Search Results

Search found 18238 results on 730 pages for 'python gui'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 429/730 | < Previous Page | 425 426 427 428 429 430 431 432 433 434 435 436  | Next Page >

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • What is the Simplest Possible Payment Gateway to Implement? (using Django)

    - by b14ck
    I'm developing a web application that will require users to either make one time deposits of money into their account, or allow users to sign up for recurring billing each month for a certain amount of money. I've been looking at various payment gateways, but most (if not all) of them seem complex and difficult to get working. I also see no real active Django projects which offer simple views for making payments. Ideally, I'd like to use something like Amazon FPS, so that I can see online transaction logs, refund money, etc., but I'm open to other things. I just want the EASIEST possible payment gateway to integrate with my site. I'm not looking for anything fancy, whatever does the job, and requires < 10 hours to get working from start to finish would be perfect. I'll give answer points to whoever can point out a good one. Thanks!

    Read the article

  • mod_wsgi daemon mode vs threaded fastcgi

    - by t0ster
    Can someone explain the difference between apache mod_wsgi in daemon mode and django fastcgi in threaded mode. They both use threads for concurrency I think. Supposing that I'm using nginx as front end to apache mod_wsgi. UPDATE: I'm comparing django built in fastcgi(./manage.py method=threaded maxchildren=15) and mod_wsgi in 'daemon' mode(WSGIDaemonProcess example threads=15). They both use threads and acquire GIL, am I right?

    Read the article

  • How to write data by dynamic parameter name

    - by Maxim Welikobratov
    I need to be able to write data to datastore of google-app-engine for some known entity. But I don't want write assignment code for each parameter of the entity. I meen, I don't want do like this val_1 = self.request.get('prop_1') val_2 = self.request.get('prop_2') ... val_N = self.request.get('prop_N') item.prop_1 = val_1 item.prop_2 = val_2 ... item.prop_N = val_N item.put() instead, I want to do something like this args = self.request.arguments() for prop_name in args: item.set(prop_name, self.request.get(prop_name)) item.put() dose anybody know how to do this trick?

    Read the article

  • Django and mod_python intermittent error?

    - by Peter
    I have a Django site at http://sm.rutgers.edu/relive/af_api/index/. It is supposed to display "Home of the relive APIs". If you refresh this page many times, you can see different renderings. 1) The expected page. 2) Django "It worked!" page. 3) "ImportError at /index/" page. If you scroll down enough to ROOT_URLCONF part, you will see it says 'relive.urls'. But apparently, it should be 'af_api.urls', which is in my settings.py file. Since these results happen randomly, is it possible that either Django or mod_python is working unstably?

    Read the article

  • Is there a way to control how pytest-xdist runs tests in parallel?

    - by superselector
    I have the following directory layout: runner.py lib/ tests/ testsuite1/ testsuite1.py testsuite2/ testsuite2.py testsuite3/ testsuite3.py testsuite4/ testsuite4.py The format of testsuite*.py modules is as follows: import pytest class testsomething: def setup_class(self): ''' do some setup ''' # Do some setup stuff here def teardown_class(self): '''' do some teardown''' # Do some teardown stuff here def test1(self): # Do some test1 related stuff def test2(self): # Do some test2 related stuff .... .... .... def test40(self): # Do some test40 related stuff if __name__=='__main()__' pytest.main(args=[os.path.abspath(__file__)]) The problem I have is that I would like to execute the 'testsuites' in parallel i.e. I want testsuite1, testsuite2, testsuite3 and testsuite4 to start execution in parallel but individual tests within the testsuites need to be executed serially. When I use the 'xdist' plugin from py.test and kick off the tests using 'py.test -n 4', py.test is gathering all the tests and randomly load balancing the tests among 4 workers. This leads to the 'setup_class' method to be executed every time of each test within a 'testsuitex.py' module (which defeats my purpose. I want setup_class to be executed only once per class and tests executed serially there after). Essentially what I want the execution to look like is: worker1: executes all tests in testsuite1.py serially worker2: executes all tests in testsuite2.py serially worker3: executes all tests in testsuite3.py serially worker4: executes all tests in testsuite4.py serially while worker1, worker2, worker3 and worker4 are all executed in parallel. Is there a way to achieve this in 'pytest-xidst' framework? The only option that I can think of is to kick off different processes to execute each test suite individually within runner.py: def test_execute_func(testsuite_path): subprocess.process('py.test %s' % testsuite_path) if __name__=='__main__': #Gather all the testsuite names for each testsuite: multiprocessing.Process(test_execute_func,(testsuite_path,))

    Read the article

  • Ternary operator

    - by Antoine Leclair
    In PHP, I often use the ternary operator to add an attribute to an html element if it applies to the element in question. For example: <select name="blah"> <option value="1"<?= $blah == 1 ? ' selected="selected"' : '' ?>> One </option> <option value="2"<?= $blah == 2 ? ' selected="selected"' : '' ?>> Two </option> </select> I'm starting a project with Pylons using Mako for the templating. How can I achieve something similar? Right now, I see two possibilities that are not ideal. Solution 1: <select name="blah"> % if blah == 1: <option value="1" selected="selected">One</option> % else: <option value="1">One</option> % endif % if blah == 2: <option value="2" selected="selected">Two</option> % else: <option value="2">Two</option> % endif </select> Solution 2: <select name="blah"> <option value="1" % if blah == 1: selected="selected" % endif >One</option> <option value="2" % if blah == 2: selected="selected" % endif >Two</option> </select> In this particular case, the value is equal to the variable tested (value="1" = blah == 1), but I use the same pattern in other situations, like <?= isset($variable) ? ' value="$variable" : '' ?>. I am looking for a clean way to achieve this using Mako.

    Read the article

  • django on appengine

    - by aks
    I am impressed with django.Am am currenty a java developer.I want to make some cool websites for myself but i want to host it in some third pary environmet. Now the question is can i host the django application on appengine?If yes , how?? Are there any site built using django which are already hosted on appengine?

    Read the article

  • Help calling class from a class above.

    - by wtzolt
    Hello, How to call from class oneThread: back to class fun:? As in, address a class written below. Is it possible? class oneThread(threading.Thread): def __init__(self): threading.Thread.__init__(self) self.start() def run(self): print "1" time.sleep(1) print "2" time.sleep(1) print "3" self.wTree.get_widget("entryResult").set_text("Done with One.") # How to call from here back to class fun, which of course is below...? class fun: wTree = None def __init__( self ): self.wTree = gtk.glade.XML( "main.glade" ) self.wTree.signal_autoconnect( {"on_buttonOne" : self.one} ) gtk.main() def one(self, widget): oneThread(); gtk.gdk.threads_init() do=fun()

    Read the article

  • The truth value of an array with more than one element is ambigous when trying to index an array

    - by user1440194
    I am trying to put all elements of rbs into a new array if the elements in var(another numpy array) is =0 and <=.1 . However when I try the following code I get this error: ValueError: The truth value of an array with more than one element is ambiguous. Use a.any() or a.all() rbs = [ish[4] for ish in realbooks] for book in realbooks: var -= float(str(book[0]).replace(":", "")) bidsred = rbs[(var <= .1) and (var >=0)] any ideas on what I'm doing wrong?

    Read the article

  • Testing InlineFormset clean methods

    - by Rory
    I have a Django project, with 2 models, a Structure and Bracket, the Bracket has a ForeignKey to a Structure (i.e. one-to-many, one Structure has many Brackets). I created a TabularInline for the admin site, so that there would be a table of Brackets on the Structure. I added a custom formset with some a custom clean method to do some extra validation, you can't have a Bracket that conflicts with another Bracket on the same Structure etc. The admin looks like this: class BracketInline(admin.TabularInline): model = Bracket formset = BracketInlineFormset class StructureAdmin(admin.ModelAdmin): inlines = [ BracketInline ] admin.site.register(Structure, StructureAdmin) That all works, and the validation works. However now I want to write some unittest to test my complex formset validation logic. My first attempt to validate known-good values is: data = {'form-TOTAL_FORMS': '1', 'form-INITIAL_FORMS': '0', 'form-MAX_NUM_FORMS': '', 'form-0-field1':'good-value', … } formset = BracketInlineFormset(data) self.assertTrue(formset.is_valid()) However that doesn't work and raises the exception: ====================================================================== ERROR: testValid (appname.tests.StructureTestCase) ---------------------------------------------------------------------- Traceback (most recent call last): File "/paht/to/project/tests.py", line 494, in testValid formset = BracketInlineFormset(data) File "/path/to/django/forms/models.py", line 672, in __init__ self.instance = self.fk.rel.to() AttributeError: 'BracketInlineFormset' object has no attribute 'fk' ---------------------------------------------------------------------- The Django documentation (for formset validation) implies one can do this. How come this isn't working? How do I test the custom clean()/validation for my inline formset?

    Read the article

  • Pygame, sounds don't play

    - by terabytest
    I'm trying to play sound files (.wav) with pygame but when I start it I never hear anything. This is the code: import pygame pygame.init() pygame.mixer.init() sounda= pygame.mixer.Sound("desert_rustle.wav") sounda.play() I also tried using channels but the result is the same

    Read the article

  • Problem with anchor tags in Django after using lighttpd + fastcgi

    - by Drew A
    I just started using lighttpd and fastcgi for my django site, but I've noticed my anchor links are no longer working. I used the anchor links for sorting links on the page, for example I use an anchor to sort links by the number of points (or votes) they have received. For example: the code in the html template: ... {% load sorting_tags %} ... {% ifequal sort_order "points" %} {% trans "total points" %} {% trans "or" %} {% anchor "date" "date posted" %} {% order_by_votes links request.direction %} {% else %} {% anchor "points" "total points" %} {% trans "or" %} {% trans "date posted" %} ... The anchor link on "www.mysite.com/my_app/" for total points will be directed to "my_app/?sort=points" But the correct URL should be "www.mysite.com/my_app/?sort=points" All my other links work, the problem is specific to anchor links. The {% anchor %} tag is taken from django-sorting, the code can be found at http://github.com/directeur/django-sorting Specifically in django-sorting/templatetags/sorting_tags.py Thanks in advance.

    Read the article

  • Sqlalchemy complex in_ clause

    - by lostlogic
    I'm trying to find a way to cause sqlalchemy to generate sql of the following form: select * from t where (a,b) in ((a1,b1),(a2,b2)); Is this possible? If not, any suggestions on a way to emulate it? Thanks kindly!

    Read the article

  • gae error : Error: Server Error, how to debug it .

    - by zjm1126
    when i upload my project to google-app-engine , it show this : Error: Server Error The server encountered an error and could not complete your request. If the problem persists, please report your problem and mention this error message and the query that caused it. why ? how can i debug this error ? thanks

    Read the article

  • Matplotlib autodatelocator custom date formatting?

    - by jawonlee
    I'm using Matplotlib to dynamically generate .png charts from a database. The user may set as the x-axis any given range of datetimes, and I need to account for all of it. While Matplotlib has the dates.AutoDateLocator(), I want the datetime format printed on the chart to be context-specific - e.g. if the user is charting from 3 p.m. to 5 p.m., the year/month/day information doesn't need to be displayed. Right now, I'm manually creating Locator and Formatter objects thusly: def get_ticks(start, end): from datetime import timedelta as td delta = end - start if delta <= td(minutes=10): loc = mdates.MinuteLocator() fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(minutes=30): loc = mdates.MinuteLocator(byminute=range(0,60,5)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(hours=1): loc = mdates.MinuteLocator(byminute=range(0,60,15)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(hours=6): loc = mdates.HourLocator() fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(days=1): loc = mdates.HourLocator(byhour=range(0,24,3)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(days=3): loc = mdates.HourLocator(byhour=range(0,24,6)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(weeks=2): loc = mdates.DayLocator() fmt = mdates.DateFormatter('%b %d') elif delta <= td(weeks=12): loc = mdates.WeekdayLocator() fmt = mdates.DateFormatter('%b %d') elif delta <= td(weeks=52): loc = mdates.MonthLocator() fmt = mdates.DateFormatter('%b') else: loc = mdates.MonthLocator(interval=3) fmt = mdates.DateFormatter('%b %Y') return loc,fmt Is there a better way of doing this?

    Read the article

  • Creating a new plugin for mpld3

    - by sjp14051
    Toward learning how to create a new mpld3 plugin, I took an existing example, LinkedDataPlugin (http://mpld3.github.io/examples/heart_path.html), and modified it slightly by deleting references to lines object. That is, I created the following: class DragPlugin(plugins.PluginBase): JAVASCRIPT = r""" mpld3.register_plugin("drag", DragPlugin); DragPlugin.prototype = Object.create(mpld3.Plugin.prototype); DragPlugin.prototype.constructor = DragPlugin; DragPlugin.prototype.requiredProps = ["idpts", "idpatch"]; DragPlugin.prototype.defaultProps = {} function DragPlugin(fig, props){ mpld3.Plugin.call(this, fig, props); }; DragPlugin.prototype.draw = function(){ var patchobj = mpld3.get_element(this.props.idpatch, this.fig); var ptsobj = mpld3.get_element(this.props.idpts, this.fig); var drag = d3.behavior.drag() .origin(function(d) { return {x:ptsobj.ax.x(d[0]), y:ptsobj.ax.y(d[1])}; }) .on("dragstart", dragstarted) .on("drag", dragged) .on("dragend", dragended); patchobj.path.attr("d", patchobj.datafunc(ptsobj.offsets, patchobj.pathcodes)); patchobj.data = ptsobj.offsets; ptsobj.elements() .data(ptsobj.offsets) .style("cursor", "default") .call(drag); function dragstarted(d) { d3.event.sourceEvent.stopPropagation(); d3.select(this).classed("dragging", true); } function dragged(d, i) { d[0] = ptsobj.ax.x.invert(d3.event.x); d[1] = ptsobj.ax.y.invert(d3.event.y); d3.select(this) .attr("transform", "translate(" + [d3.event.x,d3.event.y] + ")"); patchobj.path.attr("d", patchobj.datafunc(ptsobj.offsets, patchobj.pathcodes)); } function dragended(d, i) { d3.select(this).classed("dragging", false); } } mpld3.register_plugin("drag", DragPlugin); """ def __init__(self, points, patch): print "Points ID : ", utils.get_id(points) self.dict_ = {"type": "drag", "idpts": utils.get_id(points), "idpatch": utils.get_id(patch)} However, when I try to link the plugin to a figure, as in plugins.connect(fig, DragPlugin(points[0], patch)) I get an error, 'module' is not callable, pointing to this line. What does this mean and why doesn't it work? Thanks. I'm adding additional code to show that linking more than one Plugin might be problematic. But this may be entirely due to some silly mistake on my part, or there is a way around it. The following code based on LinkedViewPlugin generates three panels, in which the top and the bottom panel are supposed to be identical. Mouseover in the middle panel was expected to control the display in the top and bottom panels, but updates occur in the bottom panel only. It would be nice to be able to figure out how to reflect the changes in multiple panels. Thanks. import matplotlib import matplotlib.pyplot as plt import numpy as np import mpld3 from mpld3 import plugins, utils class LinkedView(plugins.PluginBase): """A simple plugin showing how multiple axes can be linked""" JAVASCRIPT = """ mpld3.register_plugin("linkedview", LinkedViewPlugin); LinkedViewPlugin.prototype = Object.create(mpld3.Plugin.prototype); LinkedViewPlugin.prototype.constructor = LinkedViewPlugin; LinkedViewPlugin.prototype.requiredProps = ["idpts", "idline", "data"]; LinkedViewPlugin.prototype.defaultProps = {} function LinkedViewPlugin(fig, props){ mpld3.Plugin.call(this, fig, props); }; LinkedViewPlugin.prototype.draw = function(){ var pts = mpld3.get_element(this.props.idpts); var line = mpld3.get_element(this.props.idline); var data = this.props.data; function mouseover(d, i){ line.data = data[i]; line.elements().transition() .attr("d", line.datafunc(line.data)) .style("stroke", this.style.fill); } pts.elements().on("mouseover", mouseover); }; """ def __init__(self, points, line, linedata): if isinstance(points, matplotlib.lines.Line2D): suffix = "pts" else: suffix = None self.dict_ = {"type": "linkedview", "idpts": utils.get_id(points, suffix), "idline": utils.get_id(line), "data": linedata} class LinkedView2(plugins.PluginBase): """A simple plugin showing how multiple axes can be linked""" JAVASCRIPT = """ mpld3.register_plugin("linkedview", LinkedViewPlugin2); LinkedViewPlugin2.prototype = Object.create(mpld3.Plugin.prototype); LinkedViewPlugin2.prototype.constructor = LinkedViewPlugin2; LinkedViewPlugin2.prototype.requiredProps = ["idpts", "idline", "data"]; LinkedViewPlugin2.prototype.defaultProps = {} function LinkedViewPlugin2(fig, props){ mpld3.Plugin.call(this, fig, props); }; LinkedViewPlugin2.prototype.draw = function(){ var pts = mpld3.get_element(this.props.idpts); var line = mpld3.get_element(this.props.idline); var data = this.props.data; function mouseover(d, i){ line.data = data[i]; line.elements().transition() .attr("d", line.datafunc(line.data)) .style("stroke", this.style.fill); } pts.elements().on("mouseover", mouseover); }; """ def __init__(self, points, line, linedata): if isinstance(points, matplotlib.lines.Line2D): suffix = "pts" else: suffix = None self.dict_ = {"type": "linkedview", "idpts": utils.get_id(points, suffix), "idline": utils.get_id(line), "data": linedata} fig, ax = plt.subplots(3) # scatter periods and amplitudes np.random.seed(0) P = 0.2 + np.random.random(size=20) A = np.random.random(size=20) x = np.linspace(0, 10, 100) data = np.array([[x, Ai * np.sin(x / Pi)] for (Ai, Pi) in zip(A, P)]) points = ax[1].scatter(P, A, c=P + A, s=200, alpha=0.5) ax[1].set_xlabel('Period') ax[1].set_ylabel('Amplitude') # create the line object lines = ax[0].plot(x, 0 * x, '-w', lw=3, alpha=0.5) ax[0].set_ylim(-1, 1) ax[0].set_title("Hover over points to see lines") linedata = data.transpose(0, 2, 1).tolist() plugins.connect(fig, LinkedView(points, lines[0], linedata)) # second set of lines exactly the same but in a different panel lines2 = ax[2].plot(x, 0 * x, '-w', lw=3, alpha=0.5) ax[2].set_ylim(-1, 1) ax[2].set_title("Hover over points to see lines #2") plugins.connect(fig, LinkedView2(points, lines2[0], linedata)) mpld3.show()

    Read the article

  • Decorator for determining HTTP response from a view

    - by polera
    I want to create a decorator that will allow me to return a raw or "string" representation of a view if a GET parameter "raw" equals "1". The concept works, but I'm stuck on how to pass context to my renderer. Here's what I have so far: from django.shortcuts import render_to_response from django.http import HttpResponse from django.template.loader import render_to_string def raw_response(template): def wrap(view): def response(request,*args,**kwargs): if request.method == "GET": try: if request.GET['raw'] == "1": render = HttpResponse(render_to_string(template,{}),content_type="text/plain") return render except Exception: render = render_to_response(template,{}) return render return response return wrap Currently, the {} is there just as a place holder. Ultimately, I'd like to be able to pass a dict like this: @raw_response('my_template_name.html') def view_name(request): render({"x":42}) Any assistance is appreciated.

    Read the article

  • How to generate lots of redundant ajax elements like checkboxes and pulldowns in Django?

    - by iJames
    Hello folks. I've been getting lots of answers from stackoverflow now that I'm in Django just be searching. Now I hope my question will also create some value for everybody. In choosing Django, I was hoping there was some similar mechanism to the way you can do partials in ROR. This was going to help me in two ways. One was in generating repeating indexed forms or form elements, and also in rendering only a piece of the page on the round trip. I've done a little bit of that by using taconite with a simple URL click but now I'm trying to get more advanced. This will focus on the form issue which boils down to how to iterate over a secondary object. If I have a list of photo instances, each of which has a couple of parameters, let's say a size and a quantity. I want to generate form elements for each photo instance separately. But then I have two lists I want to iterate on at the same time. Context: photos : Photo.objects.all() and forms = {} for photo in photos: forms[photo.id] = PhotoForm() In other words we've got a list of photo objects and a dict of forms based on the photo.id. Here's an abstraction of the template: {% for photo in photos %} {% include "photoview.html" %} {% comment %} So here I want to use the photo.id as an index to get the correct form. So that each photo has its own form. I would want to have a different action and each form field would be unique. Is that possible? How can I iterate on that? Thanks! {% endcomment %} Quantity: {{ oi.quantity }} {{ form.quantity }} Dimensions: {{ oi.size }} {{ form.size }} {% endfor %} What can I do about this simple case. And how can I make it where every control is automatically updating the server instead of using a form at all? Thanks! James

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 425 426 427 428 429 430 431 432 433 434 435 436  | Next Page >