Search Results

Search found 18238 results on 730 pages for 'python gui'.

Page 434/730 | < Previous Page | 430 431 432 433 434 435 436 437 438 439 440 441  | Next Page >

  • Django - foreignkey problem

    - by realshadow
    Hey, Imagine you have this model: class Category(models.Model): node_id = models.IntegerField(primary_key = True) type_id = models.IntegerField(max_length = 20) parent_id = models.IntegerField(max_length = 20) sort_order = models.IntegerField(max_length = 20) name = models.CharField(max_length = 45) lft = models.IntegerField(max_length = 20) rgt = models.IntegerField(max_length = 20) depth = models.IntegerField(max_length = 20) added_on = models.DateTimeField(auto_now = True) updated_on = models.DateTimeField(auto_now = True) status = models.IntegerField(max_length = 20) node = models.ForeignKey(Category_info, verbose_name = 'Category_info', to_field = 'node_id' The important part is the foreignkey. When I try: Category.objects.filter(type_id = type_g.type_id, parent_id = offset, status = 1) I get an error that get returned more than category, which is fine, because it is supposed to return more than one. But I want to filter the results trough another field, which would be type id (from the second Model) Here it is: class Category_info(models.Model): objtree_label_id = models.AutoField(primary_key = True) node_id = models.IntegerField(unique = True) language_id = models.IntegerField() label = models.CharField(max_length = 255) type_id = models.IntegerField() The type_id can be any number from 1 - 5. I am desparately trying to get only one result where the type_id would be number 1. Here is what I want in sql: SELECT n.*, l.* FROM objtree_nodes n JOIN objtree_labels l ON (n.node_id = l.node_id) WHERE n.type_id = 15 AND n.parent_id = 50 AND l.type_id = 1 Any help is GREATLY appreciated. Regards

    Read the article

  • All minimum spanning trees implementation

    - by russtbarnacle
    I've been looking for an implementation (I'm using networkx library.) that will find all the minimum spanning trees (MST) of an undirected weighted graph. I can only find implementations for Kruskal's Algorithm and Prim's Algorithm both of which will only return a single MST. I've seen papers that address this problem (such as http://fano.ics.uci.edu/cites/Publication/Epp-TR-95-50.html) but my head tends to explode someway through trying to think how to translate it to code. In fact i've not been able to find an implementation in any language!

    Read the article

  • Tying PyQt4 QAction triggered() to local class callable doesn't seem to work. How to debug this?

    - by Jon Watte
    I create this object when I want to create a QAction. I then add this QAction to a menu: class ActionObject(object): def __init__(self, owner, command): action = QtGui.QAction(command.name, owner) self.action = action self.command = command action.setShortcut(command.shortcut) action.setStatusTip(command.name) QtCore.QObject.connect(action, QtCore.SIGNAL('triggered()'), self.triggered) def triggered(self): print("got triggered " + self.command.id + " " + repr(checked)) Unfortunately, when the menu item is selected, the 'triggered' function is not called. QtCore.QObject.connect() returns True. Nothing is printed on the console to indicate that anything is wrong, and no exception is thrown. How can I debug this? (or, what am I doing wrong?)

    Read the article

  • Looping through a directory on the web and displaying its contents (files and other directories) via

    - by al jaffe
    In the same vein as http://stackoverflow.com/questions/2593399/process-a-set-of-files-from-a-source-directory-to-a-destination-directory-in-pyth I'm wondering if it is possible to create a function that when given a web directory it will list out the files in said directory. Something like... files[] for file in urllib.listdir(dir): if file.isdir: # handle this as directory else: # handle as file I assume I would need to use the urllib library, but there doesn't seem to be an easy way of doing this, that I've seen at least.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • What's the straightforward way to implement one to many editing in list_editable in django admin?

    - by Nate Pinchot
    Given the following models: class Store(models.Model): name = models.CharField(max_length=150) class ItemGroup(models.Model): group = models.CharField(max_length=100) code = models.CharField(max_length=20) class ItemType(models.Model): store = models.ForeignKey(Store, on_delete=models.CASCADE, related_name="item_types") item_group = models.ForeignKey(ItemGroup) type = models.CharField(max_length=100) Inline's handle adding multiple item_types to a Store nicely when viewing a single Store. The content admin team would like to be able to edit stores and their types in bulk. Is there a simple way to implement Store.item_types in list_editable which also allows adding new records, similar to horizontal_filter? If not, is there a straightforward guide that shows how to implement a custom list_editable template? I've been Googling but haven't been able to come up with anything. Also, if there is a simpler or better way to set up these models that would make this easier to implement, feel free to comment.

    Read the article

  • How to display multiple images?

    - by misterwebz
    I'm trying to get multiple image paths from my database in order to display them, but it currently doesn't work. Here's what i'm using: def get_image(self, userid, id): image = meta.Session.query(Image).filter_by(userid=userid) permanent_file = open(image[id].image_path, 'rb') if not os.path.exists(image.image_path): return 'No such file' data = permanent_file.read() permanent_file.close() response.content_type = guess_type(image.image_path)[0] or 'text/plain' return data I'm getting an error regarding this part: image[id].image_path What i want is for Pylons to display several jpg files on 1 page. Any idea how i could achieve this?

    Read the article

  • How different protocols interact with eachother in Twisted

    - by stsupermouse
    The scenario I want two different protocols interact with each other is as below: A and B is two different protocols. First A will interact with the server and retrieve some values. Only after A finishes retrieving the values , B will start to interact with the server. Now my problem is that is there an elegant way to initial B when A retrieves the values. Currently I just initial B in A's data process function. But i don't think that this is an elegant way. What I mean an elegant way is that the initialization of B is done by a flow controller or something like that, but not another protocol. Is there an elegant way? such using defered or any other things. I'm just new to twisted, not knowing very much about defered.... Thank you very much!

    Read the article

  • Segment string into array, regex?

    - by Hanpan
    I have a string which looks like this: "[segment1][segment2][segment2]" What I'd like is to be able to split the string into an array, so I'd end up with: Array[0] = "segment1", Array[1] = "segment2", Array[2] = "segment3" I've tried using the string split function, but it doesn't seem to do exactly what I want. I was wondering if anyone has some regex which might help me out? Thanks in advance

    Read the article

  • Find next lower item in a sorted list

    - by Sebastian
    Hey guys, let's say I have a sorted list of Floats. Now I'd like to get the index of the next lower item of a given value. The usual for-loop aprroach has a complexity of O(n). Since the list is sorted there must be a way to get the index with O(log n). My O(n) approach: index=0 for i,value in enumerate(mylist): if value>compareValue: index=i-1 Is there a datatype for solving that problem in O(log n)? best regards Sebastian

    Read the article

  • Get wrong PATH_INFO after rewriting in lighttpd

    - by Satoru.Logic
    In my lighttpd config file, I have a rewrite rule like this: $HTTP["host"] == "sub.example.com" { url.rewrite = ( "^/(.*)" => "/sub/$1" ) } So when a user visits http://sub.example.com, she's actually visiting http://example.com/sub. The problem is that the PATH_INFO seems wrong, URL: http://sub.example.com/extra PATH_INFO: expected: /extra what I get: /sub/extra Now whenever I call request.get_path(), it returns something like http://sub.example.com/sub/extra, which is not what I want. Of course, I can just override the get_path method of the request class, but I wonder if there is a simpler way like changing the lighttpd config?

    Read the article

  • Self Authenticating Links in Django

    - by awolf
    In my web app I would like to be able to email self-authenticating links to users. These links will contain a unique token (uuid). When they click the link the token being present in the query string will be enough to authenticate them and they won't have to enter their username and password. What's the best way to do this?

    Read the article

  • Check if something is a list

    - by 8EM
    What is the easiest way to check if something is a list? A method doSomething has the parameters a and b. In the method, it will loop through the list a and do something. I'd like a way to make sure a is a list, before looping through - thus avoiding an error or the unfortunate circumstance of passing in a string then getting back each letter. This question must have been asked before - however my googles failed me. Cheers.

    Read the article

  • Creating a new plugin for mpld3

    - by sjp14051
    Toward learning how to create a new mpld3 plugin, I took an existing example, LinkedDataPlugin (http://mpld3.github.io/examples/heart_path.html), and modified it slightly by deleting references to lines object. That is, I created the following: class DragPlugin(plugins.PluginBase): JAVASCRIPT = r""" mpld3.register_plugin("drag", DragPlugin); DragPlugin.prototype = Object.create(mpld3.Plugin.prototype); DragPlugin.prototype.constructor = DragPlugin; DragPlugin.prototype.requiredProps = ["idpts", "idpatch"]; DragPlugin.prototype.defaultProps = {} function DragPlugin(fig, props){ mpld3.Plugin.call(this, fig, props); }; DragPlugin.prototype.draw = function(){ var patchobj = mpld3.get_element(this.props.idpatch, this.fig); var ptsobj = mpld3.get_element(this.props.idpts, this.fig); var drag = d3.behavior.drag() .origin(function(d) { return {x:ptsobj.ax.x(d[0]), y:ptsobj.ax.y(d[1])}; }) .on("dragstart", dragstarted) .on("drag", dragged) .on("dragend", dragended); patchobj.path.attr("d", patchobj.datafunc(ptsobj.offsets, patchobj.pathcodes)); patchobj.data = ptsobj.offsets; ptsobj.elements() .data(ptsobj.offsets) .style("cursor", "default") .call(drag); function dragstarted(d) { d3.event.sourceEvent.stopPropagation(); d3.select(this).classed("dragging", true); } function dragged(d, i) { d[0] = ptsobj.ax.x.invert(d3.event.x); d[1] = ptsobj.ax.y.invert(d3.event.y); d3.select(this) .attr("transform", "translate(" + [d3.event.x,d3.event.y] + ")"); patchobj.path.attr("d", patchobj.datafunc(ptsobj.offsets, patchobj.pathcodes)); } function dragended(d, i) { d3.select(this).classed("dragging", false); } } mpld3.register_plugin("drag", DragPlugin); """ def __init__(self, points, patch): print "Points ID : ", utils.get_id(points) self.dict_ = {"type": "drag", "idpts": utils.get_id(points), "idpatch": utils.get_id(patch)} However, when I try to link the plugin to a figure, as in plugins.connect(fig, DragPlugin(points[0], patch)) I get an error, 'module' is not callable, pointing to this line. What does this mean and why doesn't it work? Thanks. I'm adding additional code to show that linking more than one Plugin might be problematic. But this may be entirely due to some silly mistake on my part, or there is a way around it. The following code based on LinkedViewPlugin generates three panels, in which the top and the bottom panel are supposed to be identical. Mouseover in the middle panel was expected to control the display in the top and bottom panels, but updates occur in the bottom panel only. It would be nice to be able to figure out how to reflect the changes in multiple panels. Thanks. import matplotlib import matplotlib.pyplot as plt import numpy as np import mpld3 from mpld3 import plugins, utils class LinkedView(plugins.PluginBase): """A simple plugin showing how multiple axes can be linked""" JAVASCRIPT = """ mpld3.register_plugin("linkedview", LinkedViewPlugin); LinkedViewPlugin.prototype = Object.create(mpld3.Plugin.prototype); LinkedViewPlugin.prototype.constructor = LinkedViewPlugin; LinkedViewPlugin.prototype.requiredProps = ["idpts", "idline", "data"]; LinkedViewPlugin.prototype.defaultProps = {} function LinkedViewPlugin(fig, props){ mpld3.Plugin.call(this, fig, props); }; LinkedViewPlugin.prototype.draw = function(){ var pts = mpld3.get_element(this.props.idpts); var line = mpld3.get_element(this.props.idline); var data = this.props.data; function mouseover(d, i){ line.data = data[i]; line.elements().transition() .attr("d", line.datafunc(line.data)) .style("stroke", this.style.fill); } pts.elements().on("mouseover", mouseover); }; """ def __init__(self, points, line, linedata): if isinstance(points, matplotlib.lines.Line2D): suffix = "pts" else: suffix = None self.dict_ = {"type": "linkedview", "idpts": utils.get_id(points, suffix), "idline": utils.get_id(line), "data": linedata} class LinkedView2(plugins.PluginBase): """A simple plugin showing how multiple axes can be linked""" JAVASCRIPT = """ mpld3.register_plugin("linkedview", LinkedViewPlugin2); LinkedViewPlugin2.prototype = Object.create(mpld3.Plugin.prototype); LinkedViewPlugin2.prototype.constructor = LinkedViewPlugin2; LinkedViewPlugin2.prototype.requiredProps = ["idpts", "idline", "data"]; LinkedViewPlugin2.prototype.defaultProps = {} function LinkedViewPlugin2(fig, props){ mpld3.Plugin.call(this, fig, props); }; LinkedViewPlugin2.prototype.draw = function(){ var pts = mpld3.get_element(this.props.idpts); var line = mpld3.get_element(this.props.idline); var data = this.props.data; function mouseover(d, i){ line.data = data[i]; line.elements().transition() .attr("d", line.datafunc(line.data)) .style("stroke", this.style.fill); } pts.elements().on("mouseover", mouseover); }; """ def __init__(self, points, line, linedata): if isinstance(points, matplotlib.lines.Line2D): suffix = "pts" else: suffix = None self.dict_ = {"type": "linkedview", "idpts": utils.get_id(points, suffix), "idline": utils.get_id(line), "data": linedata} fig, ax = plt.subplots(3) # scatter periods and amplitudes np.random.seed(0) P = 0.2 + np.random.random(size=20) A = np.random.random(size=20) x = np.linspace(0, 10, 100) data = np.array([[x, Ai * np.sin(x / Pi)] for (Ai, Pi) in zip(A, P)]) points = ax[1].scatter(P, A, c=P + A, s=200, alpha=0.5) ax[1].set_xlabel('Period') ax[1].set_ylabel('Amplitude') # create the line object lines = ax[0].plot(x, 0 * x, '-w', lw=3, alpha=0.5) ax[0].set_ylim(-1, 1) ax[0].set_title("Hover over points to see lines") linedata = data.transpose(0, 2, 1).tolist() plugins.connect(fig, LinkedView(points, lines[0], linedata)) # second set of lines exactly the same but in a different panel lines2 = ax[2].plot(x, 0 * x, '-w', lw=3, alpha=0.5) ax[2].set_ylim(-1, 1) ax[2].set_title("Hover over points to see lines #2") plugins.connect(fig, LinkedView2(points, lines2[0], linedata)) mpld3.show()

    Read the article

  • Distance between numpy arrays, columnwise

    - by Jaapsneep
    I have 2 arrays in 2D, where the column vectors are feature vectors. One array is of size F x A, the other of F x B, where A << B. As an example, for A = 2 and F = 3 (B can be anything): arr1 = np.array( [[1, 4], [2, 5], [3, 6]] ) arr2 = np.array( [[1, 4, 7, 10, ..], [2, 5, 8, 11, ..], [3, 6, 9, 12, ..]] ) I want to calculate the distance between arr1 and a fragment of arr2 that is of equal size (in this case, 3x2), for each possible fragment of arr2. The column vectors are independent of each other, so I believe I should calculate the distance between each column vector in arr1 and a collection of column vectors ranging from i to i + A from arr2 and take the sum of these distances (not sure though). Does numpy offer an efficient way of doing this, or will I have to take slices from the second array and, using another loop, calculate the distance between each column vector in arr1 and the corresponding column vector in the slice?

    Read the article

  • Efficient way to store tuples in the datastore

    - by Drew Sears
    If I have a pair of floats, is it any more efficient (computationally or storage-wise) to store them as a GeoPtProperty than it would be pickle the tuple and store it as a BlobProperty? If GeoPt is doing something more clever to keep multiple values in a single property, can it be leveraged for arbitrary data? Can I store the tuple ("Johnny", 5) in a single entity property in a similarly efficient manner?

    Read the article

  • ProgrammingError: (1146, "Table 'test_<DB>.<TABLE>' doesn't exist") when running unit test for Djang

    - by abigblackman
    I'm running a unit test using the Django framework and get this error. Running the actual code does not have this problem, running the unit tests creates a test database on the fly so I suspect the issue lies there. The code that throws the error looks like this member = Member.objects.get(email=email_address) and the model looks like class Member(models.Model): member_id = models.IntegerField(primary_key=True) created_on = models.DateTimeField(editable=False, default=datetime.datetime.utcnow()) flags = models.IntegerField(default=0) email = models.CharField(max_length=150, blank=True) phone = models.CharField(max_length=150, blank=True) country_iso = models.CharField(max_length=6, blank=True) location_id = models.IntegerField(null=True, blank=True) facebook_uid = models.IntegerField(null=True, blank=True) utc_offset = models.IntegerField(null=True, blank=True) tokens = models.CharField(max_length=3000, blank=True) class Meta: db_table = u'member' there's nothing too odd there i can see. the user running the tests has the same permissions to the database server as the user that runs the website where else can I look to see what's going wrong, why is this table not being created?

    Read the article

  • PyGTK: Trouble with size of ScrolledWindow

    - by canavanin
    Hi everyone! I am using PyGTK and the gtk.Assistant. On one page I have placed a treeview (one column, just strings) in a gtk.ScrolledWindow (I wanted the vertical scrollbar, since the list contains about 35 items). Everything is working fine; the only thing that bugs me is that I have not been able to figure out from the documentation how to set the size of the scrolled window. Currently only three items are displayed at a time; I would like to set this number to 10 or so. Below is the code. As you can see I have tried using a gtk.Adjustment to influence the scrolled window's size, but as - once more - I have been incompetent at retrieving the required info from the documentation, I don't actually know what values should be put into there. self.page7 = gtk.VBox() # The gtk.Adjustment: page_size = gtk.Adjustment(lower=10, page_size=100) # just used some arbitrary numbers here >_< scrolled_win = gtk.ScrolledWindow(page_size) scrolled_win.set_policy(gtk.POLICY_AUTOMATIC, gtk.POLICY_AUTOMATIC) # only display scroll bars when required self.character_traits_treeview = gtk.TreeView() self.character_traits_treestore = gtk.TreeStore(str) self.character_traits_treeview.set_model(self.character_traits_treestore) tc = gtk.TreeViewColumn("Character traits") self.character_traits_treeview.append_column(tc) cr = gtk.CellRendererText() tc.pack_start(cr, True) tc.add_attribute(cr, "text", 0) self.character_trait_selection = self.character_traits_treeview.get_selection() self.character_trait_selection.connect('changed', self.check_number_of_character_trait_selections) self.character_trait_selection.set_mode(gtk.SELECTION_MULTIPLE) self.make_character_traits_treestore() # adding the treeview to the scrolled window: scrolled_win.add(self.character_traits_treeview) self.page7.pack_start(scrolled_win, False, False, 0) self.assistant.append_page(self.page7) self.assistant.set_page_title(self.page7, "Step 7: Select 2-3 character traits") self.assistant.set_page_type(self.page7, gtk.ASSISTANT_PAGE_CONTENT) self.assistant.set_page_complete(self.page7, False) def check_number_of_character_trait_selections(self, blah): # ... def make_character_traits_treestore(self): # ... I know I should RTFM, but as I can't make head or tail of it, and as further searching, too, has been to no avail, I'm just hoping that someone on here can give me a hint. Thanks a lot in advance! PS: Here are the links to: the gtk.ScrolledWindow documentation the gtk.Adjustment documentation

    Read the article

  • How to get a template tag to auto-check a checkbox in Django

    - by Daniel Quinn
    I'm using a ModelForm class to generate a bunch of checkboxes for a ManyToManyField but I've run into one problem: while the default behaviour automatically checks the appropriate boxes (when I'm editing an object), I can't figure out how to get that information in my own custom templatetag. Here's what I've got in my model: ... from django.forms import CheckboxSelectMultiple, ModelMultipleChoiceField interests = ModelMultipleChoiceField(widget=CheckboxSelectMultiple(), queryset=Interest.objects.all(), required=False) ... And here's my templatetag: @register.filter def alignboxes(boxes, cls): """ Details on how this works can be found here: http://docs.djangoproject.com/en/1.1/howto/custom-template-tags/ """ r = "" i = 0 for box in boxes.field.choices.queryset: r += "<label for=\"id_%s_%d\" class=\"%s\"><input type=\"checkbox\" name=\"%s\" value=\"%s\" id=\"id_%s_%d\" /> %s</label>\n" % ( boxes.name, i, cls, boxes.name, box.id, boxes.name, i, box.name ) i = i + 1 return mark_safe(r) The thing is, I'm only doing this so I can wrap some simpler markup around these boxes, so if someone knows how to make that happen in an easier way, I'm all ears. I'd be happy with knowing a way to access whether or not a box should be checked though.

    Read the article

  • Django save method

    - by Marijus
    So I have a model with a FileField for excel spreadsheet. What I need to do this add another column in this spreadsheet, in each row let user pick from a drop-down list then save it and display it in html. All the picking and uploading will happen through the admin interface. So I have figured out way how to display a spreadsheet in html, however I have no idea how to write this save method. I could really use some hints and tips..

    Read the article

< Previous Page | 430 431 432 433 434 435 436 437 438 439 440 441  | Next Page >