Search Results

Search found 3929 results on 158 pages for 'genome assembly'.

Page 43/158 | < Previous Page | 39 40 41 42 43 44 45 46 47 48 49 50  | Next Page >

  • File not found - MOSS 2007

    - by isimple
    i received the following error on some Sharepoint Pages File Not Found. at System.Reflection.Assembly._nLoad(AssemblyName fileName, String codeBase, Evidence assemblySecurity, Assembly locationHint, StackCrawlMark& stackMark, Boolean throwOnFileNotFound, Boolean forIntrospection) at System.Reflection.Assembly.nLoad(AssemblyName fileName, String codeBase, Evidence assemblySecurity, Assembly locationHint, StackCrawlMark& stackMark, Boolean throwOnFileNotFound, Boolean forIntrospection) at System.Reflection.Assembly.InternalLoad(AssemblyName assemblyRef, Evidence assemblySecurity, StackCrawlMark& stackMark, Boolean forIntrospection) at System.Reflection.Assembly.InternalLoad(String assemblyString, Evidence assemblySecurity, StackCrawlMark& stackMark, Boolean forIntrospection) at System.Reflection.Assembly.Load(String assemblyString) at System.Web.Configuration.CompilationSection.LoadAssembly(String assemblyName, Boolean throwOnFail) at System.Web.UI.TemplateParser.LoadAssembly(String assemblyName, Boolean throwOnFail) at System.Web.UI.MainTagNameToTypeMapper.ProcessTagNamespaceRegistrationCore(TagNamespaceRegisterEntry nsRegisterEntry) at System.Web.UI.MainTagNameToTypeMapper.ProcessTagNamespaceRegistration(TagNamespaceRegisterEntry nsRegisterEntry) at System.Web.UI.BaseTemplateParser.ProcessDirective(String directiveName, IDictionary directive) at System.Web.UI.TemplateControlParser.ProcessDirective(String directiveName, IDictionary directive) at System.Web.UI.PageParser.ProcessDirective(String directiveName, IDictionary directive) at System.Web.UI.TemplateParser.ParseStringInternal(String text, Encoding fileEncoding) I used Assembly Binding Log Viewer Tool (fuslogvw.exe) to locate the assembly which is not bound and the assembly seems to be Microsoft.Sharepoint.Intl.Resources.dll. This assemlby is not being located by the application resulting in 'File not Found' error. Can anyone guide me how to solve this?

    Read the article

  • What VC++ compiler/linker does when building a C++ project with Managed Extension

    - by ???
    The initial problem is that I tried to rebuild a C++ project with debug symbols and copied it to test machine, The output of the project is external COM server(.exe file). When calling the COM interface function, there's a RPC call failre: COMException(0x800706BE): The remote procedure call failed. According to the COM HRESULT design, if the FACILITY code is 7, it's actually a WIN32 error, and the win32 error code is 0x6BE, which is the above mentioned "remote procedure call failed". All I do is replace the COM server .exe file, the origin file works well. When I checked into the project, I found it's a C++ project with Managed Extension. When I checking the DLL with reflector, it shows there's 2 additional .NET assembly reference. Then I checked the project setting and found nothing about the extra 2 assembly reference. I turned on the show includes option of compiler and verbose library of linker, and try to analyze whether the assembly is indirectly referenced via .h file. I've collect all the .h file and grep all the files with '#using' '#import' and the assembly file itself. There really is a '#using ' in one of the .h file but not-relevant to the referenced assembly. And about the linked .lib library files, only one of the .lib file is a side-product of another managed-extension-enabled C++ project, all others are produced by a pure, traditional C++ project. For the managed-extension-enabled C++ project, I checked the output DLL assembly, it did NOT reference to the 2 assembly. I even try to capture the access of the additional assembly file via sysinternal's filemon and procmon, but the rebuild process does NOT access these file. I'm very confused about the compile and linking process model of a VC++/CLI project, where the additional assembly reference slipped into the final assembly? Thanks in advance for any of your help.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • What is New in ASP.NET 4.0 Code Access Security

    - by Xiaohong
    ASP.NET Code Access Security (CAS) is a feature that helps protect server applications on hosting multiple Web sites, ASP.NET lets you assign a configurable trust level that corresponds to a predefined set of permissions. ASP.NET has predefined ASP.NET Trust Levels and Policy Files that you can assign to applications, you also can assign custom trust level and policy files. Most web hosting companies run ASP.NET applications in Medium Trust to prevent that one website affect or harm another site etc. As .NET Framework's Code Access Security model has evolved, ASP.NET 4.0 Code Access Security also has introduced several changes and improvements. The main change in ASP.NET 4.0 CAS In ASP.NET v4.0 partial trust applications, application domain can have a default partial trust permission set as opposed to being full-trust, the permission set name is defined in the <trust /> new attribute permissionSetName that is used to initialize the application domain . By default, the PermissionSetName attribute value is "ASP.Net" which is the name of the permission set you can find in all predefined partial trust configuration files. <trust level="Something" permissionSetName="ASP.Net" /> This is ASP.NET 4.0 new CAS model. For compatibility ASP.NET 4.0 also support legacy CAS model where application domain still has full trust permission set. You can specify new legacyCasModel attribute on the <trust /> element to indicate whether the legacy CAS model is enabled. By default legacyCasModel is false which means that new 4.0 CAS model is the default. <trust level="Something" legacyCasModel="true|false" /> In .Net FX 4.0 Config directory, there are two set of predefined partial trust config files for each new CAS model and legacy CAS model, trust config files with name legacy.XYZ.config are for legacy CAS model: New CAS model: Legacy CAS model: web_hightrust.config legacy.web_hightrust.config web_mediumtrust.config legacy.web_mediumtrust.config web_lowtrust.config legacy.web_lowtrust.config web_minimaltrust.config legacy.web_minimaltrust.config   The figure below shows in ASP.NET 4.0 new CAS model what permission set to grant to code for partial trust application using predefined partial trust levels and policy files:    There also some benefits that comes with the new CAS model: You can lock down a machine by making all managed code no-execute by default (e.g. setting the MyComputer zone to have no managed execution code permissions), it should still be possible to configure ASP.NET web applications to run as either full-trust or partial trust. UNC share doesn’t require full trust with CASPOL at machine-level CAS policy. Side effect that comes with the new CAS model: processRequestInApplicationTrust attribute is deprecated  in new CAS model since application domain always has partial trust permission set in new CAS model.   In ASP.NET 4.0 legacy CAS model or ASP.NET 2.0 CAS model, even though you assign partial trust level to a application but the application domain still has full trust permission set. The figure below shows in ASP.NET 4.0 legacy CAS model (or ASP.NET 2.0 CAS model) what permission set to grant to code for partial trust application using predefined partial trust levels and policy files:     What $AppDirUrl$, $CodeGen$, $Gac$ represents: $AppDirUrl$ The application's virtual root directory. This allows permissions to be applied to code that is located in the application's bin directory. For example, if a virtual directory is mapped to C:\YourWebApp, then $AppDirUrl$ would equate to C:\YourWebApp. $CodeGen$ The directory that contains dynamically generated assemblies (for example, the result of .aspx page compiles). This can be configured on a per application basis and defaults to %windir%\Microsoft.NET\Framework\{version}\Temporary ASP.NET Files. $CodeGen$ allows permissions to be applied to dynamically generated assemblies. $Gac$ Any assembly that is installed in the computer's global assembly cache (GAC). This allows permissions to be granted to strong named assemblies loaded from the GAC by the Web application.   The new customization of CAS Policy in ASP.NET 4.0 new CAS model 1. Define which named permission set in partial trust configuration files By default the permission set that will be assigned at application domain initialization time is the named "ASP.Net" permission set found in all predefined partial trust configuration files. However ASP.NET 4.0 allows you set PermissionSetName attribute to define which named permission set in a partial trust configuration file should be the one used to initialize an application domain. Example: add "ASP.Net_2" named permission set in partial trust configuration file: <PermissionSet class="NamedPermissionSet" version="1" Name="ASP.Net_2"> <IPermission class="FileIOPermission" version="1" Read="$AppDir$" PathDiscovery="$AppDir$" /> <IPermission class="ReflectionPermission" version="1" Flags ="RestrictedMemberAccess" /> <IPermission class="SecurityPermission " version="1" Flags ="Execution, ControlThread, ControlPrincipal, RemotingConfiguration" /></PermissionSet> Then you can use "ASP.Net_2" named permission set for the application domain permission set: <trust level="Something" legacyCasModel="false" permissionSetName="ASP.Net_2" /> 2. Define a custom set of Full Trust Assemblies for an application By using the new fullTrustAssemblies element to configure a set of Full Trust Assemblies for an application, you can modify set of partial trust assemblies to full trust at the machine, site or application level. The configuration definition is shown below: <fullTrustAssemblies> <add assemblyName="MyAssembly" version="1.1.2.3" publicKey="hex_char_representation_of_key_blob" /></fullTrustAssemblies> 3. Define <CodeGroup /> policy in partial trust configuration files ASP.NET 4.0 new CAS model will retain the ability for developers to optionally define <CodeGroup />with membership conditions and assigned permission sets. The specific restriction in ASP.NET 4.0 new CAS model though will be that the results of evaluating custom policies can only result in one of two outcomes: either an assembly is granted full trust, or an assembly is granted the partial trust permission set currently associated with the running application domain. It will not be possible to use custom policies to create additional custom partial trust permission sets. When parsing the partial trust configuration file: Any assemblies that match to code groups associated with "PermissionSet='FullTrust'" will run at full trust. Any assemblies that match to code groups associated with "PermissionSet='Nothing'" will result in a PolicyError being thrown from the CLR. This is acceptable since it provides administrators with a way to do a blanket-deny of managed code followed by selectively defining policy in a <CodeGroup /> that re-adds assemblies that would be allowed to run. Any assemblies that match to code groups associated with other permissions sets will be interpreted to mean the assembly should run at the permission set of the appdomain. This means that even though syntactically a developer could define additional "flavors" of partial trust in an ASP.NET partial trust configuration file, those "flavors" will always be ignored. Example: defines full trust in <CodeGroup /> for my strong named assemblies in partial trust config files: <CodeGroup class="FirstMatchCodeGroup" version="1" PermissionSetName="Nothing"> <IMembershipCondition    class="AllMembershipCondition"    version="1" /> <CodeGroup    class="UnionCodeGroup"    version="1"    PermissionSetName="FullTrust"    Name="My_Strong_Name"    Description="This code group grants code signed full trust. "> <IMembershipCondition      class="StrongNameMembershipCondition" version="1"       PublicKeyBlob="hex_char_representation_of_key_blob" /> </CodeGroup> <CodeGroup   class="UnionCodeGroup" version="1" PermissionSetName="ASP.Net">   <IMembershipCondition class="UrlMembershipCondition" version="1" Url="$AppDirUrl$/*" /> </CodeGroup> <CodeGroup class="UnionCodeGroup" version="1" PermissionSetName="ASP.Net">   <IMembershipCondition class="UrlMembershipCondition" version="1" Url="$CodeGen$/*"   /> </CodeGroup></CodeGroup>   4. Customize CAS policy at runtime in ASP.NET 4.0 new CAS model ASP.NET 4.0 new CAS model allows to customize CAS policy at runtime by using custom HostSecurityPolicyResolver that overrides the ASP.NET code access security policy. Example: use custom host security policy resolver to resolve partial trust web application bin folder MyTrustedAssembly.dll to full trust at runtime: You can create a custom host security policy resolver and compile it to assembly MyCustomResolver.dll with strong name enabled and deploy in GAC: public class MyCustomResolver : HostSecurityPolicyResolver{ public override HostSecurityPolicyResults ResolvePolicy(Evidence evidence) { IEnumerator hostEvidence = evidence.GetHostEnumerator(); while (hostEvidence.MoveNext()) { object hostEvidenceObject = hostEvidence.Current; if (hostEvidenceObject is System.Security.Policy.Url) { string assemblyName = hostEvidenceObject.ToString(); if (assemblyName.Contains(“MyTrustedAssembly.dll”) return HostSecurityPolicyResult.FullTrust; } } //default fall-through return HostSecurityPolicyResult.DefaultPolicy; }} Because ASP.NET accesses the custom HostSecurityPolicyResolver during application domain initialization, and a custom policy resolver requires full trust, you also can add a custom policy resolver in <fullTrustAssemblies /> , or deploy in the GAC. You also need configure a custom HostSecurityPolicyResolver instance by adding the HostSecurityPolicyResolverType attribute in the <trust /> element: <trust level="Something" legacyCasModel="false" hostSecurityPolicyResolverType="MyCustomResolver, MyCustomResolver" permissionSetName="ASP.Net" />   Note: If an assembly policy define in <CodeGroup/> and also in hostSecurityPolicyResolverType, hostSecurityPolicyResolverType will win. If an assembly added in <fullTrustAssemblies/> then the assembly has full trust no matter what policy in <CodeGroup/> or in hostSecurityPolicyResolverType.   Other changes in ASP.NET 4.0 CAS Use the new transparency model introduced in .Net Framework 4.0 Change in dynamically compiled code generated assemblies by ASP.NET: In new CAS model they will be marked as security transparent level2 to use Framework 4.0 security transparent rule that means partial trust code is treated as completely Transparent and it is more strict enforcement. In legacy CAS model they will be marked as security transparent level1 to use Framework 2.0 security transparent rule for compatibility. Most of ASP.NET products runtime assemblies are also changed to be marked as security transparent level2 to switch to SecurityTransparent code by default unless SecurityCritical or SecuritySafeCritical attribute specified. You also can look at Security Changes in the .NET Framework 4 for more information about these security attributes. Support conditional APTCA If an assembly is marked with the Conditional APTCA attribute to allow partially trusted callers, and if you want to make the assembly both visible and accessible to partial-trust code in your web application, you must add a reference to the assembly in the partialTrustVisibleAssemblies section: <partialTrustVisibleAssemblies> <add assemblyName="MyAssembly" publicKey="hex_char_representation_of_key_blob" />/partialTrustVisibleAssemblies>   Most of ASP.NET products runtime assemblies are also changed to be marked as conditional APTCA to prevent use of ASP.NET APIs in partial trust environments such as Winforms or WPF UI controls hosted in Internet Explorer.   Differences between ASP.NET new CAS model and legacy CAS model: Here list some differences between ASP.NET new CAS model and legacy CAS model ASP.NET 4.0 legacy CAS model  : Asp.net partial trust appdomains have full trust permission Multiple different permission sets in a single appdomain are allowed in ASP.NET partial trust configuration files Code groups Machine CAS policy is honored processRequestInApplicationTrust attribute is still honored    New configuration setting for legacy model: <trust level="Something" legacyCASModel="true" ></trust><partialTrustVisibleAssemblies> <add assemblyName="MyAssembly" publicKey="hex_char_representation_of_key_blob" /></partialTrustVisibleAssemblies>   ASP.NET 4.0 new CAS model: ASP.NET will now run in homogeneous application domains. Only full trust or the app-domain's partial trust grant set, are allowable permission sets. It is no longer possible to define arbitrary permission sets that get assigned to different assemblies. If an application currently depends on fine-tuning the partial trust permission set using the ASP.NET partial trust configuration file, this will no longer be possible. processRequestInApplicationTrust attribute is deprecated Dynamically compiled assemblies output by ASP.NET build providers will be updated to explicitly mark assemblies as transparent. ASP.NET partial trust grant sets will be independent from any enterprise, machine, or user CAS policy levels. A simplified model for locking down web servers that only allows trusted managed web applications to run. Machine policy used to always grant full-trust to managed code (based on membership conditions) can instead be configured using the new ASP.NET 4.0 full-trust assembly configuration section. The full-trust assembly configuration section requires explicitly listing each assembly as opposed to using membership conditions. Alternatively, the membership condition(s) used in machine policy can instead be re-defined in a <CodeGroup /> within ASP.NET's partial trust configuration file to grant full-trust.   New configuration setting for new model: <trust level="Something" legacyCASModel="false" permissionSetName="ASP.Net" hostSecurityPolicyResolverType=".NET type string" ></trust><fullTrustAssemblies> <add assemblyName=”MyAssembly” version=”1.0.0.0” publicKey="hex_char_representation_of_key_blob" /></fullTrustAssemblies><partialTrustVisibleAssemblies> <add assemblyName="MyAssembly" publicKey="hex_char_representation_of_key_blob" /></partialTrustVisibleAssemblies>     Hope this post is helpful to better understand the ASP.Net 4.0 CAS. Xiaohong Tang ASP.NET QA Team

    Read the article

  • Entity Framework 4 POCO entities in separate assembly, Dynamic Data Website?

    - by steve.macdonald
    Basically I want to use a dynamic data website to maintain data in an EF4 model where the entities are in their own assembly. Model and context are in another assembly. I tried this http://stackoverflow.com/questions/2282916/entity-framework-4-self-tracking-entities-asp-net-dynamic-data-error but get an "ambiguous match" error from reflection: System.Reflection.AmbiguousMatchException was unhandled by user code Message=Ambiguous match found. Source=mscorlib StackTrace: at System.RuntimeType.GetPropertyImpl(String name, BindingFlags bindingAttr, Binder binder, Type returnType, Type[] types, ParameterModifier[] modifiers) at System.Type.GetProperty(String name) at System.Web.DynamicData.ModelProviders.EFTableProvider..ctor(EFDataModelProvider dataModel, EntitySet entitySet, EntityType entityType, Type entityClrType, Type parentEntityClrType, Type rootEntityClrType, String name) at System.Web.DynamicData.ModelProviders.EFDataModelProvider.CreateTableProvider(EntitySet entitySet, EntityType entityType) at System.Web.DynamicData.ModelProviders.EFDataModelProvider..ctor(Object contextInstance, Func1 contextFactory) at System.Web.DynamicData.ModelProviders.SchemaCreator.CreateDataModel(Object contextInstance, Func1 contextFactory) at System.Web.DynamicData.MetaModel.RegisterContext(Func`1 contextFactory, ContextConfiguration configuration) at WebApplication1.Global.RegisterRoutes(RouteCollection routes) in C:\dev\Puffin\Puffin.Prototype.Web\Global.asax.cs:line 42 at WebApplication1.Global.Application_Start(Object sender, EventArgs e) in C:\dev\Puffin\Puffin.Prototype.Web\Global.asax.cs:line 78 InnerException:

    Read the article

  • Should I auto-increment the assembly version when I build my software?

    - by rwmnau
    In Visual Studio 2003, you could easily set your project assembly to auto-increment every time you built it, but with Visual Studio 2005, this functionality was removed. You can still auto-increment your assembly version on every build, but it's a complicated custom build step instead of an integrated feature. I'm not sure why this was removed, but here's a question I should have asked a while ago - Should I be using a workaround to continue to auto-increment when I build, or is there a good reason to stop doing this, in favor of manually incrementing? Since Microsoft removed it from VS, perhaps there's a good reason, and I'm wondering if anybody knows it.

    Read the article

  • How to configure .NET test assembly to use website web.config?

    - by Morten Christiansen
    I've run into a problem setting up Selenium tests for an ASP.NET MVC project in cases where I need the settings provided in the web.config of the site under test. The problem is that I want to create a dummy user before running the test and this causes an error saying that the password-answer supplied is invalid. This is due to the test assembly not using the web.config, instead using default values for membership configuration. I've tried to copy the relevant section (membership configuration) into the app.config of the assembly without luck, but I admit I'm just grasping at straws here.

    Read the article

  • Stupid automatic assembly copy problem in Visual Studio 2008 - WTH am I doing wrong?

    - by Dave
    My lazier side has apparently gotten the best of me. When I started to develop with .NET under VS2008 recently, I was very happy to see that all of the dependencies automagically got copied to my application's bin/debug folder upon compilation. This is fantastic. I never even bothered to look into how / why this is done. Yesterday, I decided to make another plugin very similar to an existing one, so I literally copied the folder and all of project files, then renamed the folder and manually edited the project files and file references. I also changed the assembly's GUID. Everything builds fine, but this particular assembly is never copied into my application's bin/debug folder. It is marked as a dependency of my app as well. What did I miss here?

    Read the article

  • Runnin Framework 4.0 with Powershell

    - by Mike Koerner
    I had problems running scripts with Framework 4.0 assemblies I created.  The error I was getting was  Add-Type : Could not load file or assembly 'file:///C:\myDLL.dll' or one of its dependencies. This assembly is built by a runtime newer than the currently loaded runtime and cannot be loaded. I had to add the supported framework to the powershell.exe.config file.<supportedRuntime version="v4.0.30319"/>I still had a problem running the assembly so I had to recompile and set "Generate serialization Assembly" to off.

    Read the article

  • Activation context generation failed for "C:\php\php-cgi.exe". Dependent Assembly

    - by Eyla
    Greeting, I have Windows Server 2008 Server Core. I want to configure this server to host php websites using IIS 7. I installed and configured IIS7 to run php using the steps in this website: http://blogs.msdn.com/b/philpenn/archive/2009/07/19/deploying-iis-7-5-fastcgi-php-on-server-core.aspx Now I’m facing a problem that when I request my php website I would get this error. Server Error 500 - Internal server error. There is a problem with the resource you are looking for, and it cannot be displayed. I check the even log and I found these details too: Activation context generation failed for "C:\php\php-cgi.exe". Dependent Assembly Microsoft.VC90.CRT,processorArchitecture="x86",publicKeyToken="1fc8b3b9a1e18e3b",type="win32",version="9.0.21022.8" could not be found. Please use sxstrace.exe for detailed diagnosis. I search about this error and I found a solution for it but which is to install Microsoft Visual C++ 2008 SP1 Redistributable Package (x86). I installed but still I’m getting same error. Please help me to solve this problem and let me know if you want to know more info about my issue.

    Read the article

  • WIX installer with Custom Actions: "built by a runtime newer than the currently loaded runtime and cannot be loaded."

    - by Rimer
    I have a WIX installer that executes Custom Actions over the course of install. When I run the WIX installer, and it encounters its first Custom Action, the installer fails out, and I receive an error in the MSI log as follows: Action start 12:03:53: LoadBCAConfigDefaults. SFXCA: Extracting custom action to temporary directory: C:\DOCUME~1\ELOY06~1\LOCALS~1\Temp\MSI10C.tmp-\ SFXCA: Binding to CLR version v2.0.50727 Calling custom action WIXCustomActions!WIXCustomActions.CustomActions.LoadBCAConfigDefaults Error: could not load custom action class WIXCustomActions.CustomActions from assembly: WIXCustomActions System.BadImageFormatException: Could not load file or assembly 'WIXCustomActions' or one of its dependencies. This assembly is built by a runtime newer than the currently loaded runtime and cannot be loaded. File name: 'WIXCustomActions' at System.Reflection.Assembly._nLoad(AssemblyName fileName, String codeBase, Evidence assemblySecurity, Assembly locationHint, StackCrawlMark& stackMark, Boolean throwOnFileNotFound, Boolean forIntrospection) at System.Reflection.Assembly.nLoad(AssemblyName fileName, String codeBase, Evidence assemblySecurity, Assembly locationHint, StackCrawlMark& stackMark, Boolean throwOnFileNotFound, Boolean forIntrospection) at System.Reflection.Assembly.InternalLoad(AssemblyName assemblyRef, Evidence assemblySecurity, StackCrawlMark& stackMark, Boolean forIntrospection) at System.Reflection.Assembly.InternalLoad(String assemblyString, Evidence assemblySecurity, StackCrawlMark& stackMark, Boolean forIntrospection) at System.AppDomain.Load(String assemblyString) at Microsoft.Deployment.WindowsInstaller.CustomActionProxy.GetCustomActionMethod(Session session, String assemblyName, String className, String methodName) ... the specific problem from above is "System.BadImageFormatException: Could not load file or assembly 'WIXCustomActions' or one of its dependencies. This assembly is built by a runtime newer than the currently loaded runtime and cannot be loaded." The wordage of that error seems to indicate something like an incorrectly referenced .NET framework or something (I'm targeting 3.5 in both my custom actions and its dependencies), but I can't figure out where to make a change to address this problem. Any ideas? .... Not sure if this will help but it's the CustomActions package batch file I run to create the .dll package containing the custom action functions: =============== call "C:\Program Files\Microsoft Visual Studio 10.0\VC\vcvarsall.bat" @echo on cd "C:\development\trunk\PortalsDev\csharp\production\Installers\WIX\customactions\PAServicesWIXCustomActions" csc /target:library /r:"C:\program files\windows installer xml v3.6\sdk\microsoft.deployment.windowsinstaller.dll" /r:"C:\development\trunk\PortalsDev\csharp\production\Installers\WIX\customactions\PAServicesWIXCustomActions\bin\Debug\eLoyalty.PortalLib.dll" /out:"C:\development\trunk\PortalsDev\csharp\production\Installers\WIX\customactions\PAServicesWIXCustomActions\bin\Debug\WIXCustomActions.dll" CustomActions.cs cd "C:\Program Files\Windows Installer XML v3.6\SDK" makesfxca "C:\development\trunk\PortalsDev\csharp\production\Installers\WIX\customactions\PAServicesWIXCustomActions\bin\Debug\BatchCustomerAnalysisWIXCustomActionsPackage.dll" "c:\program files\windows installer xml v3.6\sdk\x86\sfxca.dll" "C:\development\trunk\PortalsDev\csharp\production\Installers\WIX\customactions\PAServicesWIXCustomActions\bin\Debug\WIXCustomActions.dll" customaction.config Microsoft.Deployment.WindowsInstaller.dll

    Read the article

  • Speech recognition plugin Runtime Error: Unhandled Exception. What could possibly cause it?

    - by manuel
    I'm writing a plugin (dll file) for speech recognition, and I'm creating a WinForm as its interface/dialog. When I run the plugin and click a button to start the initialization, I get an unhandled exception. Below is the complete details of it. See the end of this message for details on invoking just-in-time (JIT) debugging instead of this dialog box. ***** Exception Text ******* System.ArgumentException: Value does not fall within the expected range. at System.Speech.Internal.SapiInterop.SapiProxy.MTAThread.Invoke2(VoidDelegate pfn) at System.Speech.Internal.SapiInterop.SapiRecognizer.SetInput(Object input, Boolean allowFormatChanges) at System.Speech.Recognition.RecognizerBase.SetInputToDefaultAudioDevice() at System.Speech.Recognition.SpeechRecognitionEngine.SetInputToDefaultAudioDevice() at gen_myplugin.Dialog.init() at gen_myplugin.Dialog.btnSpeak_Click(Object sender, EventArgs e) at System.Windows.Forms.Control.OnClick(EventArgs e) at System.Windows.Forms.Button.OnClick(EventArgs e) at System.Windows.Forms.Button.OnMouseUp(MouseEventArgs mevent) at System.Windows.Forms.Control.WmMouseUp(Message& m, MouseButtons button, Int32 clicks) at System.Windows.Forms.Control.WndProc(Message& m) at System.Windows.Forms.ButtonBase.WndProc(Message& m) at System.Windows.Forms.Button.WndProc(Message& m) at System.Windows.Forms.Control.ControlNativeWindow.OnMessage(Message& m) at System.Windows.Forms.Control.ControlNativeWindow.WndProc(Message& m) at System.Windows.Forms.NativeWindow.Callback(IntPtr hWnd, Int32 msg, IntPtr wparam, IntPtr lparam) ***** Loaded Assemblies ******* mscorlib Assembly Version: 2.0.0.0 Win32 Version: 2.0.50727.3603 (GDR.050727-3600) CodeBase: file:///c:/WINDOWS/Microsoft.NET/Framework/v2.0.50727/mscorlib.dll ---------------------------------------- gen_speechquery Assembly Version: 1.0.3755.878 Win32 Version: CodeBase: file:///C:/Program%20Files/Winamp/Plugins/gen_speechquery.dll ---------------------------------------- msvcm90 Assembly Version: 9.0.30729.1 Win32 Version: 9.00.30729.1 CodeBase: file:///C:/WINDOWS/WinSxS/x86_Microsoft.VC90.CRT_1fc8b3b9a1e18e3b_9.0.30729.1_x-ww_6f74963e/msvcm90.dll ---------------------------------------- System.Windows.Forms Assembly Version: 2.0.0.0 Win32 Version: 2.0.50727.3053 (netfxsp.050727-3000) CodeBase: file:///C:/WINDOWS/assembly/GAC_MSIL/System.Windows.Forms/2.0.0.0__b77a5c561934e089/System.Windows.Forms.dll ---------------------------------------- System Assembly Version: 2.0.0.0 Win32 Version: 2.0.50727.3053 (netfxsp.050727-3000) CodeBase: file:///C:/WINDOWS/assembly/GAC_MSIL/System/2.0.0.0__b77a5c561934e089/System.dll ---------------------------------------- System.Drawing Assembly Version: 2.0.0.0 Win32 Version: 2.0.50727.3053 (netfxsp.050727-3000) CodeBase: file:///C:/WINDOWS/assembly/GAC_MSIL/System.Drawing/2.0.0.0__b03f5f7f11d50a3a/System.Drawing.dll ---------------------------------------- System.Speech Assembly Version: 3.0.0.0 Win32 Version: 3.0.6920.1109 (lh_tools_devdiv_wpf.071009-1109) CodeBase: file:///C:/WINDOWS/assembly/GAC_MSIL/System.Speech/3.0.0.0__31bf3856ad364e35/System.Speech.dll ***** JIT Debugging ******* To enable just-in-time (JIT) debugging, the .config file for this application or computer (machine.config) must have the jitDebugging value set in the system.windows.forms section. The application must also be compiled with debugging enabled. For example: When JIT debugging is enabled, any unhandled exception will be sent to the JIT debugger registered on the computer rather than be handled by this dialog box.

    Read the article

  • That assembly does not allow partially trusted callers although the zone is fully trusted.

    - by Frederik Gheysels
    Since yesterday, I receive a security exception when I want to run a unit-test from within VS.NET 2008. The error goes like this: SecurityException: that assembly does not allow partially trusted callers ... The assembly that failed was : file:///S:/MyProject/MyAssembly.dll The S: drive is a mapped drive which points to a physical location on my disk. What I find very strange, is that this used to work for months previously. I mean, I did this all the time. In order to get this to work, I 've created a new security zone with the caspol utility in order to give this S: network share drive FullTrust. In other words, when I run caspol -m -lg I see this (I removed the other zones for the sake of brevity): 1.2. Zone - Intranet: LocalIntranet 1.2.1. All code: Same site Web 1.2.2. All code: Same directory FileIO - 'Read, PathDiscovery' 1.2.3. Url - file://R:/*: FullTrust 1.2.4. Url - file://S:/*: FullTrust 1.2.5. Url - file:///S:/*: FullTrust I've added the 1.2.5 zone just recently because the error that was given, mentionned file:///s:/.... Any ideas ? Could it be that this has something to do with the installation of VS.NET 2010 or the .NET Framework version 4.0 ?

    Read the article

  • IIS 7.5 refuses to load 64-bit assembly - possible CAS problem?

    - by Rune
    Hi, I just downloaded the Orchard CMS, opened it up in VS2008 and hit F5: Everything runs fine. I then created a website in IIS 7.5 and pointed it to the web project's directory and set up permissions correctly (I hope). I downloaded the 64-bit version System.Data.SQLite as suggested here: Orchard Work Item 14798 and here: SO: Could not load file or assembly 'System.Data.SQLite'. The site runs in Full Trust. When I point my browser to the site running through IIS I get Could not load file or assembly 'System.Data.SQLite, Version=1.0.65.0, Culture=neutral, PublicKeyToken=db937bc2d44ff139' or one of its dependencies. Failed to grant minimum permission requests. I don't know much about Code Access Security (if that is even what's at play here), so I am at a loss here. What am I doing wrong / not understanding / not seeing? How do I provide appropriate permissions and to whom / what? Is there any hope of ever deploying this application to a hoster where I am only allowed to run in Medium Trust? Any help, pointers or suggestions would be greatly appreciated. Thanks. NOTE: the question is not why this initially worked when run through Cassini. The answer to that question is contained in the answer to the SO question referenced above.

    Read the article

  • How do I reference an unsigned assembly from a VSTO Word Doc project?

    - by Gishu
    I created a new project in VS2008. Project type Visual C# > Office > 2007 > Word 2007 Document Added some code.. got Word to do a few jumps through some custom hoops.. all fine. Now I need to reference another assembly (CopyLocal as false) which is not signed. So I add the project reference. Now the project will not build complaining error MSB3188: Assembly 'X.dll' must be strong signed in order to be marked as a prerequisite. The error code page is concise (now accustomed to this) Been googling and reading posts ever since.. No Luck. How do I get around this ? Or is the hidden commandment that all references (for VSTO?) must be strong named / signed. I cannot sign 'X.dll' and be done with it because it is a binary that I don't control also it depends on another bunch of unsigned dlls.. can't set off a chain sign reaction. Update: Solved the build issue by turning CopyLocal=True. But this meant dumping the referenced X.DLL and all its dependencies into the bin\debug folder... Ughh! Tried creating a subfolder called bin\debug\refExecs and referencing X.dll CopyLocal=false from there. The error message was back.

    Read the article

  • Clarification needed: How does .NET runtime resolve assembly references from parent folder?

    - by aoven
    I have the following output structure of executables in my solution: %ProgramFiles% | +-[MyAppName] | +-[Client] | | | +-(EXE & several DLL assemblies) | +-[Common] | | | +-[Schema Assemblies] | | | | | +-(several DLL assemblies) | | | +-(several DLL assemblies) | +-[Server] | +-(EXE & several DLL assemblies) Each project in solution references different DLL assemblies, some of which are outputs from other projects in solution, and others are plain 3rd-party assemblies. For example, [Client] EXE might reference an assembly in [Common], which is in a different directory branch. All references have "Copy Local" set to false, to mirror the layout of the files in the final installed application. Now, if I take a look at reference properties in the Visual Studio IDE, I see that "Path" of every reference is absolute and that it corresponds to the actual output location of the assembly. That's understandable and correct. As expected, solution compiles and runs just fine. What I don't understand is, why everything seems to work even when I close the IDE, rename the [MyAppName] directory and run the [Client] EXE manually? How does the runtime find the assemblies if the reference paths aren't the same as they were at the time of linking? To be clear - this is actually exactly what I'm after: a semi-dispersed set of application files that run fine regardless of where the [MyAppName] directory is located or even what it's named. I'd just like to know, how and why this works without any specific path resolution on my part. I've read the answers to this similar question, but I still don't get it. Help much appreciated!

    Read the article

  • Is it possible to load an assembly targeting a different .NET runtime version in a new app domain?

    - by Notre
    Hello, I've an application that is based on .NET 2 runtime. I want to add a little bit of support for .NET 4 but don't want to (in the short term), convert the whole application (which is very large) to target .NET 4. I tried the 'obvious' approach of creating an application .config file, having this: <startup useLegacyV2RuntimeActivationPolicy="true"> <supportedRuntime version="v4.0" /> </startup> but I ran into some problems that I noted here. I got the idea of creating a separate app domain. To test it, I created a WinForm project targeting .NET 2. I then created a class library targeting .NET 4. In my WinForm project, I added the following code: AppDomainSetup setup = new AppDomainSetup(); setup.ApplicationBase = "path to .NET 4 assembly"; setup.ConfigurationFile = System.Environment.CurrentDirectory + "\\DotNet4AppDomain.exe.config"; // Set up the Evidence Evidence baseEvidence = AppDomain.CurrentDomain.Evidence; Evidence evidence = new Evidence(baseEvidence); // Create the AppDomain AppDomain dotNet4AppDomain = AppDomain.CreateDomain("DotNet4AppDomain", evidence, setup); try { Assembly doNet4Assembly = dotNet4AppDomain.Load( new AssemblyName("MyDotNet4Assembly, Version=1.0.0.0, Culture=neutral, PublicKeyToken=66f0dac1b575e793")); MessageBox.Show(doNet4Assembly.FullName); } finally { AppDomain.Unload(dotNet4AppDomain); } My DotNet4AppDomain.exe.config file looks like this: <startup useLegacyV2RuntimeActivationPolicy="true"> <supportedRuntime version="v4.0" /> </startup> Unfortunately, this throws the BadImageFormatException when dotNet4AppDomain.Load is executed. Am I doing something wrong in my code, or is what I'm trying to do just not going to work? Thank you!

    Read the article

  • Can I use encrypt web.config with a custom protection provider who's assembly is not in the GAC?

    - by James
    I have written a custom protected configuration provider for my web.config. When I try to encrypt my web.config with it I get the following error from aspnet_iisreg aspnet_regiis.exe -pef appSettings . -prov CustomProvider (This is running in my MSBuild) Could not load file or assembly 'MyCustomProviderNamespace' or one of its dependencies. The system cannot find the file specified. After checking with the Fusion log, I confirm it is checking both the GAC, and 'C:/WINNT/Microsoft.NET/Framework/v2.0.50727/' (the location of aspnet_iisreg). But it cannot find the provider. I do not want to move my component into the GAC, I want to leave the custom assembly in my ApplicationBase to copy around to various servers without having to pull/push from the GAC. Here is my provider configuration in the web.config. <configProtectedData> <providers> <add name="CustomProvider" type="MyCustomProviderNamespace.MyCustomProviderClass, MyCustomProviderNamespace" /> </providers> </configProtectedData> Has anyone got any ideas?

    Read the article

  • Obfuscator for .NET assembly (Maybe just a C++ obfuscator?)

    - by Pirate for Profit
    The software company I work for is using a ton of open source LGPL/BSD/MIT C++ code that we have written wrappers around to port "helper classes" into a .NET assembly, via C++/CLI. These libraries have wrapped old cryptic APIs into easy-to-use ones based on common sense, and will be very helpful for a lot of different tasks will be included in many future client's applications, and we might even license it to other software companies in the same field. So naturally we are tasked with looking into solutions for securing the code from prying eyes. What we're trying to do is stop the casual observer from seeing what's going on. Now I have hacked some crazy shit in EverQuest and other video games in my day so I know with enough tireless effort anything can be done. But we don't want to make it easy for whomever. To the point, besides the Visual Studio compiler's optimizations, is there's a C++ obfuscator or .NET assembly obfuscator (after it's been built o.O) or something that would scramble everything up, re-arrange data structures, string constants, etc. idk? And if such a thing exists, we'd be curious to know how that would impact performance, as some sections of code are time critical (funny saying that using a managed M$ framework).

    Read the article

  • Configuration Error , Finding assembly after I swapped referenced dll out. Visual Studio 2003

    - by TampaRich
    Here is the situation. I had a clean build of my asp.net web application working. I then went into the bin folder under the web app and replaced two referenced dll's with two older version of the same dll's. (Same name etc.) After testing I replaced those dll's back to the new ones and now my application keeps throwing the configuration error === Pre-bind state information === LOG: DisplayName = xxxxx.xxxx.Personalization (Partial) LOG: Appbase = file:///c:/inetpub/wwwroot/appname LOG: Initial PrivatePath = bin Calling assembly : (Unknown). LOG: Policy not being applied to reference at this time (private, custom, partial, or location-based assembly bind). I found this issue on the web and tried all the solutions to it but nothing worked. I then went into all my projects that it references under the solution and cleared out the bin/debug folder in each, I cleared out the obj folder under each and also deleted the temporary files associated with the application. I rebuilt it and it still will not work due to this error Not sure what is causing this or how to fix this issue. I have tried restarting IIS, stopping index services which was said to be a known issue. This is .net framework 1.1 app and visual studio 2003 Any suggestions would be great. Thanks.

    Read the article

  • Integration test failing through NUnit Gui/Console, but passes through TestDriven in IDE

    - by Cliff
    I am using NHibernate against an Oracle database with the NHibernate.Driver.OracleDataClientDriver driver class. I have an integration test that pulls back expected data properly when executed through the IDE using TestDriven.net. However, when I run the unit test through the NUnit GUI or Console, NHibernate throws an exception saying it cannot find the Oracle.DataAccess assembly. Obviously, this prevents me from running my integration tests as part of my CI process. NHibernate.HibernateException : The IDbCommand and IDbConnection implementation in the assembly Oracle.DataAccess could not be found. Ensure that the assembly Oracle.DataAccess is located in the application directory or in the Global Assembly Cache. If the assembly is in the GAC, use element in the application configuration file to specify the full name of the assembly.* I have tried making the assembly available in two ways, by copying it into the bin\debug folder and by adding the element in the config file. Again, both methods work when executing through TestDriven in the IDE. Neither work when executing through NUnit GUI/Console. The NUnit Gui log displays the following message. 21:42:26,377 ERROR [TestRunnerThread] ReflectHelper [(null)]- Could not load type Oracle.DataAccess.Client.OracleConnection, Oracle.DataAccess. System.BadImageFormatException: Could not load file or assembly 'Oracle.DataAccess, Version=2.111.7.20, Culture=neutral, PublicKeyToken=89b483f429c47342' or one of its dependencies. An attempt was made to load a program with an incorrect format. File name: 'Oracle.DataAccess, Version=2.111.7.20, Culture=neutral, PublicKeyToken=89b483f429c47342' --- System.BadImageFormatException: Could not load file or assembly 'Oracle.DataAccess' or one of its dependencies. An attempt was made to load a program with an incorrect format. File name: 'Oracle.DataAccess' I am running NUnit 2.4.8, TestDriven.net 2.24 and VS2008sp1 on Windows 7 64bit. Oracle Data Provider v2.111.7.20, NHibernate v2.1.0.4. Has anyone run into this issue, better yet, fixed it?

    Read the article

  • .NET Security Part 2

    - by Simon Cooper
    So, how do you create partial-trust appdomains? Where do you come across them? There are two main situations in which your assembly runs as partially-trusted using the Microsoft .NET stack: Creating a CLR assembly in SQL Server with anything other than the UNSAFE permission set. The permissions available in each permission set are given here. Loading an assembly in ASP.NET in any trust level other than Full. Information on ASP.NET trust levels can be found here. You can configure the specific permissions available to assemblies using ASP.NET policy files. Alternatively, you can create your own partially-trusted appdomain in code and directly control the permissions and the full-trust API available to the assemblies you load into the appdomain. This is the scenario I’ll be concentrating on in this post. Creating a partially-trusted appdomain There is a single overload of AppDomain.CreateDomain that allows you to specify the permissions granted to assemblies in that appdomain – this one. This is the only call that allows you to specify a PermissionSet for the domain. All the other calls simply use the permissions of the calling code. If the permissions are restricted, then the resulting appdomain is referred to as a sandboxed domain. There are three things you need to create a sandboxed domain: The specific permissions granted to all assemblies in the domain. The application base (aka working directory) of the domain. The list of assemblies that have full-trust if they are loaded into the sandboxed domain. The third item is what allows us to have a fully-trusted API that is callable by partially-trusted code. I’ll be looking at the details of this in a later post. Granting permissions to the appdomain Firstly, the permissions granted to the appdomain. This is encapsulated in a PermissionSet object, initialized either with no permissions or full-trust permissions. For sandboxed appdomains, the PermissionSet is initialized with no permissions, then you add permissions you want assemblies loaded into that appdomain to have by default: PermissionSet restrictedPerms = new PermissionSet(PermissionState.None); // all assemblies need Execution permission to run at all restrictedPerms.AddPermission( new SecurityPermission(SecurityPermissionFlag.Execution)); // grant general read access to C:\config.xml restrictedPerms.AddPermission( new FileIOPermission(FileIOPermissionAccess.Read, @"C:\config.xml")); // grant permission to perform DNS lookups restrictedPerms.AddPermission( new DnsPermission(PermissionState.Unrestricted)); It’s important to point out that the permissions granted to an appdomain, and so to all assemblies loaded into that appdomain, are usable without needing to go through any SafeCritical code (see my last post if you’re unsure what SafeCritical code is). That is, partially-trusted code loaded into an appdomain with the above permissions (and so running under the Transparent security level) is able to create and manipulate a FileStream object to read from C:\config.xml directly. It is only for operations requiring permissions that are not granted to the appdomain that partially-trusted code is required to call a SafeCritical method that then asserts the missing permissions and performs the operation safely on behalf of the partially-trusted code. The application base of the domain This is simply set as a property on an AppDomainSetup object, and is used as the default directory assemblies are loaded from: AppDomainSetup appDomainSetup = new AppDomainSetup { ApplicationBase = @"C:\temp\sandbox", }; If you’ve read the documentation around sandboxed appdomains, you’ll notice that it mentions a security hole if this parameter is set correctly. I’ll be looking at this, and other pitfalls, that will break the sandbox when using sandboxed appdomains, in a later post. Full-trust assemblies in the appdomain Finally, we need the strong names of the assemblies that, when loaded into the appdomain, will be run as full-trust, irregardless of the permissions specified on the appdomain. These assemblies will contain methods and classes decorated with SafeCritical and Critical attributes. I’ll be covering the details of creating full-trust APIs for partial-trust appdomains in a later post. This is how you get the strongnames of an assembly to be executed as full-trust in the sandbox: // get the Assembly object for the assembly Assembly assemblyWithApi = ... // get the StrongName from the assembly's collection of evidence StrongName apiStrongName = assemblyWithApi.Evidence.GetHostEvidence<StrongName>(); Creating the sandboxed appdomain So, putting these three together, you create the appdomain like so: AppDomain sandbox = AppDomain.CreateDomain( "Sandbox", null, appDomainSetup, restrictedPerms, apiStrongName); You can then load and execute assemblies in this appdomain like any other. For example, to load an assembly into the appdomain and get an instance of the Sandboxed.Entrypoint class, implementing IEntrypoint, you do this: IEntrypoint o = (IEntrypoint)sandbox.CreateInstanceFromAndUnwrap( "C:\temp\sandbox\SandboxedAssembly.dll", "Sandboxed.Entrypoint"); // call method the Execute method on this object within the sandbox o.Execute(); The second parameter to CreateDomain is for security evidence used in the appdomain. This was a feature of the .NET 2 security model, and has been (mostly) obsoleted in the .NET 4 model. Unless the evidence is needed elsewhere (eg. isolated storage), you can pass in null for this parameter. Conclusion That’s the basics of sandboxed appdomains. The most important object is the PermissionSet that defines the permissions available to assemblies running in the appdomain; it is this object that defines the appdomain as full or partial-trust. The appdomain also needs a default directory used for assembly lookups as the ApplicationBase parameter, and you can specify an optional list of the strongnames of assemblies that will be given full-trust permissions if they are loaded into the sandboxed appdomain. Next time, I’ll be looking closer at full-trust assemblies running in a sandboxed appdomain, and what you need to do to make an API available to partial-trust code.

    Read the article

< Previous Page | 39 40 41 42 43 44 45 46 47 48 49 50  | Next Page >