Search Results

Search found 112732 results on 4510 pages for 'google plus one'.

Page 428/4510 | < Previous Page | 424 425 426 427 428 429 430 431 432 433 434 435  | Next Page >

  • Google Chrome, IE problem with adjusting style before AJAX

    - by orokusaki
    When I'm using AJAX, I typically do something before each request to let the user know that they'll be waiting for a second. This is usually done by just adding an animated loading gif. When I do this, Firefox does what you'd expect and adds the gif before moving control to the next line (where the AJAX is called). In Chrome, it locks the browser and doesn't make any DOM changes at all (let alone load an image), including even changing the color of something, until the AJAX is done. This isn't just AJAX though. It's anything that holds control, and it never makes DOM changes until the control is given back to the window. Example (using jQuery): function submit_order() { $('#my_element').css('color', '#FF0000'); // Make text red before calling AJAX $.getJSON('/api/', my_callback) // Note, in IE and Chrome #my_element isn't turned red until the AJAX finishes and my_callback is run } Why does this happen, and how can I solve it? I can't use ASYNC because of the nature of the data (it would be a big mess). I experimented with using window.setTimeout(myajaxfunc, 150) after setting the style, to see if it would set the style, then do the timeout, but it appears it isn't an issue with just AJAX, but rather the control of the script in general (I think, hence the title making mention to AJAX because this is the only time I ever run into this problem). This doesn't have anything to do with it being in a function BTW.

    Read the article

  • How do I select the max value from multiple tables in one column

    - by Derick
    I would like to get the last date of records modified. Here is a sample simple SELECT: SELECT t01.name, t01.last_upd date1, t02.last_upd date2, t03.last_upd date3, 'maxof123' maxdate FROM s_org_ext t01, s_org_ext_x t02, s_addr_org t03 WHERE t02.par_row_id(+)= t01.row_id and t03.row_id(+)= t01.pr_addr_id and t01.int_org_flg = 'n'; How can I get column maxdate to display the max of the three dates? Note: no UNION or sub SELECT statements ;)

    Read the article

  • prepend to a file one liner shell?

    - by elmarco
    This is probably a complex solution. I am looking for a simple operator like "", but for prepending. I am afraid it does not exist. I'll have to do something like mv $F tmp cat header tmp $F Anything smarter? (I am not fond of tmp files)

    Read the article

  • Skipping one item in the column

    - by zurna
    I created a simple news website. I store both videos and images in IMAGES table. Videos added have videos and images added have images stored in a column called ImagesType. Images and Videos attached to a news is stored in ImagesID column of the NEWS table. My problem occurs when I need to display the first image of a news. i.e. IMAGES table: ImagesID ImagesLgURL ImagesType 1 /FLPM/media/videos/0H7T9C0F.flv videos 2 /FLPM/media/images/8R5D7M8O.jpg images 3 /FLPM/media/images/0E7Q9Z0C.jpg images NEWS table NewsID ImagesID NewsTitle 1 1;2; Street Chic: Paris ERROR 2 3; Paris Runway NO ERROR The following code give me an error with the 2nd news item because the first ImageID stored in the list is not an image but a video. I need to figure out a way to skip the video item and display the next image. I hope I made sense. SQL = "SELECT NEWSID, CATEGORIESID, IMAGESID, NEWSTITLE, NEWSSHORTDESC, NEWSACTIVE, NEWSDATEENTERED" SQL = SQL & " FROM NEWS N" SQL = SQL & " WHERE NEWSACTIVE = 1" SQL = SQL & " ORDER BY NEWSDATEENTERED DESC" Set objNews = objConn.Execute(SQL) Do While intLooper1 <= 3 And Not objNews.EOF IMAGES = Split(Left(objNews("IMAGESID"),Len(objNews("IMAGESID"))-1), ";") SQL = "SELECT ImagesID, ImagesName, ImagesLgURL, ImagesSmURL, ImagesType" SQL = SQL & " FROM IMAGES I" SQL = SQL & " WHERE ImagesID = " & IMAGES(0) & " AND ImagesType = 'images'" Set objLgImage = objConn.Execute(SQL) <div> <a href="?Section=news&SubSection=redirect&NEWSID=<%=objNews("NEWSID")%>"> <img src="<%=objLgImage("ImagesLgURL")%>" alt="<%=objLgImage("ImagesName")%>" /> </a> </div> <% objLgImage.Close Set objLgImage = Nothing intLooper1 = intLooper1 + 1 objNews.MoveNext Loop %>

    Read the article

  • One-Click Application Moving from WinForms to WPF

    - by Tyler
    I have a WinForms app that I recently re-wrote in WPF and I need to release to my end users. I'd like to be able to have the users go to the ClickOnce install point for the WPF application and have their WinForm application removed so they don't have both on their machine What's the best way (read: easiest for users) of accomplishing this? I have thought about creating an prereq command line app to detect the old version and uninstall, but would like to avoid having to write an something like that where it only get's run once.

    Read the article

  • One position right barrel shift using ALU Operators?

    - by Tomek
    I was wondering if there was an efficient way to perform a shift right on an 8 bit binary value using only ALU Operators (NOT, OR, AND, XOR, ADD, SUB) Example: input: 00110101 output: 10011010 I have been able to implement a shift left by just adding the 8 bit binary value with itself since a shift left is equivalent to multiplying by 2. However, I can't think of a way to do this for shift right. The only method I have come up with so far is to just perform 7 left barrel shifts. Is this the only way?

    Read the article

  • Map tiling - What kind of projection?

    - by ikky
    Hi. I've taken a large image and divided it in to square tiles (256x256). It is made for google maps also, so the whole image is divided into z_x_y.png (Depending on zoom level). z=0 = 1x1 tile z=1 = 2x2 tilesthe z=2 = 4x4 tiles My imageMap is "flat" and is not based on a sphere like the worldmap. I'm gonna use this map on a windows mobile app (which has no google API), and all the "points of interests" is inserted into a database by longitude and latitude. And since i have to make this for the windows mobile, i just have XY coordinate system. Is it enough to just use this: MAP_WIDTH = 256*TILES_W; MAP_HEIGHT = 256*TILES_H; function convert(int lat, int lon) { int y = (int)((-1 * lat) + 90) * (MAP_HEIGHT / 180); int x = (int)(lon + 180) * (MAP_WIDTH / 360); ImagePoint p = new ImagePoint(x,y); // An object which holds the coordinates return p; } Or do i need a projection technique? Thanks in advance. Please ask, if something is unclear.

    Read the article

  • Merging two XML files into one XML file using Java

    - by dmurali
    I am stuck with how to proceed with combining two different XML files(which has the same structure). When I was doing some research on it, people say that XML parsers like DOM or StAX will have to be used. But cant I do it with the regular IOStream? I am currently trying to do with the help of IOStream but this is not solving my purpose, its being more complex. For example, What I have tried is; public class GUI { public static void main(String[] args) throws Exception { // Creates file to write to Writer output = null; output = new BufferedWriter(new FileWriter("C:\\merged.xml")); String newline = System.getProperty("line.separator"); output.write(""); // Read in xml file 1 FileInputStream in = new FileInputStream("C:\\1.xml"); BufferedReader br = new BufferedReader(new InputStreamReader(in)); String strLine; while ((strLine = br.readLine()) != null) { if (strLine.contains("<MemoryDump>")){ strLine = strLine.replace("<MemoryDump>", "xmlns:xsi"); } if (strLine.contains("</MemoryDump>")){ strLine = strLine.replace("</MemoryDump>", "xmlns:xsd"); } output.write(newline); output.write(strLine); System.out.println(strLine); } // Read in xml file 2 FileInputStream in = new FileInputStream("C:\\2.xml"); BufferedReader br1 = new BufferedReader(new InputStreamReader(in)); String strLine1; while ((strLine1 = br1.readLine()) != null) { if (strLine1.contains("<MemoryDump>")){ strLine1 = strLine1.replace("<MemoryDump>", ""); } if (strLine1.contains("</MemoryDump>")){ strLine1 = strLine1.replace("</MemoryDump>", ""); } output.write(newline); output.write(strLine1); I request you to kindly let me know how do I proceed with merging two XML files by adding additional content as well. It would be great if you could provide me some example links as well..! Thank You in Advance..! System.out.println(strLine1); } }

    Read the article

  • Microsecond (or one ms) time resolution on an embedded device (Linux Kernel)

    - by ChrisDiRulli
    Hey guys, I have a kernel module I've built that requires at least 1 ms time resolution. I currently use do_gettimeofday() but I'm concerned that this won't work once I move my module to an embedded device. The device has a 180 Mz processor (MIPS) and the default HZ value in the kernel is 100. Thus using jiffies will only give me at best 10 ms resolution. That won't cut it. What I'd like to know is if do_gettimeofday() is based on the timer interrupt (HZ). Can it be guaranteed to provide at least 1 ms of resolution? Thanks!

    Read the article

  • Params order in Foo.new(params[:foo]), need one before the other (Rails)

    - by Jeena
    I have a problem which I don't know how to fix. It has to do with the unsorted params hash. I have a object Reservation which has a virtual time= attribute and a virtual eating_session= attribute when I set the time= I also want to validate it via an external server request. I do that with help of the method times() which makes a lookup on a other server and saves all possible times in the @times variable. The problem now is that the method times() needs the eating_session attribute to find out which times are valid, but rails sometimes calls the times= method first, before there is any eating_session in the Reservation object when I just do @reservation = Reservation.new(params[:reservation]) class ReservationsController < ApplicationController def new @reservation = Reservation.new(params[:reservation]) # ... end end class Reservation < ActiveRecord::Base include SoapClient attr_accessor :date, :time belongs_to :eating_session def time=(time) @time = times.find { |t| t[:time] == time } end def times return @times if defined? @times @times = [] response = call_soap :search_availability { # eating_session is sometimes nil :session_id => eating_session.code, # <- HERE IS THE PROBLEM :dining_date => date } response[:result].each do |result| @times << { :time => "#{DateTime.parse(result[:time]).strftime("%H:%M")}", :correlation_data => result[:correlation_data] } end @times end end I have no idea how to fix this, any help is apriciated.

    Read the article

  • Can't find how to import as one object or how to merge

    - by Aaron
    I need write a script in blender that creates some birds which fly around some obstacles. The problem is that I need to import a pretty large Collada model (a building) which consists of multiple objects. The import works fine, but the the building is not seen as 1 object. I need to resize and move this building, but I can only get the last object in the building (which is a camera)... Does anyone know how to merge this building in 1 object, group, variable... so I can resize and move it correctly? Part of the code I used: bpy.ops.wm.collada_import(filepath="C:\\Users\\me\\building.dae") building= bpy.context.object building.scale = (100, 100, 100) building.name = "building"

    Read the article

  • How to resolve a java.security.AccessControlException?

    - by thisisananth
    I have written an SAX parser in my Google App Engine Web application. in that I try to validate my xml file with an xsd. But I am getting an access control exception when my code is tyring to access that xsd. java.security.AccessControlException: access denied (java.io.FilePermission \WEB-INF\ApplicationResponse.xsd read) at java.security.AccessControlContext.checkPermission(AccessControlContext.java:264) at java.security.AccessController.checkPermission(AccessController.java:427) at java.lang.SecurityManager.checkPermission(SecurityManager.java:532) at com.google.appengine.tools.development.DevAppServerFactory$CustomSecurityManager.checkPermission(DevAppServerFactory.java:166) at java.lang.SecurityManager.checkRead(SecurityManager.java:871) at java.io.FileInputStream.(FileInputStream.java:100) at com.sun.org.apache.xerces.internal.impl.xs.XMLSchemaLoader.xsdToXMLInputSource(XMLSchemaLoader.java:830) at com.sun.org.apache.xerces.internal.impl.xs.XMLSchemaLoader.processJAXPSchemaSource(XMLSchemaLoader.java:708) at com.sun.org.apache.xerces.internal.impl.xs.XMLSchemaLoader.loadSchema(XMLSchemaLoader.java:554) at com.sun.org.apache.xerces.internal.impl.xs.XMLSchemaValidator.findSchemaGrammar(XMLSchemaValidator.java:2459) at com.sun.org.apache.xerces.internal.impl.xs.XMLSchemaValidator.handleStartElement(XMLSchemaValidator.java:1807) at com.sun.org.apache.xerces.internal.impl.xs.XMLSchemaValidator.startElement(XMLSchemaValidator.java:705) at com.sun.org.apache.xerces.internal.impl.XMLNSDocumentScannerImpl.scanStartElement(XMLNSDocumentScannerImpl.java:330) at com.sun.org.apache.xerces.internal.impl.XMLNSDocumentScannerImpl$NSContentDispatcher.scanRootElementHook(XMLNSDocumentScannerImpl.java:779) at com.sun.org.apache.xerces.internal.impl.XMLDocumentFragmentScannerImpl$FragmentContentDispatcher.dispatch(XMLDocumentFragmentScannerImpl.java:1794) at com.sun.org.apache.xerces.internal.impl.XMLDocumentFragmentScannerImpl.scanDocument(XMLDocumentFragmentScannerImpl.java:368) at com.sun.org.apache.xerces.internal.parsers.XML11Configuration.parse(XML11Configuration.java:834) at com.sun.org.apache.xerces.internal.parsers.XML11Configuration.parse(XML11Configuration.java:764) at com.sun.org.apache.xerces.internal.parsers.XMLParser.parse(XMLParser.java:148) at com.sun.org.apache.xerces.internal.parsers.AbstractSAXParser.parse(AbstractSAXParser.java:1242) at sax.SAXLocalNameCount.parse(SAXLocalNameCount.java:220) at com.sms2mint.InterfaceServlet.doGet(InterfaceServlet.java:54) Please let me know how to debug this? I have tried to place the xsd in classes, webcontent, /WEB-INF but didn't help. Also declared this as a resource file in appengine-web.xml also but no avail.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • How to move child element from one parent to another using jQuery

    - by Kapslok
    I am using the jQuery DataTables plugin. I would like to move the search box (.dataTables_filter) and number of records to display dropdown (.dataTables_length) from their parent element (.dataTables_wrapper) to another div on my page without losing any registered javascript behavior. For instance the search box has a function attached to the 'keyup' event and I want to keep that intact. The DOM looks like this: <body> <div id="parent1"> <div class="dataTables_wrapper" id="table1_wrapper"> <div class="dataTables_length" id="table1_length"> <select size="1" name="table1_length"> <option value="10">10</option> <option value="25">25</option> <option value="50">50</option> <option value="100">100</option> </select> </div> <div class="dataTables_filter" id="table1_filter"> <input type="text" class="search"> </div> <table id="table1"> ... </table> </div> </div> <div id="parent2"> <ul> <li><a href="#">Link A</a></li> <li><a href="#">Link B</a></li> <li><a href="#">Link C</a></li> </ul> </div> </body> This is what I would like the DOM to look like after the move: <body> <div id="parent1"> <div class="dataTables_wrapper" id="table1_wrapper"> <table id="table1"> ... </table> </div> </div> <div id="parent2"> <div class="dataTables_filter" id="table1_filter"> <input type="text" class="search"> </div> <div class="dataTables_length" id="table1_length"> <select size="1" name="table1_length"> <option value="10">10</option> <option value="25">25</option> <option value="50">50</option> <option value="100">100</option> </select> </div> <ul> <li><a href="#">Link A</a></li> <li><a href="#">Link B</a></li> <li><a href="#">Link C</a></li> </ul> </div> </body> I've been looking at the .append(), .appendTo(), .prepend() and .prependTo() functions but haven't had any luck with these in practice. I've also looked at the .parent() and .parents() functions, but can't seem to code a workable solution. I have also considered changing the CSS so that the elements are absolutely positioned - but to be frank the page is setup with fluid elements all over, and I really want these elements to be floated in their new parents. Any help with this is much appreciated.

    Read the article

  • In listview,Viewstub cannot be found after the previous one is inflate

    - by user2958132
    I am using some list item layout and in the item layout, there is a Viewstub where I want to put some image in.I don't have the source of list item layout and just know there are some TextViews and ViewStubs in it. My purpose is to find the ViewStub first and set my personal layout and play with it. However, some of the ViewStub cannot be found. public class TJAdapter extends CursorAdapter { .... public void bindView(View view, Context context, Cursor cursor) { ViewStub contentstub = (ViewStub)item.findViewById(R.id.content_stub); if (contentstub == null){ LOG.error("TJ,contentstub is null"); } else { LOG.error("TJ,contentstub is not null"); contentstub.setLayoutResource(R.layout.icon_image); View iconImage = contentstub.inflate(); } .... } public View newView(Context context, Cursor cursor, ViewGroup parent) { final View view = mInflater.inflate(R.layout.list_item, parent, false); bindView(view, context, cursor); } And the log output is like this: TJ,bindView is called TJ,contentstub is not null TJ,bindView is called TJ,contentstub is null TJ,bindView is called TJ,contentstub is not null TJ,bindView is called TJ,contentstub is not null TJ,bindView is called TJ,contentstub is null TJ,bindView is called TJ,contentstub is not null I spent a lot of time on it and have no idea why this happens. Can some body help?

    Read the article

  • javascript regex: match altered version of first match with only one expression

    - by theseion
    Hi there I'm writing a brush for Alex Gorbatchev's Syntax Highlighter to get highlighting for Smalltalk code. Now, consider the following Smalltalk code: aCollection do: [ :each | each shout ] I want to find the block argument ":each" and then match "each" every time it occurrs afterwards (for simplicity, let's say every occurrence an not just inside the brackets). Note that the argument can have any name, e.g. ":myArg". My attempt to match ":each": \:([\d\w]+) This seems to work. The problem is for me to match the occurrences of "each". I thought something like this could work: \:([\d\w]+)|\1 but the right hand side of the alternation seems to be treated as an independent expression, so backreferencing doesn't work. So my question is: is it even possible to accomplish what I want in a single expression? Or would I have to use the backreference within a second expression (via another function call)? Cheers.

    Read the article

  • Combining multiple lines into one line

    - by mkal
    I have this use case of an xml file with input like Input: <abc a="1"> <val>0.25</val> </abc> <abc a="2"> <val>0.25</val> </abc> <abc a="3"> <val>0.35</val> </abc> ... Output: <abc a="1"><val>0.25</val></abc> <abc a="2"><val>0.25</val></abc> <abc a="3"><val>0.35</val></abc> I have around 200K lines in a file in the Input format, how can I quickly convert this into output format.

    Read the article

  • Handling one-to-many relationship with ZF partialLoop

    - by snaken
    Lets say i'm listing musical artists, each artist has basic information like Name, Age etc. stored in an artist table. They also have entries in an Albums table (album name/album cover etc), referencing the artist table using the artist id as a foreign key. I have the Model_Artist (Artist.php) file: class Model_Artist extends Zend_Db_Table_Abstract { protected $_name = 'artist'; protected $_dependentTables = array('Model_ArtistAlbums'); public function fetchArtistss() { $select = $this->select(); return $this->fetchAll($select); } } and to the Model_ArtistAlbums (ArtistAlbums.php) file class Model_ArtistAlbums extends Zend_Db_Table_Abstract { protected $_name = 'albums'; protected $_referenceMap = array( 'Artists' => array( 'columns' => 'alb_art_id', 'refTableClass' => 'Model_Artist', 'refColumns' => 'art_id' ) ); // etc } in my controller: public function indexAction() { /* THIS WORKS $art = new Model_Artist(); $artRowset = $art->find(1); $art1 = $artRowset->current(); $artalbums = $art1->findDependentRowset('Model_ArtistAlbums'); foreach($artalbums as $album){ echo $album->alb_title."<br>"; } */ $arts = new Model_Artist(); $this->view->artists = $arts->fetchArtists(); } in the view file: $this->partial()->setObjectKey('artist'); echo $this->partialLoop('admin/list-artists.phtml', $this->artists); but with this code in artists/list-artists.phtml: foreach($this->artist->findDependentRowset('albums') as $album): // other stuff endforeach; i get this error: Fatal error: Call to a member function findDependentRowset() on a non-object A var_dump of $this->artist = NULL.

    Read the article

  • MySQL: select words as rows even som are "new line" separated in one field

    - by Tillebeck
    Hi I have a table with a field where words are written separated with new lines. So a select on this single field from to rows will output 3 lines for first row and 2 lines for second row: Row1 designationer nye kolonier mindre byer Row2 udsteder bopladser I would like to do a select that select all these lines as if they had been rows in the table like: SELECT do_the_split(field) FROM table so the result would be more like: Row1 designationer Row2 nye kolonier Row3 mindre byer Row4 udsteder Row5 bopladser is there any way to do this in MySQL? BR. Anders

    Read the article

< Previous Page | 424 425 426 427 428 429 430 431 432 433 434 435  | Next Page >