Search Results

Search found 55276 results on 2212 pages for 'eicar test string'.

Page 433/2212 | < Previous Page | 429 430 431 432 433 434 435 436 437 438 439 440  | Next Page >

• SQL Invalid Object Name 'AddressType'

  - by salvationishere

  I am getting the above error in my VS 2008 C# method when I try to invoke the SQL getColumnNames stored procedure from VS. This SP accepts one input parameter, the table name, and works successfully from SSMS. Currently I am selecting the AdventureWorks AddressType table for it to pull the column names from this table. I can see teh AdventureWorks table available in VS from my Server Explorer / Data Connection. And I see both the AddressType table and getColumnNames SP showing in Server Explorer. But I am still getting this error listed above. Here is the C# code snippet I use to execute this: public static DataTable DisplayTableColumns(string tt) { SqlDataReader dr = null; string TableName = tt; string connString = "Data Source=.;AttachDbFilename=\"C:\Program Files\Microsoft SQL Server\MSSQL10.MSSQLSERVER\MSSQL\DATA\AdventureWorks_Data.mdf\";Initial Catalog=AdventureWorks;Integrated Security=True;Connect Timeout=30;User Instance=False"; string errorMsg; SqlConnection conn2 = new SqlConnection(connString); SqlCommand cmd = conn2.CreateCommand(); try { cmd.CommandText = "dbo.getColumnNames"; cmd.CommandType = CommandType.StoredProcedure; cmd.Connection = conn2; SqlParameter parm = new SqlParameter("@TableName", SqlDbType.VarChar); parm.Value = TableName; parm.Direction = ParameterDirection.Input; cmd.Parameters.Add(parm); conn2.Open(); dr = cmd.ExecuteReader(); } catch (Exception ex) { errorMsg = ex.Message; } And when I examine the errorMsg it says the following: " at System.Data.SqlClient.SqlConnection.OnError(SqlException exception, Boolean breakConnection)\r\n at System.Data.SqlClient.SqlInternalConnection.OnError(SqlException exception, Boolean breakConnection)\r\n at System.Data.SqlClient.TdsParser.ThrowExceptionAndWarning(TdsParserStateObject stateObj)\r\n at System.Data.SqlClient.TdsParser.Run(RunBehavior runBehavior, SqlCommand cmdHandler, SqlDataReader dataStream, BulkCopySimpleResultSet bulkCopyHandler, TdsParserStateObject stateObj)\r\n at System.Data.SqlClient.SqlDataReader.ConsumeMetaData()\r\n at System.Data.SqlClient.SqlDataReader.get_MetaData()\r\n at System.Data.SqlClient.SqlCommand.FinishExecuteReader(SqlDataReader ds, RunBehavior runBehavior, String resetOptionsString)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReaderTds(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, Boolean async)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method, DbAsyncResult result)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method)\r\n at System.Data.SqlClient.SqlCommand.ExecuteReader(CommandBehavior behavior, String method)\r\n at System.Data.SqlClient.SqlCommand.ExecuteReader()\r\n at ADONET_namespace.ADONET_methods.DisplayTableColumns(String tt) in C:\Documents and Settings\Admin\My Documents\Visual Studio 2008\Projects\AddFileToSQL\AddFileToSQL\ADONET methods.cs:line 35" Where line 35 is dr = cmd.ExecuteReader();

  Read the article

• Configuring TeamCity + NUnit unit tests so files can be loaded properly

  - by Dave

  In a nutshell, I have a solution that builds fine in the IDE, and the unit tests all run fine with the NUnit GUI (via the NUnitit VS2008 plugin). However, when I execute my TeamCity build runner, all unit tests that require file access (e.g. for running tests against specific XML files), I just get System.IO.DirectoryNotFoundExceptions. The reason for this is clear: it's looking for those supporting XML files loaded by various unit tests in the wrong folder. The way my unit tests are structured looks like this: +-- project folder +-- unit tests folder +-- test.xml +-- test.cs +-- project file.xaml +-- project file.xaml.cs All of my projects own their own UnitTests folder, which contains the .cs file and any XML files, XML Schemas, etc that are necessary to run the tests. So when I write my test.cs, I have it look for "test.xml" in the code because they are in the same folder (actually, I do something like ....\unit tests\test.xml, but that's kind of silly). As I said before, the tests run great in NUnit. But that's because the unit tests are part of the project. When running the unit tests from TeamCity, I am executing them against the assemblies that get copied to the main app's output folder. These unit test XML files should not be copied willy-nilly to the output folder just to make the tests pass. Can anyone suggest a better method of organizing my unit tests in each project (which are dependencies for the main app), such that I can execute the unit tests from NUnit and from the TeamCity build runner? The only other option I can come up with is to just put the testing XML data in code, rather than loading it from a file. I would rather not do this.

  Read the article

• Excel - referenced values via OleDB from .Net client

  - by ho

  I'm trying to read an Excel file (.xls, I think Excel 2003 compatible) via OleDB, but it fails to get the values for referenced fields. This is my current test code (please note, this is just part of the class): Private m_conn As OleDbConnection Public Sub New(ByVal fileName As String) Dim connString As String = String.Format("Provider=Microsoft.Jet.OLEDB.4.0;Data Source={0};Extended Properties=Excel 8.0;", fileName) m_conn = New OleDbConnection(connString) m_conn.Open() End Sub Public Sub GetSheet(ByVal sheet As String) Dim query As String = String.Format("SELECT * FROM [{0}]", sheet) Using cmd As OleDbCommand = m_conn.CreateCommand() cmd.CommandText = query Dim ds As New DataSet() Dim a As New OleDbDataAdapter(cmd) Using rdr As OleDbDataReader = cmd.ExecuteReader() While rdr.Read() Debug.WriteLine(rdr.Item(0).ToString()) End While End Using End Using End Sub But if the value is a reference (something like =+'MySheetName'!K37), I just get a DBNull from the call to rdr.Item(0). I can get around this by automating Excel instead, but would prefer not to have to use Excel automation so wondering if anyone knows how to do it.

  Read the article

• def constrainedMatchPair(firstMatch,secondMatch,length):

  - by smart

  matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

  Read the article

• C++ Header file questions

  - by Karl

  So I'm trying to learn C++ and I've gotten as far as using header files. They really make no sense to me. I've tried many combinations of this but nothing so far has worked: Main.cpp: #include "test.h" int main() { testClass Player1; return 0; } test.h: #ifndef TEST_H_INCLUDED #define TEST_H_INCLUDED class testClass { private: int health; public: testClass(); ~testClass(); int getHealth(); void setHealth(int inH); }; #endif // TEST_H_INCLUDED test.cpp: #include "test.h" testClass::testClass() { health = 100; } testClass::~testClass() {} int testClass::getHealth() { return(health); } void testClass::setHealth(int inH) { health = inH; } What I'm trying to do is pretty simple, but the way the header files work just makes no sense to me at all. Code blocks returns the following on build: obj\Debug\main.o(.text+0x131)||In function main':| *voip*\test\main.cpp |6|undefined reference totestClass::testClass()'| obj\Debug\main.o(.text+0x13c):voip\test\main.cpp|7|undefined reference to `testClass::~testClass()'| ||=== Build finished: 2 errors, 0 warnings ===| I'd appreciate any help. Or if you have a decent tutorial for it, that would be fine too (most of the tutorials I've googled haven't helped)

  Read the article

• how to assign the html value to the php variable without post or get method

  - by Meena

  hi , in my program i had a php value $test = 2 using this value i done some operation for example: in my page i had a 2 block A and B and one select box. If the test value is A it enable the div A, if the value is B it hide div A and also i am able to show and hide the div using the select box onchange event. please check my sample code given below $test = $_GET["id"]; <select name="hideme" id="hideme" onchange="enableme();"> <option value="A">Show</option> <option value="B">Hide</option> </select> if($test == 'A') { <div id="div1" name="div1"> xxxxxxxxxxxxx </div> } Js Function : function enableme() { if(document.getElementByID('hideme').value == "A") { document.getElementById.style.display ="block"; } else { document.getElementById.style.display ="none"; } } my issue is at fist time using the $test($_get) value it show the correct div but the on change event is not working because of , if condition. If i remove the if condition then it show div A even if the value of the $test is B. how could i handle both. Please Help me

  Read the article

• How to dispose off custom object from within custom membership provider

  - by IrfanRaza

  I have created my custom MembershipProvider. I have used an instance of the class DBConnect within this provider to handle database functions. Please look at the code below: public class SGIMembershipProvider : MembershipProvider { #region "[ Property Variables ]" private int newPasswordLength = 8; private string connectionString; private string applicationName; private bool enablePasswordReset; private bool enablePasswordRetrieval; private bool requiresQuestionAndAnswer; private bool requiresUniqueEmail; private int maxInvalidPasswordAttempts; private int passwordAttemptWindow; private MembershipPasswordFormat passwordFormat; private int minRequiredNonAlphanumericCharacters; private int minRequiredPasswordLength; private string passwordStrengthRegularExpression; private MachineKeySection machineKey; **private DBConnect dbConn;** #endregion ....... public override bool ChangePassword(string username, string oldPassword, string newPassword) { if (!ValidateUser(username, oldPassword)) return false; ValidatePasswordEventArgs args = new ValidatePasswordEventArgs(username, newPassword, true); OnValidatingPassword(args); if (args.Cancel) { if (args.FailureInformation != null) { throw args.FailureInformation; } else { throw new Exception("Change password canceled due to new password validation failure."); } } SqlParameter[] p = new SqlParameter[3]; p[0] = new SqlParameter("@applicationName", applicationName); p[1] = new SqlParameter("@username", username); p[2] = new SqlParameter("@password", EncodePassword(newPassword)); bool retval = **dbConn.ExecuteSP("User_ChangePassword", p);** return retval; } //ChangePassword public override void Initialize(string name, NameValueCollection config) { if (config == null) { throw new ArgumentNullException("config"); } ...... ConnectionStringSettings ConnectionStringSettings = ConfigurationManager.ConnectionStrings[config["connectionStringName"]]; if ((ConnectionStringSettings == null) || (ConnectionStringSettings.ConnectionString.Trim() == String.Empty)) { throw new ProviderException("Connection string cannot be blank."); } connectionString = ConnectionStringSettings.ConnectionString; **dbConn = new DBConnect(connectionString); dbConn.ConnectToDB();** ...... } //Initialize ...... } // SGIMembershipProvider I have instantiated dbConn object within Initialize() event. My problem is that how could i dispose off this object when object of SGIMembershipProvider is disposed off. I know the GC will do this all for me, but I need to explicitly dispose off that object. Even I tried to override Finalize() but there is no such overridable method. I have also tried to create destructor for SGIMembershipProvider. Can anyone provide me solution.

  Read the article

• Sessions not persisting between requests

  - by klonq

  My session objects are only stored within the request scope on google app engine and I can't figure out how to persist objects between requests. The docs are next to useless on this matter and I can't find anyone who's experienced a similar problem. Please help. When I store session objects in the servlet and forward the request to a JSP using: getServletContext().getRequestDispatcher("/example.jsp").forward(request,response); Everything works like it should. But when I store objects to the session and redirect the request using: response.sendRedirect("/example/url"); The session objects are lost to the ether. In fact when I dump session key/value pairs on new requests there is absolutely nothing, session objects only appear within the request scope of servlets which create session objects. It appears to me that the objects are not being written to Memcache or Datastore. In terms of configuring sessions for my application I have set <sessions-enabled>true</sessions-enabled> In appengine-web.xml. Is there anything else I am missing? The single paragraph of documentation on sessions also notes that only objects which implement Serializable can be stored in the session between requests. I have included an example of the code which is not working below. The obvious solution is to not use redirects, and this might be ok for the example given below but some application data does need to be stored in the session between requests so I need to find a solution to this problem. EXAMPLE: The class FlashMessage gives feedback to the user from server-side operations. if (email.send()) { FlashMessage flash = new FlashMessage(FlashMessage.SUCCESS, "Your message has been sent."); session.setAttribute(FlashMessage.SESSION_KEY, flash); // The flash message will not be available in the session object in the next request response.sendRedirect(URL.HOME); } else { FlashMessage flash = new FlashMessage(FlashMessage.ERROR, FlashMessage.INVALID_FORM_DATA); session.setAttribute(FlashMessage.SESSION_KEY, flash); // The flash message is displayed without problem getServletContext().getRequestDispatcher(Templates.CONTACT_FORM).forward(request,response); } FlashMessage.java import java.io.Serializable; public class FlashMessage implements Serializable { private static final long serialVersionUID = 8109520737272565760L; // I have tried using different, default and no serialVersionUID public static final String SESSION_KEY = "flashMessage"; public static final String ERROR = "error"; public static final String SUCCESS = "success"; public static final String INVALID_FORM_DATA = "Your request failed to validate."; private String message; private String type; public FlashMessage (String type, String message) { this.type = type; this.message = message; } public String display(){ return "<div id='flash' class='" + type + "'>" + message + "</div>"; } }

  Read the article

• Unix Sockets in Go

  - by marketer

  I'm trying to make a simple echo client and server that uses Unix sockets. In this example, the server can receive data from the client, but it can't send the data back. If I use tcp connections instead, it works great: Server package main import "net" import "fmt" func echoServer(c net.Conn) { for { buf := make([]byte, 512) nr, err := c.Read(buf) if err != nil { return } data := buf[0:nr] fmt.Printf("Received: %v", string(data)) _, err = c.Write(data) if err != nil { panic("Write: " + err.String()) } } } func main() { l, err := net.Listen("unix", "/tmp/echo.sock") if err != nil { println("listen error", err.String()) return } for { fd, err := l.Accept() if err != nil { println("accept error", err.String()) return } go echoServer(fd) } } Client package main import "net" import "time" func main() { c,err := net.Dial("unix","", "/tmp/echo.sock") if err != nil { panic(err.String()) } for { _,err := c.Write([]byte("hi\n")) if err != nil { println(err.String()) } time.Sleep(1e9) } }

  Read the article

• How do you tell that your unit tests are correct?

  - by Jacob Adams

  I've only done minor unit testing at various points in my career. Whenever I start diving into it again, it always troubles me how to prove that my tests are correct. How can I tell that there isn't a bug in my unit test? Usually I end up running the app, proving it works, then using the unit test as a sort of regression test. What is the recommended approach and/or what is the approach you take to this problem? Edit: I also realize that you could write small, granular unit tests that would be easy to understand. However, if you assume that small, granular code is flawless and bulletproof, you could just write small, granular programs and not need unit testing. Edit2: For the arguments "unit testing is for making sure your changes don't break anything" and "this will only happen if the test has the exact same flaw as the code", what if the test overfits? It's possible to pass both good and bad code with a bad test. My main question is what good is unit testing since if your tests can be flawed you can't really improve your confidence in your code, can't really prove your refactoring worked, and can't really prove that you met the specification?

  Read the article

• How do I tie a cmbBox that selects all drives (local and network) into a treeNode VB

  - by jpavlov

  How do i tie in a selected item from a cmbBox with a treeView? I am looking to just obtain the value of the one selected drive Thanks. Imports System Imports System.IO Imports System.IO.File Imports System.Windows.Forms Public Class F_Treeview_Demo Private Sub F_Treeview_Demo_Load(ByVal sender As Object, ByVal e As System.EventArgs) Handles Me.Load ' Initialize the local directory treeview Dim nodeText As String = "" Dim sb As New C_StringBuilder With My.Computer.FileSystem 'Read in the number of drives For i As Integer = 0 To .Drives.Count - 1 '** Build the drive's node text sb.ClearText() sb.AppendText(.Drives(i).Name) cmbDrives.Items.Add(sb.FullText) Next End With ListRootNodes() End Sub Private Sub btnExit_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles btnExit.Click Application.Exit() End Sub Private Sub tvwLocalFolders_AfterSelect(ByVal sender As Object, ByVal e As System.Windows.Forms.TreeViewEventArgs) _ Handles tvwLocalFolders.AfterSelect ' Display the path for the selected node Dim folder As String = tvwLocalFolders.SelectedNode.Tag lblLocalPath.Text = folder ListView1.Items.Clear() Dim childNode As TreeNode = e.Node.FirstNode Dim parentPath As String = AddChar(e.Node.Tag) End Sub Private Sub AddToList(ByVal nodes As TreeNodeCollection) For Each node As TreeNode In nodes If node.Checked Then ListView1.Items.Add(node.Text) ListView1.Items.Add(Chr(13)) AddToList(node.Nodes) End If Next End Sub Private Sub tvwLocalFolders_BeforeExpand(ByVal sender As Object, ByVal e As System.Windows.Forms.TreeViewCancelEventArgs) _ Handles tvwLocalFolders.BeforeExpand ' Display the path for the selected node lblLocalPath.Text = e.Node.Tag ' Populate all child nodes below the selected node Dim parentPath As String = AddChar(e.Node.Tag) tvwLocalFolders.BeginUpdate() Dim childNode As TreeNode = e.Node.FirstNode 'this i added Dim smallNode As TreeNode = e.Node.FirstNode Do While childNode IsNot Nothing ListLocalSubFolders(childNode, parentPath & childNode.Text) childNode = childNode.NextNode ''this i added ListLocalFiles(smallNode, parentPath & smallNode.Text) Loop tvwLocalFolders.EndUpdate() tvwLocalFolders.Refresh() ' Select the node being expanded tvwLocalFolders.SelectedNode = e.Node ListView1.Items.Clear() AddToList(tvwLocalFolders.Nodes) ListView1.Items.Add(Environment.NewLine) End Sub Private Sub ListRootNodes() ' Add all local drives to the Local treeview Dim nodeText As String = "" Dim sb As New C_StringBuilder With My.Computer.FileSystem For i As Integer = 0 To .Drives.Count - 1 '** Build the drive's node text sb.ClearText() sb.AppendText(.Drives(i).Name) nodeText = sb.FullText nodeText = Me.cmbDrives.SelectedItem '** Add the drive to the treeview Dim driveNode As TreeNode driveNode = tvwLocalFolders.Nodes.Add(nodeText) 'driveNode.Tag = .Drives(i).Name '** Add the next level of subfolders 'ListLocalSubFolders(driveNode, .Drives(i).Name) ListLocalSubFolders(driveNode, nodeText) 'driveNode = Nothing Next End With End Sub Private Sub ListLocalFiles(ByVal ParentNode As TreeNode, ByVal PParentPath As String) Dim FileNode As String = "" Try For Each FileNode In Directory.GetFiles(PParentPath) Dim smallNode As TreeNode smallNode = ParentNode.Nodes.Add(FilenameFromPath(FileNode)) With smallNode .ImageIndex = 0 .SelectedImageIndex = 1 .Tag = FileNode End With smallNode = Nothing Next Catch ex As Exception End Try End Sub Private Sub ListLocalSubFolders(ByVal ParentNode As TreeNode, _ ByVal ParentPath As String) ' Add all local subfolders below the passed Local treeview node Dim FolderNode As String = "" Try For Each FolderNode In Directory.GetDirectories(ParentPath) Dim childNode As TreeNode childNode = ParentNode.Nodes.Add(FilenameFromPath(FolderNode)) With childNode .ImageIndex = 0 .SelectedImageIndex = 1 .Tag = FolderNode End With childNode = Nothing Next Catch ex As Exception End Try End Sub Private Sub ComboBox1_SelectedIndexChanged(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles cmbDrives.SelectedIndexChanged End Sub Private Sub lblLocalPath_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles lblLocalPath.Click End Sub Private Sub grpLocalFileSystem_Enter(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles grpLocalFileSystem.Enter End Sub Private Sub btn1_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles btn1.Click ' lbl1.Text = End Sub Private Sub ListView1_SelectedIndexChanged(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles ListView1.SelectedIndexChanged End Sub End Class

  Read the article

• testng multiple suites

  - by Eli

  Hi people. my problem is as follows: i am testing a web-ui using selenium and testng. i have a test suite with many test classes in it. i have a method with the @BeforeSuite witch also has a @Parameters annotation, this method recieves as a parameter the browser in witch the selenium will test by run,executing the lines: selenium = new DefaultSelenium("localhost", 4444, **browser**, "http://localhost:8099"); selenium.start(); the xml im using to run the test suite is: <suite name="suite"> <parameter name = "browser" value = "*firefox"/> <test name="allTests"> <classes> <class name="test.webui.MemcachedDeploymentTest" /> </classes> </test> </suite> this works fine and the test runs in firefox. my problem is that i would like to somehow run this suite again, immediatly after the first run finishes, but this time with chrome as the browser. i now have 2 xml suites, one with chrome and one with firefox, is there any way to run these test suites one after the other automatically? maybe using a third xml? Thanks in advance

  Read the article

• Serialization Error:Unable to generate a temporary class (result=1).\r\nerror CS0030:- c#

  - by ltech

  Running XSD.exe on my xml to generate C# class. All works well except on this property public DocumentATTRIBUTES[][] Document { get { return this.documentField; } set { this.documentField = value; } } I want to try and use CollectionBase, and this was my attempt public DocumentATTRIBUTESCollection Document { get { return this.documentField; } set { this.documentField = value; } } /// <remarks/> [System.SerializableAttribute()] [System.Diagnostics.DebuggerStepThroughAttribute()] [System.ComponentModel.DesignerCategoryAttribute("code")] [System.Xml.Serialization.XmlTypeAttribute(AnonymousType = true)] public partial class DocumentATTRIBUTES { private string _author; private string _maxVersions; private string _summary; /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string author { get { return _author; } set { _author = value; } } /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string max_versions { get { return _maxVersions; } set { _maxVersions = value; } } /// <remarks/> [System.Xml.Serialization.XmlElementAttribute(Form = System.Xml.Schema.XmlSchemaForm.Unqualified)] public string summary { get { return _summary; } set { _summary = value; } } } public class DocumentAttributeCollection : System.Collections.CollectionBase { public DocumentAttributeCollection() : base() { } public DocumentATTRIBUTES this[int index] { get { return (DocumentATTRIBUTES)this.InnerList[index]; } } public void Insert(int index, DocumentATTRIBUTES value) { this.InnerList.Insert(index, value); } public int Add(DocumentATTRIBUTES value) { return (this.InnerList.Add(value)); } } However when I try to serialize my object using XmlSerializer serializer = new XmlSerializer(typeof(DocumentMetaData)); I get the error: {"Unable to generate a temporary class (result=1).\r\nerror CS0030: Cannot convert type 'DocumentATTRIBUTES' to 'DocumentAttributeCollection'\r\nerror CS1502: The best overloaded method match for 'DocumentAttributeCollection.Add(DocumentATTRIBUTES)' has some invalid arguments\r\nerror CS1503: Argument '1': cannot convert from 'DocumentAttributeCollection' to 'DocumentATTRIBUTES'\r\n"} the XSD pertaining to this property is <xs:complexType> <xs:sequence> <xs:element name="ATTRIBUTES" minOccurs="0" maxOccurs="unbounded"> <xs:complexType> <xs:sequence> <xs:element name="author" type="xs:string" minOccurs="0" /> <xs:element name="max_versions" type="xs:string" minOccurs="0" /> <xs:element name="summary" type="xs:string" minOccurs="0" /> </xs:sequence> </xs:complexType> </xs:element> </xs:sequence> </xs:complexType> </xs:element>

  Read the article

• Resharper code format linebreaks

  - by mizipzor

  Im trying to setup the code formatting in ReSharper. Limiting each line to a maximum count of characters, it seems to want to place casts on a separate line. Like so: string mystring = (string) MyStringConverter.convert(toconvert, typeof(string), null, null); I cant seem to be able to find the correct combination of settings to not have this on three lines. Im looking for something like this: string mystring = (string) MyStringConverter.convert( toconvert, typeof(string), null, null); Where the linebreak occurs is not that important, I guess I cant be to picky when I want to limit the line length. But three lines is a bit much. Does anyone know the/any correct combination of settings to make it only cut the line once?

  Read the article

• LINQ2SQL: how to merge two columns from the same table into a single list

  - by TomL

  this is probably a simple question, but I'm only a beginner so... Suppose I have a table containing home-work locations (cities) certain people use. Something like: ID(int), namePerson(string), homeLocation(string), workLocation(string) where homeLocation and workLocation can both be null. Now I want all the different locations that are used merged into a single list. Something like: var homeLocation = from hm in Places where hm.Home != null select hm.Home; var workLocation = from wk in Places where wk.Work != null select wk.Work; List<string> locationList = new List<string>(); locationList = homeLocation.Distinct().ToList<string>(); locationList.AddRange(workLocation.Distinct().ToList<string>()); (which I guess would still allow duplicates if they have the same value in both columns, which I don't really want...) My question: how this be put into a single LINQ statement? Thanks in advance for your help!

  Read the article

• Why doesn't access database update?

  - by Ryan

  Recently I met a strange problem, see code snips as below: var sqlCommand: string; connection: TADOConnection; qry: TADOQuery; begin connection := TADOConnection.Create(nil); try connection.ConnectionString := 'Provider=Microsoft.Jet.OLEDB.4.0;Data Source=Test.MDB;Persist Security Info=False'; connection.Open(); qry := TADOQuery.Create(nil); try qry.Connection := connection; qry.SQL.Text := 'Select * from aaa'; qry.Open; qry.Append; qry.FieldByName('TestField1').AsString := 'test'; qry.Post; beep; finally qry.Free; end; finally connection.Free; end; end; First, Create a new access database named test.mdb and put it under the directory of this test project, we can create a new table named aaa in it which has only one text type field named TestField1. We set a breakpoint at line of "beep", then lunch the test application under ide debug mode, when ide stops at the breakpoint line (qry.post has been executed), at this time we use microsoft access to open test.mdb and open table aaa you will find there are no any changes in table aaa, if you let the ide continue running after pressing f9 you can find a new record is inserted in to table aaa, but if you press ctrl+f2 to terminate the application at the breakpoint, you will find the table aaa has no record been inserted, but in normal circumstance, a new record should be inserted in to the table aaa after qry.post executed. who can explain this problem , it troubles me so long time. thanks !!! BTW, the ide is delphi 2010, and the access mdb file is created by microsoft access 2007 under windows 7

  Read the article

• Returning the index number of an Arraylist in Java

  - by Daniel

  I would like my method public void showClassRoomDetails(String teacherName) to return the Arraylist index number using the teacherName. Thanks import java.util.ArrayList; public class School { private ArrayList<Classroom> classrooms; private String classRoomName; private String teacherName; public School() { classrooms = new ArrayList<Classroom>(); } public void addClassRoom(Classroom newClassRoom, String theClassRoomName) { classrooms.add(newClassRoom); classRoomName = theClassRoomName; } public void addTeacherToClassRoom(int classroomId, String TeacherName) { if (classroomId < classrooms.size() ) { classrooms.get(classroomId).setTeacherName(TeacherName); } } public void showClassRoomDetails(String teacherName) { for (Classroom classroom : this.classrooms) { if (classroom.returnTeacherName().equals(teacherName)) { System.out.println(classroom.returnClassRoomName()); System.out.println(classroom.returnTeacherName()); break; } } } }

  Read the article

• How strict should I be in the "do the simplest thing that could possible work" while doing TDD

  - by Support - multilanguage SO

  For TDD you have to Create a test that fail Do the simplest thing that could possible work to pass the test Add more variants of the test and repeat Refactor when a pattern emerge With this approach you're supposing to cover all the cases ( that comes to my mind at least) but I'm wonder if am I being too strict here and if it is possible to "think ahead" some scenarios instead of simple discover them. For instance, I'm processing a file and if it doesn't conform to a certain format I am to throw an InvalidFormatException So my first test was: @Test void testFormat(){ // empty doesn't do anything... processor.validate("empty.txt"); try { processor.validate("invalid.txt"); assert false: "Should have thrown InvalidFormatException"; } catch( InvalidFormatException ife ) { assert "Invalid format".equals( ife.getMessage() ); } } I run it and it fails because it doesn't throw an exception. So the next thing that comes to my mind is: "Do the simplest thing that could possible work", so I : public void validate( String fileName ) throws InvalidFormatException { if(fileName.equals("invalid.txt") { throw new InvalidFormatException("Invalid format"); } } Doh!! ( although the real code is a bit more complicated, I found my self doing something like this several times ) I know that I have to eventually add another file name and other test that would make this approach impractical and that would force me to refactor to something that makes sense ( which if I understood correctly is the point of TDD, to discover the patterns the usage unveils ) but: Q: am I taking too literal the "Do the simplest thing..." stuff?

  Read the article

• my jComboBox does not react to my keyListener and actionPerform perfroms weired stuff

  - by aladdin

  hi I am trying to search for UserName and return values onto jComboBox, here is the code public void actionPerformed(java.awt.event.ActionEvent e) { sr = new Search(((String) jComboBoxReceiver.getSelectedItem())); usrList = sr.searchUser(); String[] userList = new String[usrList.size()] ; for(int i=0;i<usrList.size();i++){ userList[i]= usrList.get(i).getUserName(); } model = new DefaultComboBoxModel(userList); jComboBoxReceiver.setModel(model); } However, if i do that, it does perform correctly, however, it will go search for the first item again, which is very confusing... then i tried using key Pressed if(e.getKeyCode()==13){ sr = new Search(((String) jComboBoxReceiver.getSelectedItem())); usrList = sr.searchUser(); String[] userList = new String[usrList.size()] ; for(int i=0;i<usrList.size();i++){ userList[i]= usrList.get(i).getUserName(); } model = new DefaultComboBoxModel(userList); jComboBoxReceiver.setModel(model); } And this one does not react at all ...

  Read the article

• JAXB Marshalling supply name space for root element dynamically

  - by Venkat

  I have to pass the namespace for root element dynamically while marshalling using jaxb (JAXB 2.1.10 - JDK 6). i will be using the genrated xml to call different webservices which is qualified with different namespaces but same input xml. here is my sample jaxb annotated class .....guide me with your valuable inputs. @XmlAccessorType(XmlAccessType.FIELD) @XmlType(name = "", propOrder = { "taskName", "taskType" }) @XmlRootElement(name = "TaskRequest") public class TaskRequest { @XmlElement(name = "TaskName", required = true) protected String taskName; @XmlElement(name = "TaskType", required = true) protected String taskType; public String getTaskName() { return taskName; } public void setTaskName(String value) { this.taskName = value; } public String getTaskType() { return taskType; } public void setTaskType(String value) { this.taskType = value; } }

  Read the article

• Java programming accessing object variables

  - by Haxed

  Helo, there are 3 files, CustomerClient.java, CustomerServer.java and Customer.java PROBLEM: In the CustomerServer.java file, i get an error when I compile the CustomerServer.java at line : System.out.println(a[k].getName()); ERROR: init: deps-jar: Compiling 1 source file to C:\Documents and Settings\TLNA\My Documents\NetBeansProjects\Server\build\classes C:\Documents and Settings\TLNA\My Documents\NetBeansProjects\Server\src\CustomerServer.java:44: cannot find symbol symbol : method getName() location: class Customer System.out.println(a[k].getName()); 1 error BUILD FAILED (total time: 0 seconds) CustomerClient.java import java.io.*; import java.net.*; import java.awt.*; import java.awt.event.*; import javax.swing.*; import javax.swing.border.*; public class CustomerClient extends JApplet { private JTextField jtfName = new JTextField(32); private JTextField jtfSeatNo = new JTextField(32); // Button for sending a student to the server private JButton jbtRegister = new JButton("Register to the Server"); // Indicate if it runs as application private boolean isStandAlone = false; // Host name or ip String host = "localhost"; public void init() { JPanel p1 = new JPanel(); p1.setLayout(new GridLayout(2, 1)); p1.add(new JLabel("Name")); p1.add(jtfName); p1.add(new JLabel("Seat No.")); p1.add(jtfSeatNo); add(p1, BorderLayout.CENTER); add(jbtRegister, BorderLayout.SOUTH); // Register listener jbtRegister.addActionListener(new ButtonListener()); // Find the IP address of the Web server if (!isStandAlone) { host = getCodeBase().getHost(); } } /** Handle button action */ private class ButtonListener implements ActionListener { public void actionPerformed(ActionEvent e) { try { // Establish connection with the server Socket socket = new Socket(host, 8000); // Create an output stream to the server ObjectOutputStream toServer = new ObjectOutputStream(socket.getOutputStream()); // Get text field String name = jtfName.getText().trim(); String seatNo = jtfSeatNo.getText().trim(); // Create a Student object and send to the server Customer s = new Customer(name, seatNo); toServer.writeObject(s); } catch (IOException ex) { System.err.println(ex); } } } /** Run the applet as an application */ public static void main(String[] args) { // Create a frame JFrame frame = new JFrame("Register Student Client"); // Create an instance of the applet CustomerClient applet = new CustomerClient(); applet.isStandAlone = true; // Get host if (args.length == 1) { applet.host = args[0]; // Add the applet instance to the frame } frame.add(applet, BorderLayout.CENTER); // Invoke init() and start() applet.init(); applet.start(); // Display the frame frame.pack(); frame.setVisible(true); } } CustomerServer.java import java.io.*; import java.net.*; public class CustomerServer { private String name; private int i; private ObjectOutputStream outputToFile; private ObjectInputStream inputFromClient; public static void main(String[] args) { new CustomerServer(); } public CustomerServer() { Customer[] a = new Customer[30]; try { // Create a server socket ServerSocket serverSocket = new ServerSocket(8000); System.out.println("Server started "); // Create an object ouput stream outputToFile = new ObjectOutputStream( new FileOutputStream("student.dat", true)); while (true) { // Listen for a new connection request Socket socket = serverSocket.accept(); // Create an input stream from the socket inputFromClient = new ObjectInputStream(socket.getInputStream()); // Read from input //Object object = inputFromClient.readObject(); for (int k = 0; k <= 2; k++) { if (a[k] == null) { a[k] = (Customer) inputFromClient.readObject(); // Write to the file outputToFile.writeObject(a[k]); //System.out.println("A new student object is stored"); System.out.println(a[k].getName()); break; } if (k == 2) { //fully booked outputToFile.writeObject("All seats are booked"); break; } } } } catch (ClassNotFoundException ex) { ex.printStackTrace(); } catch (IOException ex) { ex.printStackTrace(); } finally { try { inputFromClient.close(); outputToFile.close(); } catch (Exception ex) { ex.printStackTrace(); } } } } Customer.java public class Customer implements java.io.Serializable { private String name; private String seatno; public Customer(String name, String seatno) { this.name = name; this.seatno = seatno; } public String getName() { return name; } public String getSeatNo() { return seatno; } }

  Read the article

• ServeletException, Property <variable name> not found

  - by k9yosh

  What i'm trying to do is add a new variable to this previously created Managed Bean Hello.java and use it in my xhtml file binding to a text field. But it seems that it is not being found when i run it on the server. So it throws a "ServeletException" and says that the "property 'lname'(my variable) is not found". How do i solve this and why is this happening? This is my managed bean, package stack.tute.malinda.model; import javax.faces.bean.ManagedBean; import javax.faces.bean.RequestScoped; @ManagedBean @RequestScoped public class Hello { private String fname; private String message; private String lname; //trying to add this new variable and use it in my xhtml file in a text field. public String getLname() { return lname; } public void setLname(String lname) { this.lname = lname; } public String getName() { return fname; } public String createMessage() { message="Hello " + fname + ""+ lname +"!"; return null; } public void setName(String fname) { this.fname=fname; } public String getMessage() { return message; } } This is my xhtml code, <h:body> <fieldset style="padding: 1em; float:left; margin-right:0.5em; padding-top:0.2em; text-align:left; border:1px solid green; font-weight:bold;"> <legend>Personal Details</legend> <h:form> <h:outputLabel for="name" value="First Name :" required="true"/> <h:inputText id="name" value="#{hello.name}"/> <br/> //Trying to access that variable here. <h:outputLabel for="name1" value="Last Name :" required="true"/> <h:inputText id="name1" value="#{hello.lname}"/> <h:message for="name"/> <br/> <h:commandButton value="Say hello" action="#{hello.createMessage}"> <f:ajax execute="@form" render="@form"/> </h:commandButton> <br/> <h:outputText value="#{hello.message}"/> </h:form> </fieldset>

  Read the article

• [FIXED] Scan file contents into an array of a structure.

  - by ZaZu

  Hello, I have a structure in my program that contains a particular array. I want to scan a random file with numbers and put the contents into that array. This is my code : ( NOTE : This is a sample from a bigger program, so I need the structure and arrays as declared ) The contents of the file are basically : 5 4 3 2 5 3 4 2 #include<stdio.h> #define first 500 #define sec 500 struct trial{ int f; int r; float what[first][sec]; }; int trialtest(trial *test); main(){ trial test; trialtest(&test); } int trialtest(trial *test){ int z,x,i; FILE *fin; fin=fopen("randomfile.txt","r"); for(i=0;i<5;i++){ fscanf(fin,"%5.2f\t",(*test).what[z][x]); } fclose(fin); return 0; } But the problem is, whenever this I run this code, I get this error : (25) : warning 508 - Data of type 'double' supplied where a pointer is required I tried adding do{ for(i=0;i<5;i++){ q=fscanf(fin,"%5.2f\t",(*test).what[z][x]); } }while(q!=EOF); But that didnt work either, it gives the same error. Does anyone have a solution to this problem ?

  Read the article

• Why do R objects not print in a function or a "for" loop?

  - by Sal Leggio

  I have an R matrix named ddd. When I enter this, everything works fine: i <- 1 shapiro.test(ddd[,y]) ad.test(ddd[,y]) stem(ddd[,y]) print(y) The calls to Shapiro Wilk, Anderson Darling, and stem all work, and extract the same column. If I put this code in a "for" loop, the calls to Shapiro Wilk, and Anderson Darling stop working, while the the stem & leaf call and the print call continue to work. for (y in 7:10) { shapiro.test(ddd[,y]) ad.test(ddd[,y]) stem(ddd[,y]) print(y) } The decimal point is 1 digit(s) to the right of the | 0 | 0 0 | 899999 1 | 0 [1] 7 The same thing happens if I try and write a function. SW & AD do not work. The other calls do. > D <- function (y) { + shapiro.test(ddd[,y]) + ad.test(ddd[,y]) + stem(ddd[,y]) + print(y) } > D(9) The decimal point is at the | 9 | 000 9 | 10 | 00000 [1] 9 Why don't all the calls behave the same way?

  Read the article

• PHP validating integers

  - by Mikk

  Hi, I was wondering, what would be the best way to validate an integer. I'd like this to work with strings as well, so I could to something like (string)+00003 - (int)3 (valid) (string)-027 - (int)-27 (valid) (int)33 - (int)33 (valid) (string)'33a' - (FALSE) (invalid) That is what i've go so far: function parseInt($int){ //If $int already is integer, return it if(is_int($int)){return $int;} //If not, convert it to string $int=(string)$int; //If we have '+' or '-' at the beginning of the string, remove them $validate = ($int[0] === '-' || $int[0] === '+')?substr($int, 1):$int; //If $validate matches pattern 0-9 convert $int to integer and return it //otherwise return false return preg_match('/^[0-9]+$/', $validate)?(int)$int:FALSE; } As far as I tested, this function works, but it looks like a clumsy workaround. Is there any better way to write this kind of function. I've also tried filter_var($foo, FILTER_VALIDATE_INT); but it won't accept values like '0003', '-0' etc.

  Read the article

< Previous Page | 429 430 431 432 433 434 435 436 437 438 439 440  | Next Page >