <% end %> I have been trying to do things like: <%=image_tag site.user.pic.profile_pic.url(:small) %> <%=image_tag site.user.profile_pic.url(:small) %> etc. But that is obviously wrong. My error directs me to the Questions#show action so I am imagining that I need to define something in there but not sure what. Is is possible to call the pic given the current associations, placement of the call, and if so what Controller additions do I need to make, and what line of code will call the pic? UPDATE: Here is the QuestionsController#show code: def show @question = Question.find(params[:id]) @sites = @question.sites.all(:select => "sites.*, SUM(likes.like) as like_total", :joins => "LEFT JOIN likes AS likes ON likes.site_id = sites.id", :group => "sites.id", :order => "like_total DESC") respond_to do |format| format.html # show.html.erb format.xml { render :xml => @question } end end

    Read the article

  • Releasing the keyboard stops shake events. Why?

    - by Moshe
    1) How do I make a UITextField resign the keyboard and hide it? The keyboard is in a dynamically created subview whose superview looks for shake events. Resigning first responder seems to break the shake event handler. 2) how do you make the view holding the keyboard transparent, like see through glass? I have seen this done before. This part has been taken care of thanks guys. As always, code samples are appreciated. I've added my own to help explain the problem. EDIT: Basically, - (void)motionBegan:(UIEventSubtype)motion withEvent:(UIEvent *)event; gets called in my main view controller to handle shaking. When a user taps on the "edit" icon (a pen, in the bottom of the screen - not the traditional UINavigationBar edit button), the main view adds a subview to itself and animates it on to the screen using a custom animation. This subview contains a UINavigationController which holds a UITableView. The UITableView, when a cell is tapped on, loads a subview into itself. This second subview is the culprit. For some reason, a UITextField in this second subview is causing problems. When a user taps on the view, the main view will not respond to shakes unless the UITextField is active (in editing mode?). Additional info: My Motion Event Handler: - (void)motionBegan:(UIEventSubtype)motion withEvent:(UIEvent *)event { NSLog(@"%@", [event description]); SystemSoundID SoundID; NSString *soundFile = [[NSBundle mainBundle] pathForResource:@"shake" ofType:@"aif"]; AudioServicesCreateSystemSoundID((CFURLRef)[NSURL fileURLWithPath:soundFile], &SoundID); AudioServicesPlayAlertSound(SoundID); [self genRandom:TRUE]; } The genRandom: Method: /* Generate random label and apply it */ -(void)genRandom:(BOOL)deviceWasShaken{ if(deviceWasShaken == TRUE){ decisionText.text = [NSString stringWithFormat: (@"%@", [shakeReplies objectAtIndex:(arc4random() % [shakeReplies count])])]; }else{ SystemSoundID SoundID; NSString *soundFile = [[NSBundle mainBundle] pathForResource:@"string" ofType:@"aif"]; AudioServicesCreateSystemSoundID((CFURLRef)[NSURL fileURLWithPath:soundFile], &SoundID); AudioServicesPlayAlertSound(SoundID); decisionText.text = [NSString stringWithFormat: (@"%@", [pokeReplies objectAtIndex:(arc4random() % [pokeReplies count])])]; } } shakeReplies and pokeReplies are both NSArrays of strings. One is used for when a certain part of the screen is poked and one is for when the device is shaken. The app will randomly choose a string from the NSArray and display onscreen. For those of you who work graphically, here is a diagram of the view hierarchy: Root View -> UINavigationController -> UITableView -> Edit View -> Problem UITextfield

    Read the article

  • objective C convert NSString to unsigned

    - by user1501354
    I have changed my question. I want to convert an NSString to an unsigned int. Why? Because I want to do parallel payment in PayPal. Below I have given my coding in which I want to convert the NSString to an unsigned int. My query is: //optional, set shippingEnabled to TRUE if you want to display shipping //options to the user, default: TRUE [PayPal getPayPalInst].shippingEnabled = TRUE; //optional, set dynamicAmountUpdateEnabled to TRUE if you want to compute //shipping and tax based on the user's address choice, default: FALSE [PayPal getPayPalInst].dynamicAmountUpdateEnabled = TRUE; //optional, choose who pays the fee, default: FEEPAYER_EACHRECEIVER [PayPal getPayPalInst].feePayer = FEEPAYER_EACHRECEIVER; //for a payment with multiple recipients, use a PayPalAdvancedPayment object PayPalAdvancedPayment *payment = [[PayPalAdvancedPayment alloc] init]; payment.paymentCurrency = @"USD"; // A payment note applied to all recipients. payment.memo = @"A Note applied to all recipients"; //receiverPaymentDetails is a list of PPReceiverPaymentDetails objects payment.receiverPaymentDetails = [NSMutableArray array]; NSArray *emailArray = [NSArray arrayWithObjects:@"[email protected]",@"[email protected]", nil]; for (int i = 1; i <= 2; i++) { PayPalReceiverPaymentDetails *details = [[PayPalReceiverPaymentDetails alloc] init]; // Customize the payment notes for one of the three recipient. if (i == 2) { details.description = [NSString stringWithFormat:@"Component %d", i]; } details.recipient = [NSString stringWithFormat:@"%@",[emailArray objectAtIndex:i-1]]; unsigned order; if (i==1) { order = [[feeArray objectAtIndex:0] unsignedIntValue]; } if (i==2) { order = [[amountArray objectAtIndex:0] unsignedIntValue]; } //subtotal of all items for this recipient, without tax and shipping details.subTotal = [NSDecimalNumber decimalNumberWithMantissa:order exponent:-4 isNegative:FALSE]; //invoiceData is a PayPalInvoiceData object which contains tax, shipping, and a list of PayPalInvoiceItem objects details.invoiceData = [[PayPalInvoiceData alloc] init]; //invoiceItems is a list of PayPalInvoiceItem objects //NOTE: sum of totalPrice for all items must equal details.subTotal //NOTE: example only shows a single item, but you can have more than one details.invoiceData.invoiceItems = [NSMutableArray array]; PayPalInvoiceItem *item = [[PayPalInvoiceItem alloc] init]; item.totalPrice = details.subTotal; [details.invoiceData.invoiceItems addObject:item]; [payment.receiverPaymentDetails addObject:details]; } [[PayPal getPayPalInst] advancedCheckoutWithPayment:payment]; Can anybody tell me how to do this conversion? Thanks and regards in advance.

    Read the article

  • AIDL based two way communication

    - by sshasan
    I have two apps between which I want some data exchanged. As they are running in different processes, so, I am using AIDL to communicate between them. Now, everything is happening really great in one direction (say my apps are A and B) i.e. data is being sent from A to B but, now I need to send some data from B to A. I noticed that we need to include the app with the AIDL in the build path of app where the AIDL method will be called. So in my case A includes B in its build path. For B to be able to send something to A, by that logic, B would need A in its build path. This would create a cycle. I am stuck at this point. And I cannot think of a work around this loop. Any help would be greatly appreciated :) . Thanks! ----EDIT---- So, I following the advice mentioned in one of the comments below, I have the following code In the IPCAIDL project the AIDL file resides, its contents are package ipc.android.aidl; interface Iaidl{ boolean pushBoolean(boolean flag); } This project is being used as a library in both the IPCServer and the IPC Client. The IPCServer Project has the service which defines what happens with the AIDL method. The file is booleanService.java package ipc.android.server; import ipc.android.aidl.Iaidl; import android.app.Service; import android.content.Intent; import android.os.IBinder; import android.os.RemoteException; import android.util.Log; public class booleanService extends Service { @Override public IBinder onBind(Intent intent) { return new Iaidl.Stub() { @Override public boolean pushBoolean(boolean arg0) throws RemoteException { Log.i("SERVER(IPC AIDL)", "Truth Value:"+arg0); return arg0; } }; } } The IPCClient file which calls this method is package ipc.android.client2; import ipc.android.aidl.Iaidl; import android.app.Activity; import android.content.ComponentName; import android.content.Context; import android.content.Intent; import android.content.ServiceConnection; import android.os.Bundle; import android.os.IBinder; import android.os.RemoteException; import android.view.View; import android.widget.Button; public class IPCClient2Activity extends Activity { Button b1; Iaidl iAIDL; boolean k = false; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); bindService(new Intent("ipc.android.server.booleanService"), conn, Context.BIND_AUTO_CREATE); startService(new Intent("ipc.android.server.booleanService")); b1 = (Button) findViewById(R.id.button1); b1.setOnClickListener(new View.OnClickListener() { @Override public void onClick(View v) { if(k){ k = false; } else{ k = true; } try { iAIDL.pushBoolean(k); } catch (RemoteException e) { // TODO Auto-generated catch block e.printStackTrace(); } } }); } private ServiceConnection conn = new ServiceConnection() { @Override public void onServiceDisconnected(ComponentName name) { // TODO Auto-generated method stub } @Override public void onServiceConnected(ComponentName name, IBinder service) { iAIDL = Iaidl.Stub.asInterface(service); } }; } The manifest file for IPCServer includes the declaration of the service.

    Read the article

  • ZF-Autoloader not working in UnitTests on Ubuntu

    - by Sam
    i got a problem regarding Unit-testing a Zend-Framework application under Ubuntu 12.04. The project-structure is a default zend application whereas the models are defined as the following ./application ./models ./DbTable ./ProjectStatus.php (Application_Model_DbTable_ProjectStatus) ./Mappers ./ProjectStatus.php (Application_Model_Mapper_ProjectStatus) ./ProjectStatus.php (Application_Model_ProjectStatus) The Problem here is with the Zend-specific autoloading. The naming convention here appears that the folder Mappers loads all classes with _Mapper but not _Mappers. This is some internal Zend behavior which is fine so far. On my windows machine the phpunit runs without any Problems, trying to initiate all those classes. On my Ubuntu machine however with jenkins running on it, phpunit fails to find the appropriate classes giving me the following error Fatal error: Class 'Application_Model_Mapper_ProjectStatus' not found in /var/lib/jenkins/jobs/PAM/workspace/tests/application/models/Mapper/ProjectStatusTest.php on line 39 The error appears to really be that the Zend-Autoloader doesn't load from the ubuntu machine, but i can't figure out how or why this works. The question remains of why this is. I think i've double checked every point of contact with the zend autoloading stuff, but i just can't figure this out. I'll paste the - from my point of view relevant snippets - and hope someone of you has any insight to this. Jenkins Snippet for PHPUnit <target name="phpunit" description="Run unit tests with PHPUnit"> <exec executable="phpunit" failonerror="true"> <arg line="--configuration '${basedir}/tests/phpunit.xml' --coverage-clover '${basedir}/build/logs/clover.xml' --coverage-html '${basedir}/build/coverage/.' --log-junit '${basedir}/build/logs/junit.xml'" /> </exec> </target> ./tests/phpunit.xml <phpunit bootstrap="./bootstrap.php"> ... this shouldn't be of relevance ... </phpunit> ./tests/bootstrap.php <?php // Define path to application directory defined('APPLICATION_PATH') || define('APPLICATION_PATH', realpath(dirname(__FILE__) . '/../application')); // Define application environment defined('APPLICATION_ENV') || define('APPLICATION_ENV', (getenv('APPLICATION_ENV') ? getenv('APPLICATION_ENV') : 'testing')); // Ensure library/ is on include_path set_include_path(implode(PATH_SEPARATOR, array( realpath(APPLICATION_PATH . '/../library'), get_include_path(), ))); require_once 'Zend/Loader/Autoloader.php'; Zend_Loader_Autoloader::getInstance(); Any help will be appreciated.

    Read the article

  • The best JSF coding pattern for editing JPA entities using @RequestScoped only

    - by AlanObject
    I am in a project where I will write a lot of pages like this, so I want to use the most efficient (to write) coding pattern. Background: In the past I have used CODI's @ViewAccessScoped to preserve state between requests, and more recently I have started using flash scoped objects to save state. I can't use JSF @ViewScoped because I use CDI and they don't play well together. So I want to see if I can do this with only @RequestScoped backing beans. The page is designed like this (the p namespace is Primefaces): <f:metadata> <f:viewParam name="ID" value="#{backing.id}" /> </f:metadata> .... <h1>Edit Object Page</h1> <h:form id="formObj" rendered="#{backing.accessOK}"> <p:panelGrid columns="2"> <h:outputLabel value="Field #1:"/> <p:inputText value="#{backing.record.field1}" /> (more input fields) <h:outputLabel value="Action:" /> <h:panelGroup> <p:commandButton value="Save" action="#{backing.save}" /> <p:commandButton value="Cancel" action="backing.cancel" /> </h:panelGroup> </p:panelGrid> <p:messages showDetail="true" showSummary="true" /> </h:form> If the page is requested, the method accessOK() has the ability to keep the h:form from being rendered. Instead, the p:messages is shown with whatever FacesMessage(s) the accessOK() method cares to set. The pattern for the bean backing looks like this: @Named @RequestScoped public class Backing { private long id; private SomeJPAEntity record; private Boolean accessOK; public long getId() { return id; } public void setId(long value) { id = value; } public boolean accessOK() { if (accessOK != null) return accessOK; if (getRecord() == null) { // add a FacesMessage that explains the record // does not exist return accessOK = false; // note single = } // do any other access checks, such as write permissions return accessOK = true; } public SomeJPAEntity getRecord() { if (record != null) return record; if (getId() > 0) record = // get the record from DB else record = new SomeJPAEntity(); return record; } public String execute() { if (!accessOK()) return null; // bad edit // do other integrity checks here. If fail, set FacesMessages // and return null; if (getId() > 0) // merge the record back into the data base else // persist the record } } Here is what goes wrong with this model. When the Save button is clicked, a new instance of Backing is built, and then there are a lot of calls to the getRecord() getter before the setID() setter is called. So the logic in getRecord() breaks because it cannot rely on the id property being valid when it is called. When this was a @ViewAccessScoped (or ViewScoped) backing bean, then both the id and record properties are already set when the form is processed with the commandButton. Alternatively you can save those properties in flash storage but that has its own problems I want to avoid. So is there a way to make this programming model work within the specification?

    Read the article

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

  • Applying Unity in dynamic menu

    - by Rajarshi
    I was going through Unity 2.0 to check if it has an effective use in our new application. My application is a Windows Forms application and uses a traditional bar menu (at the top), currently. My UIs (Windows Forms) more or less support Dependency Injection pattern since they all work with a class (Presentation Model Class) supplied to them via the constructor. The form then binds to the properties of the supplied P Model class and calls methods on the P Model class to perform its duties. Pretty simple and straightforward. How P Model reacts to the UI actions and responds to them by co-ordinating with the Domain Class (Business Logic/Model) is irrelevant here and thus not mentioned. The object creation sequence to show up one UI from menu then goes like this - Create Business Model instance Create Presentation Model instance with Business Model instance passed to P Model constructor. Create UI instance with Presentation Model instance passed to UI constructor. My present solution: To show an UI in the method above from my menu I would have to refer all assemblies (Business, PModel, UI) from my Menu class. Considering I have split the modules into a number of physical assemblies, that would be a dificult task to add references to about 60 different assemblies. Also the approach is not very scalable since I would certainly need to release more modules and with this approach I would have to change the source code every time I release a new module. So primarily to avoid the reference of so many assemblies from my Menu class (assembly) I did as below - Stored all the dependency described above in a database table (SQL Server), e.g. ModuleShortCode | BModelAssembly | BModelFullTypeName | PModelAssembly | PModelFullTypeName | UIAssembly | UIFullTypeName Now used a static class named "Launcher" with a method "Launch" as below - Launcher.Launch("Discount") Launcher.Launch("Customers") The Launcher internally uses data from the dependency table and uses Activator.CreateInstance() to create each of the objects and uses the instance as constructor parameter to the next object being created, till the UI is built. The UI is then shown as a modal dialog. The code inside Launcher is somewhat like - Form frm = ResolveForm("Discount"); frm.ShowDialog(); The ResolveForm does the trick of building the chain of objects. Can Unity help me here? Now when I did that I did not have enough information on Unity and now that I have studied Unity I think I have been doing more or less the same thing. So I tried to replace my code with Unity. However, as soon as I started I hit a block. If I try to resolve UI forms in my Menu as Form customers = myUnityContainer.Resolve(); or Form customers = myUnityContainer.Resolve(typeof(Customers)); Then either way, I need to refer to my UI assembly from my Menu assembly since the target Type "Customers" need to be known for Unity to resolve it. So I am back to same place since I would have to refer all UI assemblies from the Menu assembly. I understand that with Unity I would have to refer fewer assemblies (only UI assemblies) but those references are needed which defeats my objectives below - Create the chain of objects dynamically without any assembly reference from Menu assembly. This is to avoid Menu source code changing every time I release a new module. My Menu also is built dynamically from a table. Be able to supply new modules just by supplying the new assemblies and inserting the new Dependency row in the table by a database patch. At this stage, I have a feeling that I have to do it the way I was doing, i.e. Activator.CreateInstance() to fulfil all my objectives. I need to verify whether the community thinks the same way as me or have a better suggestion to solve the problem. The post is really long and I sincerely thank you if you come til this point. Waiting for your valuable suggestions. Rajarshi

    Read the article

  • R: Plotting a graph with different colors of points based on advanced criteria

    - by balconydoor
    What I would like to do is a plot (using ggplot), where the x axis represent years which have a different colour for the last three years in the plot than the rest. The last three years should also meet a certain criteria and based on this the last three years can either be red or green. The criteria is that the mean of the last three years should be less (making it green) or more (making it red) than the 66%-percentile of the remaining years. So far I have made two different functions calculating the last three year mean: LYM3 <- function (x) { LYM3 <- tail(x,3) mean(LYM3$Data,na.rm=T) } And the 66%-percentile for the remaining: perc66 <- function(x) { percentile <- head(x,-3) quantile(percentile$Data, .66, names=F,na.rm=T) } Here are two sets of data that can be used in the calculations (plots), the first which is an example from my real data where LYM3(df1) < perc66(df1) and the second is just made up data where LYM3 perc66. df1<- data.frame(Year=c(1979:2010), Data=c(347261.87, 145071.29, 110181.93, 183016.71, 210995.67, 205207.33, 103291.78, 247182.10, 152894.45, 170771.50, 206534.55, 287770.86, 223832.43, 297542.86, 267343.54, 475485.47, 224575.08, 147607.81, 171732.38, 126818.10, 165801.08, 136921.58, 136947.63, 83428.05, 144295.87, 68566.23, 59943.05, 49909.08, 52149.11, 117627.75, 132127.79, 130463.80)) df2 <- data.frame(Year=c(1979:2010), Data=c(sample(50,29,replace=T),75,75,75)) Here’s my code for my plot so far: plot <- ggplot(df1, aes(x=Year, y=Data)) + theme_bw() + geom_point(size=3, aes(colour=ifelse(df1$Year<2008, "black",ifelse(LYM3(df1) < perc66(df1),"green","red")))) + geom_line() + scale_x_continuous(breaks=c(1980,1985,1990,1995,2000,2005,2010), limits=c(1978,2011)) plot As you notice it doesn’t really do what I want it to do. The only thing it does seem to do is that it turns the years before 2008 into one level and those after into another one and base the point colour off these two levels. Since I don’t want this year to be stationary either, I made another tiny function: fun3 <- function(x) { df <- subset(x, Year==(max(Year)-2)) df$Year } So the previous code would have the same effect as: geom_point(size=3, aes(colour=ifelse(df1$Year<fun3(df1), "black","red"))) But it still does not care about my colours. Why does it make the years into levels? And how come an ifelse function doesn’t work within another one in this case? How would it be possible to the arguments to do what I like? I realise this might be a bit messy, asking for a lot at the same time, but I hope my description is pretty clear. It would be helpful if someone could at least point me in the right direction. I tried to put the code for the plot into a function as well so I wouldn’t have to change the data frame at all functions within the plot, but I can’t get it to work. Thank you!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • mysql: can't set max_allowed_package to anything grater than 16MB

    - by sas
    I'm not sure if this is the right place to post these kind of questions, if it's not so, please (politely) let me know... :-) I need to save files greater than 16MB on a mysql database from a php site... I've already changed the c:\xampp\mysql\bin\my.cnf and set max_allowed_packet to 16 MB, and everything worked fine then I set it to 32 MB but there´s no way I can handle a file bigger than 16 MB I get the following error: 'MySQL server has gone away' (the same error I had when max_allowed_packet was set to 1MB) there must be some other setting that doesn´t allow me to handle files bigger than 16MB maybe the php client, I guess, but I don't know where to edit it this is the code I'm running when file.txt is smaller than 16.776.192 bytes long, it works fine, but if file.txt has 16.777.216 bytes i get the aforementioned error oh, and the field download.content is a longblob... $file = 'file.txt'; $file_handle = fopen( $file, 'r' ); $content = fread( $file_handle, filesize( $file ) ); fclose( $file_handle ); db_execute( 'truncate table download', true ); $sql = "insert into download( code, title, name, description, original_name, mime_type, size, content, user_insert_id, date_insert, user_update_id, date_update ) values ( 'new file', 'new file', 'sas.jpg', 'new file', '$file', 'mime', " . filesize( $file ) . ", '" . addslashes( $content ) . "', 0, " . db_char_to_sql( now_char(), 'datetime' ) . ", 0, " . db_char_to_sql( now_char(), 'datetime' ) . " )"; db_execute( $sql, true ); (the db_execute funcion just opens the connections and executes the sql stuff) running on windows XP sp2 server version: 5.0.67-community PHP Version 4.4.9 mysql client API version: 3.23.49 using: ApacheFriends XAMPP (Basispaket) version 1.6.8 that comes with + Apache 2.2.9 + MySQL 5.0.67 (Community Server) + PHP 5.2.6 + PHP 4.4.9 + PEAR + phpMyAdmin 2.11.9.2 ... this is part of the content of c:\xampp\mysql\bin\my.cnf # The MySQL server [mysqld] port= 3306 socket= "C:/xampp/mysql/mysql.sock" basedir="C:/xampp/mysql" tmpdir="C:/xampp/tmp" datadir="C:/xampp/mysql/data" skip-locking key_buffer = 16M # max_allowed_packet = 1M max_allowed_packet = 32M table_cache = 128 sort_buffer_size = 512K net_buffer_length = 8K read_buffer_size = 256K read_rnd_buffer_size = 512K myisam_sort_buffer_size = 8M

    Read the article

  • sed - trying to replace first occurrence after a match

    - by wakkaluba
    I am facing a situation that drives me nuts. I am setting up an update server which uses a json file. Don't ask why or how, it sucks and is my only possibility to achieve it. I have been trying and researching for HOURS (many) because I went ballistic and wanted to crack this on my own. But I have to realize I got stuck and need help. So sorry for this chunk but I think it is somewhat important to see... The file is a one liner and repeating the following sequence with changing values (of course). "plugin_name_foo_bar": {"buildDate": "bla", "dependencies": [{"name": "bla", "optional": true, "version": "1.00"}], "developers": [{"developerId": "bla", "email": "[email protected]", "name": "Bla bla2nd"}], "excerpt": "some text {excerpt} !bla.png|thumbnail,border=1! ", "gav": "bla", "labels": ["report", "scm-related"], "name": "plugin_name_foo_bar", "previousTimestamp": "bla", "previousVersion": "1.0", "releaseTimestamp": "bla", "requiredCore": "1", "scm": "github.com", "sha1": "ynnBM2jWo25ZLDdP3ybBOnV/Pio=", "title": "bla", "url": "http://bla.org", "version": "1.0", "wiki": "https://bla.org"}, "Exclusion": {"buildDate": "bla", "dependencies": [], and the next plugin block is glued straight afterwards. What I now want to do is to search for "plugin_foo_bar": {" as this is the unique identifier for a new plugin description block. I want to replace the first sha1 value occuring afterwards. That's where I keep failing. I always grab the first,last or any occurrence in the entire file and not the block :( "title" is the unique identifier after the sha1 value. So I tried to make the .* less greedy but it ain't working out. last attempt was heading towards: sed -i 's/("name": "plugin_name_foo_bar.*sha1": ")([a-zA-Z0-9!@#\$%^&*()\[\]]*)(", "title"\)/\1blablabla\2/1' default.json to find the sha1 value of that plugin but still no joy. I hope someone knows - preferably a simpler approach - before I now continue with trial and error until I have to puke and freakout. I am working with SED on Windows, so Unix approach might help me to figure out how to achieve this in batch but please make it as one-liner if possible. Scripts are a real pain to convert. And I just need SED and no other solution with other tools like AWK. That is absolutely out of discussion. Any help is appreciated :) Cheers Jan

    Read the article

  • DB Design Pattern - Many to many classification / categorised tagging.

    - by Robin Day
    I have an existing database design that stores Job Vacancies. The "Vacancy" table has a number of fixed fields across all clients, such as "Title", "Description", "Salary range". There is an EAV design for "Custom" fields that the Clients can setup themselves, such as, "Manager Name", "Working Hours". The field names are stored in a "ClientText" table and the data stored in a "VacancyClientText" table with VacancyId, ClientTextId and Value. Lastly there is a many to many EAV design for custom tagging / categorising the vacancies with things such as Locations/Offices the vacancy is in, a list of skills required. This is stored as a "ClientCategory" table listing the types of tag, "Locations, Skills", a "ClientCategoryItem" table listing the valid values for each Category, e.g., "London,Paris,New York,Rome", "C#,VB,PHP,Python". Finally there is a "VacancyClientCategoryItem" table with VacancyId and ClientCategoryItemId for each of the selected items for the vacancy. There are no limits to the number of custom fields or custom categories that the client can add. I am now designing a new system that is very similar to the existing system, however, I have the ability to restrict the number of custom fields a Client can have and it's being built from scratch so I have no legacy issues to deal with. For the Custom Fields my solution is simple, I have 5 additional columns on the Vacancy Table called CustomField1-5. This removes one of the EAV designs. It is with the tagging / categorising design that I am struggling. If I limit a client to having 5 categories / types of tag. Should I create 5 tables listing the possible values "CustomCategoryItems1-5" and then an additional 5 many to many tables "VacancyCustomCategoryItem1-5" This would result in 10 tables performing the same storage as the three tables in the existing system. Also, should (heaven forbid) the requirements change in that I need 6 custom categories rather than 5 then this will result in a lot of code change. Therefore, can anyone suggest any DB Design Patterns that would be more suitable to storing such data. I'm happy to stick with the EAV approach, however, the existing system has come across all the usual performance issues and complex queries associated with such a design. Any advice / suggestions are much appreciated. The DBMS system used is SQL Server 2005, however, 2008 is an option if required for any particular pattern.

    Read the article

  • Settings designer file complains when protecting configuration for connectionStrings in App.Config i

    - by Joe
    Hi, I am trying to encrypt Configuration Information Using Protected Configuration in Visual Studio 2010. I have the following info speicifed in the App.Config file: <connectionStrings configProtectionProvider="TheProviderName"> <EncryptedData> <CipherData> <CipherValue>VALUE GOES HERE</CipherValue> </CipherData> </EncryptedData> </connectionStrings> <appSettings configProtectionProvider="TheProviderName"> <EncryptedData> <CipherData> <CipherValue>VALUE GOES HERE</CipherValue> </CipherData> </EncryptedData> </appSettings> However, when I then go to the Settings area of the Projects Properties to view the settings in the Designer, I get prompted with the following error "An error occured while reading the App.config file. The file might be corrupted or contain invalid XML." I understand that my changes are causing the error, however, is there anyway I can bypass that the information is not read into at design view? (Of course the best way would be to make the tags be recognized by the designer, is there any way to do this?) I tried adding <connectionStrings configProtectionProvider="TheProviderName" xmlns="http://schemas.microsoft.com/.NetConfiguration/v2.0"> to connectionStrings as well as to the appSettings, but with no luck, the intellisense is bypassed in the config file, but the designer still complains. I would be satisfied if the designer would not complain about this "error", which is not actually an error because Microsoft states here that it should work. ASP.NET 2.0 provides a new feature, called protected configuration, that enables you to encrypt sensitive information in a configuration file. Although primarily designed for ASP.NET, protected configuration can also be used to encrypt configuration file sections in Windows applications. For a detailed description of the new protected configuration capabilities, see Encrypting Configuration Information Using Protected Configuration. And yes, it does work to encrypt it and to decrypt it and use it, it is just very annoying and frustrating that the designer complains about it. Anyone who knows which xsd file that is used (if used) to verify the contents of the App.config file in the design view? Any help appreciated.

    Read the article

  • Instance Failure in asp.net

    - by user85511
    I have a web application that is working perfectly in my system. However, when I copied it to another system, I couldn't login to the application. There is an error: Server Error in '/' Application. -------------------------------------------------------------------------------- Instance failure. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.InvalidOperationException: Instance failure. Source Error: An unhandled exception was generated during the execution of the current web request. Information regarding the origin and location of the exception can be identified using the exception stack trace below. Stack Trace: [InvalidOperationException: Instance failure.] System.Data.SqlClient.TdsParser.Connect(ServerInfo serverInfo, SqlInternalConnectionTds connHandler, Boolean ignoreSniOpenTimeout, Int64 timerExpire, Boolean encrypt, Boolean trustServerCert, Boolean integratedSecurity, SqlConnection owningObject) +4858423 System.Data.SqlClient.SqlInternalConnectionTds.AttemptOneLogin(ServerInfo serverInfo, String newPassword, Boolean ignoreSniOpenTimeout, Int64 timerExpire, SqlConnection owningObject) +90 System.Data.SqlClient.SqlInternalConnectionTds.LoginNoFailover(String host, String newPassword, Boolean redirectedUserInstance, SqlConnection owningObject, SqlConnectionString connectionOptions, Int64 timerStart) +257 System.Data.SqlClient.SqlInternalConnectionTds.OpenLoginEnlist(SqlConnection owningObject, SqlConnectionString connectionOptions, String newPassword, Boolean redirectedUserInstance) +221 System.Data.SqlClient.SqlInternalConnectionTds..ctor(DbConnectionPoolIdentity identity, SqlConnectionString connectionOptions, Object providerInfo, String newPassword, SqlConnection owningObject, Boolean redirectedUserInstance) +189 System.Data.SqlClient.SqlConnectionFactory.CreateConnection(DbConnectionOptions options, Object poolGroupProviderInfo, DbConnectionPool pool, DbConnection owningConnection) +4859187 System.Data.ProviderBase.DbConnectionFactory.CreatePooledConnection(DbConnection owningConnection, DbConnectionPool pool, DbConnectionOptions options) +31 System.Data.ProviderBase.DbConnectionPool.CreateObject(DbConnection owningObject) +433 System.Data.ProviderBase.DbConnectionPool.UserCreateRequest(DbConnection owningObject) +66 System.Data.ProviderBase.DbConnectionPool.GetConnection(DbConnection owningObject) +499 System.Data.ProviderBase.DbConnectionFactory.GetConnection(DbConnection owningConnection) +65 System.Data.ProviderBase.DbConnectionClosed.OpenConnection(DbConnection outerConnection, DbConnectionFactory connectionFactory) +117 System.Data.SqlClient.SqlConnection.Open() +122 System.Web.DataAccess.SqlConnectionHolder.Open(HttpContext context, Boolean revertImpersonate) +87 System.Web.DataAccess.SqlConnectionHelper.GetConnection(String connectionString, Boolean revertImpersonation) +221 System.Web.Security.SqlMembershipProvider.GetPasswordWithFormat(String username, Boolean updateLastLoginActivityDate, Int32& status, String& password, Int32& passwordFormat, String& passwordSalt, Int32& failedPasswordAttemptCount, Int32& failedPasswordAnswerAttemptCount, Boolean& isApproved, DateTime& lastLoginDate, DateTime& lastActivityDate) +815 System.Web.Security.SqlMembershipProvider.CheckPassword(String username, String password, Boolean updateLastLoginActivityDate, Boolean failIfNotApproved, String& salt, Int32& passwordFormat) +105 System.Web.Security.SqlMembershipProvider.CheckPassword(String username, String password, Boolean updateLastLoginActivityDate, Boolean failIfNotApproved) +42 System.Web.Security.SqlMembershipProvider.ValidateUser(String username, String password) +78 System.Web.UI.WebControls.Login.AuthenticateUsingMembershipProvider(AuthenticateEventArgs e) +60 System.Web.UI.WebControls.Login.OnAuthenticate(AuthenticateEventArgs e) +119 System.Web.UI.WebControls.Login.AttemptLogin() +115 System.Web.UI.WebControls.Login.OnBubbleEvent(Object source, EventArgs e) +101 System.Web.UI.Control.RaiseBubbleEvent(Object source, EventArgs args) +37 System.Web.UI.WebControls.Button.OnCommand(CommandEventArgs e) +118 System.Web.UI.WebControls.Button.RaisePostBackEvent(String eventArgument) +166 System.Web.UI.WebControls.Button.System.Web.UI.IPostBackEventHandler.RaisePostBackEvent(String eventArgument) +10 System.Web.UI.Page.RaisePostBackEvent(IPostBackEventHandler sourceControl, String eventArgument) +13 System.Web.UI.Page.RaisePostBackEvent(NameValueCollection postData) +36 System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) +1565 -------------------------------------------------------------------------------- Version Information: Microsoft .NET Framework Version:2.0.50727.3053; ASP.NET Version:2.0.50727.3053 What could be the reason for such an error? How could I solve this?

    Read the article

  • Why does WebSharingAppDemo-CEProviderEndToEnd sample still need a client db connection after scope c

    - by Don
    I'm researching a way to build an n-tierd sync solution. From the WebSharingAppDemo-CEProviderEndToEnd sample it seems almost feasable however for some reason, the app will only sync if the client has a live SQL db connection. Can some one explain what I'm missing and how to sync without exposing SQL to the internet? The problem I'm experiencing is that when I provide a Relational sync provider that has an open SQL connection from the client, then it works fine but when I provide a Relational sync provider that has a closed but configured connection string, as in the example, I get an error from the WCF stating that the server did not receive the batch file. So what am I doing wrong? SqlConnectionStringBuilder builder = new SqlConnectionStringBuilder(); builder.DataSource = hostName; builder.IntegratedSecurity = true; builder.InitialCatalog = "mydbname"; builder.ConnectTimeout = 1; provider.Connection = new SqlConnection(builder.ToString()); // provider.Connection.Open(); **** un-commenting this causes the code to work** //create anew scope description and add the appropriate tables to this scope DbSyncScopeDescription scopeDesc = new DbSyncScopeDescription(SyncUtils.ScopeName); //class to be used to provision the scope defined above SqlSyncScopeProvisioning serverConfig = new SqlSyncScopeProvisioning(); .... The error I get occurs in this part of the WCF code: public SyncSessionStatistics ApplyChanges(ConflictResolutionPolicy resolutionPolicy, ChangeBatch sourceChanges, object changeData) { Log("ProcessChangeBatch: {0}", this.peerProvider.Connection.ConnectionString); DbSyncContext dataRetriever = changeData as DbSyncContext; if (dataRetriever != null && dataRetriever.IsDataBatched) { string remotePeerId = dataRetriever.MadeWithKnowledge.ReplicaId.ToString(); //Data is batched. The client should have uploaded this file to us prior to calling ApplyChanges. //So look for it. //The Id would be the DbSyncContext.BatchFileName which is just the batch file name without the complete path string localBatchFileName = null; if (!this.batchIdToFileMapper.TryGetValue(dataRetriever.BatchFileName, out localBatchFileName)) { //Service has not received this file. Throw exception throw new FaultException<WebSyncFaultException>(new WebSyncFaultException("No batch file uploaded for id " + dataRetriever.BatchFileName, null)); } dataRetriever.BatchFileName = localBatchFileName; } Any ideas?

    Read the article

  • [Reloaded] Error while sorting filtered data from a GridView

    - by Bogdan M
    Hello guys, I have an error I cannot solve, on a ASP.NET website. One of its pages - Countries.aspx, has the following controls: a CheckBox called "CheckBoxNAME": < asp:CheckBox ID="CheckBoxNAME" runat="server" Text="Name" /> a TextBox called "TextBoxName": < asp:TextBox ID="TextBoxNAME" runat="server" Width="100%" Wrap="False"> < /asp:TextBox> a SQLDataSource called "SqlDataSourceCOUNTRIES", that selects all records from a Table with 3 columns - ID (Number, PK), NAME (Varchar2(1000)), and POPULATION (Number) called COUNTRIES < asp:SqlDataSource ID="SqlDataSourceCOUNTRIES" runat="server" ConnectionString="< %$ ConnectionStrings:myDB %> " ProviderName="< %$ ConnectionStrings:myDB.ProviderName %> " SelectCommand="SELECT COUNTRIES.ID, COUNTRIES.NAME, COUNTRIES.POPULATION FROM COUNTRIES ORDER BY COUNTRIES.NAME, COUNTRIES.ID"> < /asp:SqlDataSource> a GridView called GridViewCOUNTRIES: < asp:GridView ID="GridViewCOUNTRIES" runat="server" AllowPaging="True" AllowSorting="True" AutoGenerateColumns="False" DataSourceID="SqlDataSourceCOUNTRIES" DataKeyNames="ID" DataMember="DefaultView"> < Columns> < asp:CommandField ShowSelectButton="True" /> < asp:BoundField DataField="ID" HeaderText="Id" SortExpression="ID" /> < asp:BoundField DataField="NAME" HeaderText="Name" SortExpression="NAME" /> < asp:BoundField DataField="POPULATION" HeaderText="Population" SortExpression="POPULATION" /> < /Columns> < /asp:GridView> a Button called ButtonFilter: < asp:Button ID="ButtonFilter" runat="server" Text="Filter" onclick="ButtonFilter_Click"/> This is the onclick event: protected void ButtonFilter_Click(object sender, EventArgs e) { Response.Redirect("Countries.aspx?" + (this.CheckBoxNAME.Checked ? string.Format("NAME={0}", this.TextBoxNAME.Text) : string.Empty)); } Also, this is the main onload event of the page: protected void Page_Load(object sender, EventArgs e) { if (Page.IsPostBack == false) { if (Request.QueryString.Count != 0) { Dictionary parameters = new Dictionary(); string commandTextFormat = string.Empty; if (Request.QueryString["NAME"] != null) { if (commandTextFormat != string.Empty && commandTextFormat.EndsWith("AND") == false) { commandTextFormat += "AND"; } commandTextFormat += " (UPPER(COUNTRIES.NAME) LIKE '%' || :NAME || '%') "; parameters.Add("NAME", Request.QueryString["NAME"].ToString()); } this.SqlDataSourceCOUNTRIES.SelectCommand = string.Format("SELECT COUNTRIES.ID, COUNTRIES.NAME, COUNTRIES.POPULATION FROM COUNTRIES WHERE {0} ORDER BY COUNTRIES.NAME, COUNTRIES.ID", commandTextFormat); foreach (KeyValuePair parameter in parameters) { this.SqlDataSourceCOUNTRIES.SelectParameters.Add(parameter.Key, parameter.Value.ToUpper()); } } } } Basicly, the page displays in the GridViewCOUNTRIES all the records of table COUNTRIES. The scenario is the following: - the user checks the CheckBox; - the user types a value in the TextBox (let's say "ch"); - the user presses the Button; - the page loads displaying only the records that match the filter criteria (in this case, all the countries that have names containing "Ch"); - the user clicks on the header of the column called "Name" in order to sort the data in the GridView Then, I get the following error: ORA-01036: illegal variable name/number. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.Data.OracleClient.OracleException: ORA-01036: illegal variable name/number Source Error: An unhandled exception was generated during the execution of the current web request. Information regarding the origin and location of the exception can be identified using the exception stack trace below. Any help is greatly appreciated, tnks. PS: I'm using ASP.NET 3.5, under Visual Studio 2008, with an OracleXE database.

    Read the article

  • MooTools event listener disappears after element.innerHTML is changed

    - by acoder
    Hi everyone, I am trying to achieve this task using MooTools. Description: I attached an event listener to "myButton" link. A click on this link initiates an AJAX request and updates "myDiv" content based on the response text. During this request a POST variable is being sent to "button.php", but it's not used at the moment.. (i wish to use it later) OK, as a result, "myDiv" gets exactly the same link with the same ID (myButton) + a random number, so that we could see that each click generates a new number. The problem: After the first click on "myButton", "myDiv" updates correctly, showing a random number. When I click "myButton" for the second time (this time in newly updated div), the div does not refresh anymore. Please note that I need "myButton" to be inside "myDiv", and "myDiv" must be updated (refreshed) after each click without having to refresh the entire page. Can somebody show me how to achieve this task based on this simplified code example? index.html <html> <head> <script type="text/javascript" src="mootools-1.2.4-core-nc.js"></script> <script> window.addEvent('domready', function() { $('myButton').addEvent('click', function(e) { e.stop(); var myRequest = new Request({ method: 'post', url: 'button.php', data: { action : 'test' }, onRequest: function() { $('myDiv').innerHTML = '<img src="images/loading.gif" />'; }, onComplete: function(response) { $('myDiv').innerHTML = response; } }); myRequest.send(); $('myButton').removeEvent('click'); }); }); </script> </head> <body> <div id="myDiv"> <a id="myButton" href="#">Button</a> </div> </body> </html> button.php <a id="myButton" href="#">Button</a> clicked <?php echo rand(1,100); ?>

    Read the article

  • Parsing CSV File to MySQL DB in PHP

    - by Austin
    I have a some 350-lined CSV File with all sorts of vendors that fall into Clothes, Tools, Entertainment, etc.. categories. Using the following code I have been able to print out my CSV File. <?php $fp = fopen('promo_catalog_expanded.csv', 'r'); echo '<tr><td>'; echo implode('</td><td>', fgetcsv($fp, 4096, ',')); echo '</td></tr>'; while(!feof($fp)) { list($cat, $var, $name, $var2, $web, $var3, $phone,$var4, $kw,$var5, $desc) = fgetcsv($fp, 4096); echo '<tr><td>'; echo $cat. '</td><td>' . $name . '</td><td><a href="http://www.' . $web .'" target="_blank">' .$web.'</a></td><td>'.$phone.'</td><td>'.$kw.'</td><td>'.$desc.'</td>' ; echo '</td></tr>'; } fclose($file_handle); show_source(__FILE__); ?> First thing you will probably notice is the extraneous vars within the list(). this is because of how the excel spreadsheet/csv file: Category,,Company Name,,Website,,Phone,,Keywords,,Description ,,,,,,,,,, Clothes,,4imprint,,4imprint.com,,877-466-7746,,"polos, jackets, coats, workwear, sweatshirts, hoodies, long sleeve, pullovers, t-shirts, tees, tshirts,",,An embroidery and apparel company based in Wisconsin. ,,Apollo Embroidery,,apolloemb.com,,1-800-982-2146,,"hats, caps, headwear, bags, totes, backpacks, blankets, embroidery",,An embroidery sales company based in California. One thing to note is that the last line starts with two commas as it is also listed within "Clothes" category. My concern is that I am going about the CSV output wrong. Should I be using a foreach loop instead of this list way? Should I first get rid of any unnecessary blank columns? Please advise any flaws you may find, improvements I can use so I can be ready to import this data to a MySQL DB.

    Read the article

  • Having problems creating an array from XML data in Acrobat Javascript, please help if you can

    - by Kevin Minke
    I have a manually created array that already works example below: var PartsData = { 179: { ref:"", partNum: "201-2007-C00-00", descript: "System Monitor Card (Tracewell Only)", cage: "39764", qty: "1", SMR: "XBOZZ", UOC: "A" }}; Now this array above is is just one value in the array and it works fine. Here is the XML that I am trying to use to dynamically change the values. <?xml version="1.0" encoding="utf-8"?> <partsTables> <partsList> <part sheetNum="ta1"> <breakDownIndexNo>-1 </breakDownIndexNo> <referenceDesg/> <indent>20534220P01 </indent> <description/> <cage>TAC RI, GRADE-A SHOCK (TEC RACK), ALT P/N 72304-1</cage> <qtyPerAssy>23991 </qtyPerAssy> <smr>1 </smr> <uoc>ADODD </uoc> <blank/> </part> </partsList> </partsTables> I have this parsing just fine in Acrobat. Now I want to make the array work for me in using these values. if I have the following below it will work. Where part.item(i).indent.value equals the value of the indent node, etc. newArr = { 179: { ref: part.item(i).referenceDesg.value, partNum: part.item(i).indent.value, descript: part.item(i).cage.value, cage: part.item(i).qtyPerAssy.value, qty: part.item(i).smr.value, SMR: part.item(i).uoc.value, UOC: part.item(i).blank.value}}; As soon as I try to make the 179 value, which is in the breakDownIndexNo node, dynamic by using the direct part.item(i).breakDownIndexNo.value it will not compile. Acrobat is using javascript so I'm not sure why I can not get this to parse. I have tried to create a variable out of the breakDownIndexNo node and typed it to both a String and an Integer. this will let it create the array but it will not let me output from the array. newArr[indexNum].partNum gives me "no properties" where newArr[179].partNum if I were to manually set the index number to 179 will print out the value of part.item(i).indent.value. If any of you have an idea or an answer please let me know.

    Read the article

< Previous Page | 418 419 420 421 422 423 424 425 426 427 428 429  | Next Page >