Search Results

Search found 42468 results on 1699 pages for 'default program'.

Page 435/1699 | < Previous Page | 431 432 433 434 435 436 437 438 439 440 441 442  | Next Page >

  • .gitconfig error

    - by Tanner
    I edited my .gitconfig file to add support for LabView and it appears that I did something that Git doesn't exactly like. The problem is it (Git) doesn't tell me what it doesn't like. What did I do wrong? The error message doesn't help much either: "fatal: bad config file line 13 in c:/Users/Tanner/.gitconfig" [gui] recentrepo = C:/Users/Tanner/Desktop/FIRST 2010 Beta/Java/LoganRover [user] name = Tanner Smith email = [email protected] [merge "labview"] name = LabView 3-Way Merge driver = “C:\Program Files\National Instruments\Shared\LabVIEW Merge\LVMerge.exe” “C:\Program Files\National Instruments\LabVIEW 8.6\LabVIEW.exe” %O %B %A %A recursive = binary And I'm not seeing a line 13, but usually that would mean something is wrong at the end? I don't know, Git is new to me.

    Read the article

  • How to combine library with my jar?

    - by Dacto
    Ok so i wrote a program that makes use of a 3rd party open source library and i want to package it with my program in a single jar. I'm using netbeans 6.8 and everything I've tried java always spit back the error: java.lang.NoClassDefFoundError: libraryname; off topic:also i would like to know how to make an executable-jar(exe) through netbeans if it is possible. (ive seen programs that were written in java but were an .exe) EDIT discovered a plugin for eclipse called FatJar which can do what i want, but i cant find something similar for netbeans, is there such thing?

    Read the article

  • OnExit is not entering via PostSharp in asp.net project.

    - by mark smith
    Hi there, I have setup PostSharp and it appears to be working but i don't get it entering OnExit (i have logged setup to ensure it is working) ... Its a bit tricky to configure with asp.net - or is it just me ... I am using the 1.5 new version I basically have the following in my web.config and i had to add the SearchPath otherwise it can't find my assemblies <postsharp directory="C:\Program Files\PostSharp 1.5" trace="true"> <parameters> <!--<add name="parameter-name" value="parameter-value"/>--> </parameters> <searchPath> <!-- Always add the binary folder to the search path. --> <add name="bin" value="~\bin"/> </searchPath> </postsharp> I have set tracing on but what is strange to me is that it appears to build to the temp directory, maybe this is my issue, i am unsure .. hence i do F5 ... Is it possible to name the Output directory and output file?? As you can see it is editing a DLL in the temp dir so IIS is no longer in control so it doesn't execute it ??? Confused! :-) C:\Program Files\PostSharp 1.5\postsharp.exe "/P:Output=C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp\App_Web_04ae3ewy.dll" "/P:IntermediateDirectory=C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp " /P:CleanIntermediate=False /P:ReferenceDirectory=. /P:SignAssembly=False /P:PrivateKeyLocation= /P:ResolvedReferences= "/P:SearchPath=C:\Source Code\Visual Studio 2008\Projects\mysitemvc\mysitemvc\bin," /V /SkipAutoUpdate "C:\Program Files\PostSharp 1.5\Default.psproj" "C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\before-postsharp\App_Web_04ae3ewy.dll" PostSharp 1.5 [1.5.6.627] - Copyright (c) Gael Fraiteur, 2005-2009. info PS0035: C:\Windows\Microsoft.NET\Framework\v2.0.50727\ilasm.exe "C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp\App_Web_04ae3ewy.il" /QUIET /DLL /PDB "/RESOURCE=C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp\App_Web_04ae3ewy.res" "/OUTPUT=C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\mysitemvc-1.2\c2087140\8ac2dc93\postsharp\App_Web_04ae3ewy.dll" /SUBSYSTEM=3 /FLAGS=1 /BASE=18481152 /STACK=1048576 /ALIGNMENT=512 /MDV=v2.0.50727

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Installing Office Customization

    - by user187229
    Name: From: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto The customization cannot be installed because another version is currently installed and cannot be upgraded from this location. To install this version of the customization, first use Add or Remove Programs to uninstall this program: TestUpdatedVersion. Then install the new customization from the following location: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto ********** Exception Text ********** Microsoft.VisualStudio.Tools.Applications.Deployment.AddInAlreadyInstalledException: The customization cannot be installed because another version is currently installed and cannot be upgraded from this location. To install this version of the customization, first use Add or Remove Programs to uninstall this program: TestUpdatedVersion. Then install the new customization from the following location: file:///D:/Samples/TestUpdatedVersion/bin/Debug/TestUpdatedVersion.vsto at Microsoft.VisualStudio.Tools.Applications.Deployment.ClickOnceAddInDeploymentManager.VerifySolutionCodebaseIsUnchanged(Uri uri, String subscriptionId, Boolean previouslyInstalled) at Microsoft.VisualStudio.Tools.Applications.Deployment.ClickOnceAddInDeploymentManager.InstallAddIn()

    Read the article

  • Why is jQuery .load() firing twice?

    - by LeslieOA
    Hello S-O. I'm using jQuery 1.4 with jQuery History and trying to figure out why Firebug/Web Inspector are showing 2 XHR GET requests on each page load (double that amount when visiting my sites homepage (/ or /#). e.g. Visit this (or any) page with Firebug enabled. Here's the edited/relevant code (see full source): - $(document).ready(function() { $('body').delegate('a', 'click', function(e) { var hash = this.href; if (hash.indexOf(window.location.hostname) > 0) { /* Internal */ hash = hash.substr((window.location.protocol+'//'+window.location.host+'/').length); $.historyLoad(hash); return false; } else if (hash.indexOf(window.location.hostname) == -1) { /* External */ window.open(hash); return false; } else { /* Nothing to do */ } }); $.historyInit(function(hash) { $('#loading').remove(); $('#container').append('<span id="loading">Loading...</span>'); $('#ajax').animate({height: 'hide'}, 'fast', 'swing', function() { $('#page').empty(); $('#loading').fadeIn('fast'); if (hash == '') { /* Index */ $('#ajax').load('/ #ajax','', function() { ajaxLoad(); }); } else { $('#ajax').load(hash + ' #ajax', '', function(responseText, textStatus, XMLHttpRequest) { switch (XMLHttpRequest.status) { case 200: ajaxLoad(); break; case 404: $('#ajax').load('/404 #ajax','', ajaxLoad); break; // Default 404 default: alert('We\'re experiencing technical difficulties. Try refreshing.'); break; } }); } }); // $('#ajax') }); // historyInit() function ajaxLoad() { $('#loading').fadeOut('fast', function() { $(this).remove(); $('#ajax').animate({height: 'show', opacity: '1'}, 'fast', 'swing'); }); } }); A few notes that may be helpful: - Using WordPress with default/standard .htaccess I'm redirecting /links-like/this to /#links-like/this via JavaScript only (PE) I'm achieving the above with window.location.replace(addr); and not window.location=addr; Feel free to visit my site if needed. Thanks in advanced.

    Read the article

  • VS2010 - Add template to New Project window

    - by gbogumil
    I am trying to add a new project template for an often used pattern. Starting from the class library template I have done the following (it still does not show up in the new project window): opened the .vstemplate file changed name and description to 'hard coded' values (my template). The values in there pulled from the csharpui.dll resources. changed the TemplateID, DefaultName, and ProjectItems included. saved these to the ProjectemplatesCache folder and as a zip in the ProjectTemplates folder. restarted VS2010 and checked the new project location which should have shown my new template. specifically, the folders I saved to were.. C:\program files\Microsoft Visual Studio 10.0\Common7\IDE\ProjectTemplatesCache\CSharp\Windows\1033\HostComm.zip (the zip is the folder name, not a zip file) and C:\program files\Microsoft Visual Studio 10.0\Common7\IDE\ProjectTemplates\CSharp\Windows\1033 (this folder has a HostComm.zip file in it) Has anyone else done this? Can it be done? If it can then what did I miss?

    Read the article

  • WIX will not add HKLM registry setting during Windows 7 install

    - by Scott Boettger
    Good Morning, I have written a WiX installer that works perfectly with Windows XP but when installing to a Windows 7 box I am running into difficulty with Registry Entries. What I need to do is add a HKLM entry as well as the registry entry for the program to show in the start menu. Here is the code i am using for both types of entry: <!-- Create the registry entries for the program --> <DirectoryRef Id="TARGETDIR"> <Component Id="RegistryEntriesInst" Guid="..."> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Action="createAndRemoveOnUninstall"> <RegistryValue Type="string" Name="installed" Value="true" KeyPath="yes"/> </RegistryKey> </Component> <Component Id="RegistryEntriesVer" Guid="..."> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Action="createAndRemoveOnUninstall"> <RegistryValue Type="string" Name="version" Value="$(var.ProductVersion)" KeyPath="yes"/> </RegistryKey> </Component> </DirectoryRef> <!-- To add shortcuts to the start menu to run and uninstall the program--> <DirectoryRef Id="ApplicationProgramsFolder"> <Component Id="ApplicationShortcut" Guid="..."> <Shortcut Id="ApplicationStartMenuShortcut" Name="$(var.ProductName)" Description="..." Target="[SERVERLOCATION]$(var.Project.TargetFileName)" WorkingDirectory="SERVERLOCATION"/> <Shortcut Id="UninstallProduct" Name="Uninstall $(var.ProductName)" Description="..." Target="[System64Folder]msiexec.exe" Arguments="/x [ProductCode]"/> <RemoveFolder Id="SERVERLOCATION" On="uninstall"/> <RegistryValue Root="HKCU" Key="Software\$(var.Manufacturer)\$(var.ProductName)" Name="installed" Type="integer" Value="1" KeyPath="yes"/> </Component> </DirectoryRef> Any help/suggestions that can be given will be appreciated. On a side note the registry permissions are the same on the XP and 7 computers. Thanks

    Read the article

  • Lotus Notes rich text field to RTF File - VB

    - by user236105
    Here is my problem, I am doing a data migration from Lotus notes to another type of software that does not support Rich Text Fields. I am trying to write a VB 2005 program that will take any rich text fields that are found and place them into an RTF file - which will be uploaded as an attachment in the new software. I cannot get the program to take the rich text formating or objects to the RTF file, only the plain text. I have tried everything under the sun using the COM library to get these objects out to no avail. Any ideas or suggestions? Thank you in advance Bryan

    Read the article

  • Prime Numbers Code Help

    - by andrew
    Hello Everybody, I am suppose to "write a Java program that reads a positive integer n from standard input, then prints out the first n prime number." It's divided into 3 parts. 1st: This function will return true or false according to whether m is prime or composite. The array argument P will contain a sufficient number of primes to do the testing. Specifically, at the time isPrime() is called, array P must contain (at least) all primes p in the range 2 p m . For instance, to test m = 53 for primality, one must do successive trial divisions by 2, 3, 5, and 7. We go no further since 11 53 . Thus a precondition for the function call isPrime(53, P) is that P[0] = 2 , P[1] = 3 , P[2] = 5, and P[3] = 7 . The return value in this case would be true since all these divisions fail. Similarly to test m =143 , one must do trial divisions by 2, 3, 5, 7, and 11 (since 13 143 ). The precondition for the function call isPrime(143, P) is therefore P[0] = 2 , P[1] = 3 , P[2] = 5, P[3] = 7 , and P[4] =11. The return value in this case would be false since 11 divides 143. Function isPrime() should contain a loop that steps through array P, doing trial divisions. This loop should terminate when 2 either a trial division succeeds, in which case false is returned, or until the next prime in P is greater than m , in which case true is returned. Then there is the "main function" • Check that the user supplied exactly one command line argument which can be interpreted as a positive integer n. If the command line argument is not a single positive integer, your program will print a usage message as specified in the examples below, then exit. • Allocate array Primes[] of length n and initialize Primes[0] = 2 . • Enter a loop which will discover subsequent primes and store them as Primes[1] , Primes[2], Primes[3] , ……, Primes[n -1] . This loop should contain an inner loop which walks through successive integers and tests them for primality by calling function isPrime() with appropriate arguments. • Print the contents of array Primes[] to stdout, 10 to a line separated by single spaces. In other words Primes[0] through Primes[9] will go on line 1, Primes[10] though Primes[19] will go on line 2, and so on. Note that if n is not a multiple of 10, then the last line of output will contain fewer than 10 primes. The last function is called "usage" which I am not sure how to execute this! Your program will include a function called Usage() having signature static void Usage() that prints this message to stderr, then exits. Thus your program will contain three functions in all: main(), isPrime(), and Usage(). Each should be preceded by a comment block giving it’s name, a short description of it’s operation, and any necessary preconditions (such as those for isPrime().) And hear is my code, but I am having a bit of a problem and could you guys help me fix it? If I enter the number "5" it gives me the prime numbers which are "6,7,8,9" which doesn't make much sense. import java.util.; import java.io.; import java.lang.*; public class PrimeNumber { static boolean isPrime(int m, int[] P){ int squarert = Math.round( (float)Math.sqrt(m) ); int i = 2; boolean ans=false; while ((i<=squarert) & (ans==false)) { int c= P[i]; if (m%c==0) ans= true; else ans= false; i++; } /* if(ans ==true) ans=false; else ans=true; return ans; } ///****main public static void main(String[] args ) { Scanner in= new Scanner(System.in); int input= in.nextInt(); int i, j; int squarert; boolean ans = false; int userNum; int remander = 0; System.out.println("input: " + input); int[] prime = new int[input]; prime[0]= 2; for(i=1; i ans = isPrime(j,prime); j++;} prime[i] = j; } //prnt prime System.out.println("The first " + input + " prime number(s) are: "); for(int r=0; r }//end of main } Thanks for the help

    Read the article

  • C Privilege Escalation (With Password)

    - by AriX
    Hey everyone, I need to write a C program that will allow me to read/write files that are owned by root. However, I can only run the code under another user. I have the root password, but there are no "sudo" or "su" commands on the system, so I have no way of accessing the root account (there are practically no shell commands whatsoever, actually). I don't know a whole lot about UNIX permissions, so I don't know whether or not it is actually possible to do this without exploiting the system in some way or running a program owned by root itself (with +s or whatever). Any advice? Thanks! P.S. No, this isn't anything malicious, this is on an iPhone.

    Read the article

  • GDI+ is giving me errors

    - by user146780
    I want to use GDI + just to load a png. I included the headers and lib file then I do: Bitmap b; b.fromfile(filename); I get this from the compiler though. Error 1 error C2146: syntax error : missing ';' before identifier 'b' c:\users\josh\documents\visual studio 2008\projects\vectorizer project\vectorizer project\vectorizer project.cpp 23 Error 2 error C4430: missing type specifier - int assumed. Note: C++ does not support default-int c:\users\josh\documents\visual studio 2008\projects\vectorizer project\vectorizer project\vectorizer project.cpp 23 Error 3 error C4430: missing type specifier - int assumed. Note: C++ does not support default-int c:\users\josh\documents\visual studio 2008\projects\vectorizer project\vectorizer project\vectorizer project.cpp 23 Error 4 error C2440: '=' : cannot convert from 'const char [3]' to 'WCHAR *' c:\users\josh\documents\visual studio 2008\projects\vectorizer project\vectorizer project\vectorizer project.cpp 172 Error 5 error C2228: left of '.FromFile' must have class/struct/union c:\users\josh\documents\visual studio 2008\projects\vectorizer project\vectorizer project\vectorizer project.cpp 179 What is the correct way to do this? Thanks

    Read the article

  • Why Does .Hide()ing and .Show()ing Panels in wxPython Result in the Sizer Changing the Layout?

    - by MetaHyperBolic
    As referenced in my previous question, I am trying to make something slightly wizard-like in function. I have settled on a single frame with a sizer added to it. I build panels for each of the screens I would like users to see, add them to the frame's sizer, then switch between panels by .Hide()ing one panel, then calling a custom .ShowYourself() on the next panel. Obviously, I would like the buttons to remain in the same place as the user progresses through the process. I have linked together two panels in an infinite loop by their "Back" and "Next" buttons so you can see what is going on. The first panel looks great; tom10's code worked on that level, as it eschewed my initial, over-fancy attempt with borders flying every which way. And then the second panel seems to have shrunk down to the bare minimum. As we return to the first panel, the shrinkage has occurred here as well. Why does it look fine on the first panel, but not after I return there? Why is calling .Fit() necessary if I do not want a 10 pixel by 10 pixel wad of grey? And if it is necessary, why does .Fit() give inconsistent results? This infinite loop seems to characterize my experience with this: I fix the layout on a panel, only to find that switching ruins the layout for other panels. I fix that problem, by using sizer_h.Add(self.panel1, 0) instead of sizer_h.Add(self.panel1, 1, wx.EXPAND), and now my layouts are off again. So far, my "solution" is to add a mastersizer.SetMinSize((475, 592)) to each panel's master sizer (commented out in the code below). This is a cruddy solution because 1) I have had to find the numbers that work by trial and error (-5 pixels for the width, -28 pixels for the height). 2) I don't understand why the underlying issue still happens. What's the correct, non-ugly solution? Instead of adding all of the panels to the frame's sizer at once, should switching panels involve .Detach()ing that panel from the frame's sizer and then .Add()ing the next panel to the frame's sizer? Is there a .JustMakeThisFillThePanel() method hiding somewhere I have missed in both the wxWidgets and the wxPython documents online? I'm obviously missing something in my mental model of layout. Here's a TinyURL link, if I can't manage to embed the . Minimalist code pasted below. import wx import sys class My_App(wx.App): def OnInit(self): self.frame = My_Frame(None) self.frame.Show() self.SetTopWindow(self.frame) return True def OnExit(self): print 'Dying ...' class My_Frame(wx.Frame): def __init__(self, image, parent=None,id=-1, title='Generic Title', pos=wx.DefaultPosition, style=wx.CAPTION | wx.STAY_ON_TOP): size = (480, 620) wx.Frame.__init__(self, parent, id, 'Program Title', pos, size, style) sizer_h = wx.BoxSizer(wx.HORIZONTAL) self.panel0 = User_Interaction0(self) sizer_h.Add(self.panel0, 1, wx.EXPAND) self.panel1 = User_Interaction1(self) sizer_h.Add(self.panel1, 1, wx.EXPAND) self.SetSizer(sizer_h) self.panel0.ShowYourself() def ShutDown(self): self.Destroy() class User_Interaction0(wx.Panel): def __init__(self, parent, id=-1): wx.Panel.__init__(self, parent, id) # master sizer for the whole panel mastersizer = wx.BoxSizer(wx.VERTICAL) #mastersizer.SetMinSize((475, 592)) mastersizer.AddSpacer(15) # build the top row txtHeader = wx.StaticText(self, -1, 'Welcome to This Boring\nProgram', (0, 0)) font = wx.Font(16, wx.DEFAULT, wx.NORMAL, wx.BOLD) txtHeader.SetFont(font) txtOutOf = wx.StaticText(self, -1, '1 out of 7', (0, 0)) rowtopsizer = wx.BoxSizer(wx.HORIZONTAL) rowtopsizer.Add(txtHeader, 3, wx.ALIGN_LEFT) rowtopsizer.Add((0,0), 1) rowtopsizer.Add(txtOutOf, 0, wx.ALIGN_RIGHT) mastersizer.Add(rowtopsizer, 0, flag=wx.EXPAND | wx.LEFT | wx.RIGHT, border=15) # build the middle row text = 'PANEL 0\n\n' text = text + 'This could be a giant blob of explanatory text.\n' txtBasic = wx.StaticText(self, -1, text) font = wx.Font(11, wx.DEFAULT, wx.NORMAL, wx.NORMAL) txtBasic.SetFont(font) mastersizer.Add(txtBasic, 1, flag=wx.EXPAND | wx.LEFT | wx.RIGHT, border=15) # build the bottom row btnBack = wx.Button(self, -1, 'Back') self.Bind(wx.EVT_BUTTON, self.OnBack, id=btnBack.GetId()) btnNext = wx.Button(self, -1, 'Next') self.Bind(wx.EVT_BUTTON, self.OnNext, id=btnNext.GetId()) btnCancelExit = wx.Button(self, -1, 'Cancel and Exit') self.Bind(wx.EVT_BUTTON, self.OnCancelAndExit, id=btnCancelExit.GetId()) rowbottomsizer = wx.BoxSizer(wx.HORIZONTAL) rowbottomsizer.Add(btnBack, 0, wx.ALIGN_LEFT) rowbottomsizer.AddSpacer(5) rowbottomsizer.Add(btnNext, 0) rowbottomsizer.AddSpacer(5) rowbottomsizer.AddStretchSpacer(1) rowbottomsizer.Add(btnCancelExit, 0, wx.ALIGN_RIGHT) mastersizer.Add(rowbottomsizer, flag=wx.EXPAND | wx.LEFT | wx.RIGHT, border=15) # finish master sizer mastersizer.AddSpacer(15) self.SetSizer(mastersizer) self.Raise() self.SetPosition((0,0)) self.Fit() self.Hide() def ShowYourself(self): self.Raise() self.SetPosition((0,0)) self.Fit() self.Show() def OnBack(self, event): self.Hide() self.GetParent().panel1.ShowYourself() def OnNext(self, event): self.Hide() self.GetParent().panel1.ShowYourself() def OnCancelAndExit(self, event): self.GetParent().ShutDown() class User_Interaction1(wx.Panel): def __init__(self, parent, id=-1): wx.Panel.__init__(self, parent, id) # master sizer for the whole panel mastersizer = wx.BoxSizer(wx.VERTICAL) #mastersizer.SetMinSize((475, 592)) mastersizer.AddSpacer(15) # build the top row txtHeader = wx.StaticText(self, -1, 'Read about This Boring\nProgram', (0, 0)) font = wx.Font(16, wx.DEFAULT, wx.NORMAL, wx.BOLD) txtHeader.SetFont(font) txtOutOf = wx.StaticText(self, -1, '2 out of 7', (0, 0)) rowtopsizer = wx.BoxSizer(wx.HORIZONTAL) rowtopsizer.Add(txtHeader, 3, wx.ALIGN_LEFT) rowtopsizer.Add((0,0), 1) rowtopsizer.Add(txtOutOf, 0, wx.ALIGN_RIGHT) mastersizer.Add(rowtopsizer, 0, flag=wx.EXPAND | wx.LEFT | wx.RIGHT, border=15) # build the middle row text = 'PANEL 1\n\n' text = text + 'This could be a giant blob of boring text.\n' txtBasic = wx.StaticText(self, -1, text) font = wx.Font(11, wx.DEFAULT, wx.NORMAL, wx.NORMAL) txtBasic.SetFont(font) mastersizer.Add(txtBasic, 1, flag=wx.EXPAND | wx.LEFT | wx.RIGHT, border=15) # build the bottom row btnBack = wx.Button(self, -1, 'Back') self.Bind(wx.EVT_BUTTON, self.OnBack, id=btnBack.GetId()) btnNext = wx.Button(self, -1, 'Next') self.Bind(wx.EVT_BUTTON, self.OnNext, id=btnNext.GetId()) btnCancelExit = wx.Button(self, -1, 'Cancel and Exit') self.Bind(wx.EVT_BUTTON, self.OnCancelAndExit, id=btnCancelExit.GetId()) rowbottomsizer = wx.BoxSizer(wx.HORIZONTAL) rowbottomsizer.Add(btnBack, 0, wx.ALIGN_LEFT) rowbottomsizer.AddSpacer(5) rowbottomsizer.Add(btnNext, 0) rowbottomsizer.AddSpacer(5) rowbottomsizer.AddStretchSpacer(1) rowbottomsizer.Add(btnCancelExit, 0, wx.ALIGN_RIGHT) mastersizer.Add(rowbottomsizer, flag=wx.EXPAND | wx.LEFT | wx.RIGHT, border=15) # finish master sizer mastersizer.AddSpacer(15) self.SetSizer(mastersizer) self.Raise() self.SetPosition((0,0)) self.Fit() self.Hide() def ShowYourself(self): self.Raise() self.SetPosition((0,0)) self.Fit() self.Show() def OnBack(self, event): self.Hide() self.GetParent().panel0.ShowYourself() def OnNext(self, event): self.Hide() self.GetParent().panel0.ShowYourself() def OnCancelAndExit(self, event): self.GetParent().ShutDown() def main(): app = My_App(redirect = False) app.MainLoop() if __name__ == '__main__': main()

    Read the article

  • How do I use the iPhone Simulator in 3.2 (not iPad Simulator)

    - by JustinXXVII
    I'm fixing my app to be a universal binary. Testing on the simulator seems to default to the iPad. For small corrections like checking orientations and small UI updates, the only way I can find to get the iPhone version is to plug in my iPhone and build and run on device. Loading the debugger takes valuable time, when running on simulator is so much faster for this kind of work. Can I set the simulator to default to iPhone for this? Setting it to 3.1.3 doesn't work because of the 3.2 code I have in the binary for the iPad.

    Read the article

  • MIPS assembly: how to declare integer values in the .data section?

    - by Barney
    I'm trying to get my feet wet with MIPS assembly language using the MARS simulator. My main problem now is how do I initialize a set of memory locations so that I can access them later via assembly language instructions? For example, I want to initialize addresses 0x1001000 - 0x10001003 with the values 0x99, 0x87, 0x23, 0x45. I think this can be done in the data declaration (.data) section of my assembly program but I'm not sure of the syntax. Is this possible? Alternatively, in the .data section, how do I specify storing the integer values in some memory location (I don't care where, but I just want to reference them somewhere). So I'm looking for the C equivalent of "int x = 20, y=30, z=90;" I know how to do that using MIPS instructions but is it possible to declare something like that in the .data section of a MIPS assembly program?

    Read the article

  • SSRS - Unable to determine if the owner of job has server access [SQLSTATE 42000] (Error 15404))

    - by John DaCosta
    SQL Server Reporting Services, in SSRS it seems like Schedules never fire, however a look at the SQL Agent reveals a permission issue related to not being able to resolve a user account. Seems SQL Agent does not rely on caching or whatever voodoo Windows magically works. link text Fix is listed here... edit -- Above is the fix I used to workaround this issue, has any one found any other work arounds or resolutions to this issue? It seems that by default the SSRS Generated Schedules are run as this phantom user account. How do I change this default? Is SSRS creating the jobs as the user the service runs as? Thanks Remus

    Read the article

  • Windows Workflow and sql script in declarative config like InRule

    - by Satish
    We have been using InRule for our Rule needs we have found that it does not scale well and so are investigating the Windows Work Flow. Within InRule we could configure pretty much have any task for example our sql scripts and stored procedures where all part of a separate rule config file, I am wondering if there is a similar functionality within windows work flow where I could just call a declarative task and pass it a bunch of parameters – This task should contain the sql script I would be executing , we should be able to change the script at runtime without recompilation to the WF code. Is this possible in Windows Work flow – How can I accomplish this within work flow. Additionally for sql execution within Work Flow, how does it get the connection string. Should it be passed from the calling program – is passing it as input parameter from the Calling app via the Dictionary object the best way or can the work flow code have visibility to my calling program app.config and get the connection string ?

    Read the article

  • C# SerialPort - Problems mixing ports with different baud rates.

    - by GrandAdmiral
    Greetings, I have two devices that I would like to connect over a serial interface, but they have incompatible connections. To get around this problem, I connected them both to my PC and I'm working on a C# program that will route traffic on COM port X to COM port Y and vice versa. The program connects to two COM ports. In the data received event handler, I read in incoming data and write it to the other COM port. To do this, I have the following code: private void HandleDataReceived(SerialPort inPort, SerialPort outPort) { byte[] data = new byte[1]; while (inPort.BytesToRead > 0) { // Read the data data[0] = (byte)inPort.ReadByte(); // Write the data if (outPort.IsOpen) { outPort.Write(data, 0, 1); } } } That code worked fine as long as the outgoing COM port operated at a higher baud rate than the incoming COM port. If the incoming COM port was faster than the outgoing COM port, I started missing data. I had to correct the code like this: private void HandleDataReceived(SerialPort inPort, SerialPort outPort) { byte[] data = new byte[1]; while (inPort.BytesToRead > 0) { // Read the data data[0] = (byte)inPort.ReadByte(); // Write the data if (outPort.IsOpen) { outPort.Write(data, 0, 1); while (outPort.BytesToWrite > 0); //<-- Change to fix problem } } } I don't understand why I need that fix. I'm new to C# (this is my first program), so I'm wondering if there is something I am missing. The SerialPort defaults to a 2048 byte write buffer and my commands are less than ten bytes. The write buffer should have the ability to buffer the data until it can be written to a slower COM port. In summary, I'm receiving data on COM X and writing the data to COM Y. COM X is connected at a faster baud rate than COM Y. Why doesn't the buffering in the write buffer handle this difference? Why does it seem that I need to wait for the write buffer to drain to avoid losing data? Thanks!

    Read the article

  • Easier debugging stl array

    - by bobobobo
    In MSVC++ I have a vector. Whenever you go out of bounds of the vector (in debug mode, launched as "Start Debugging"), when you step out of bounds of the vector the program halts with a dialog box: Microsoft Visual C++ Debug Library ==== Debug Assertion Failed! Expression: Vector subscript out of range Abort | Retry | Ignore So what I want though is the MSVC++ debugger within visual studio to STOP AT THE LINE WHERE THE OUT OF BOUNDS OCCURRED, not give me this dialog box. How can I cause the program to "break" properly and be able to step through code /inspect variables when an out of bounds occurs on an STL vector?

    Read the article

  • ASN1 out of memory. during a signedCMS.decode

    - by JL
    I am having a problem using the signedCMS.decode routine. See the code below. The error seems to occur when the file size is too big in this case 11MB. private static void RemoveZfoSignature(string zfoFileName) { byte[] fileContents = File.ReadAllBytes(zfoFileName); var contentInfo = new ContentInfo(fileContents); var signedCms = new SignedCms(contentInfo); // This line throws the error 100% of the time signedCms.Decode(fileContents); signedCms.RemoveSignature(0); byte[] outfile = signedCms.ContentInfo.Content; string outFileName = zfoFileName.Replace(".zfo", "_tmp.zfo"); File.WriteAllBytes(outFileName, outfile); } Here is the exact error: "System.Security.Cryptography.CryptographicException: ASN1 out of memory. at System.Security.Cryptography.Pkcs.SignedCms.OpenToDecode(Byte[] encodedMessage, ContentInfo contentInfo, Boolean detached) at System.Security.Cryptography.Pkcs.SignedCms.Decode(Byte[] encodedMessage) at ConsoleApplication2.Program.RemoveZfoSignature(String zfoFileName) in C:\\Users\\\\Documents\\Visual Studio 2008\\Projects\\ConsoleApplication2\\ConsoleApplication2\\Program.cs:line 30" Any idea on how to fix this?

    Read the article

  • C# timer won't tick

    - by Andrej
    hi, i have a strange problem... I've been going out of my mind for the past couple of hours... the timer i put in my winform code (from the toolbar) won't tick... I have timers on a couple of forms in my program, they all work fine... I try to do exactly the same it this it won't tick... I select it, drag it on to a form, enable it, set interval and handle the tick event... and nothing happens... i even tried putting random code like messagebox.show in the tick event just to see if anything happens, and nothing!!! as I said, a have a couple of more timer in my program (on other forms, not in the one i'm trying to put this timer) and they all work fine... any suggestions? thanks in advance!

    Read the article

  • JAutodoc for Eclipse

    - by bizso09
    Hi, I'm trying to generate javadoc with JAutodoc 1.7 for Eclipse 3.5. I've sucessfully created templates for files, classes, methods. However, on parameters and exceptions I get the default @param and @throws tags generated even if I change the template in preferences/JAutodoc/templates/parameters. This is incompatible with the coding standards they have given us. Any help? Btw, I tried to use the default eclipse comment template but I couldn't find any enclosing_method_arguments variable in my version. Any ideas why that might be?

    Read the article

  • RAR password recovery on GPU using ATI Stream processor

    - by Wajdy Essam
    Hello, I'm newbie in GPU programming , and i work on brute force RAR Password Recovery on ATI Stream Processor using brook+ language, but i see that the kernel written in brook+ language doesn't allow any calling to normal functions (except kernel functions) , my questions is : 1) how to use unrar.dll (to unrar archive files) API in this situation? and is this the only way to program RAR password recovery? 2) what about crack and ElcomSoft software that use GPU , how they work ? 3) what exactly the role for the function work inside GPU (ATI Stream processor or CUDA) in this program? 4) is nVidia/CUDA technology is easier/more flexible than ATI/brook+ language ?

    Read the article

  • Service and Web Reference crashes Visual Studio

    - by CatZ
    When I move the mouse over any of these two or right click any of them Visual Studio crashes with the following message in the event log: Felet uppstod i programmet med namn: devenv.exe, version 9.0.30729.1, tidsstämpel 0x488f2b50 , felet uppstod i modulen med namn: ntdll.dll, version 6.1.7600.16385, tidsstämpel 0x4a5bdb3b Undantagskod: 0xc0000374 Felförskjutning: 0x000cdcbb Process-ID: 0xef4 Programmets starttid: 0x01cb07b7f1bd036d Sökväg till program: C:\Program Files (x86)\Microsoft Visual Studio 9.0\Common7\IDE\devenv.exe Sökväg till modul: C:\Windows\SysWOW64\ntdll.dll Rapport-ID: 46c92fc7-73ab-11df-b110-002481038dc3 Unfortunately it's the same thing in Visual Studio 2010 as it is in Visual Studio 2008. I have tried to repair the installation, reset all settings to default and Uninstall all plugins I have without any noticable results. Does anyone have any clue to what is going on? Salient part in English: Faulting application devenv.exe, version 9.0.30729.1, time stamp 0x488f2b50, faulting module ntdll.dll, version 6.1.7600.16385, time stamp 0x4a5bdb3b, exception code 0xc0000374, fault offset 0x000cdcbb, process id 0xef4, application start time 0x01cb07b7f1bd036d.

    Read the article

  • How do you run PartCover with spaces in the path?

    - by nportelli
    I have a msbuild file that I'm trying to run from Hudson CI. It outputs like this "C:\Program Files\Gubka Bob\PartCover .NET 2\PartCover.exe" --target "C:\Program Files\Microsoft Visual Studio 9.0\Common7\IDE\MSTest.exe" --target-args "/noisolation" "/testcontainer:C:\CI\Hudson\jobs\Video Raffle\workspace\Source\VideoRaffleCaller\Source\VideoRaffleCaller.Test.Unit\bin\Debug\VideoRaffleCaller.Test.Unit.dll" --include "[VideoRaffleCaller*]*" --output "Coverage\partcover.xml" I get this error Invalid switch "raffle\workspace\source\videorafflecaller\source\videorafflecall er.test.unit\bin\debug\videorafflecaller.test.unit.dll". For switch syntax, type "MSTest /help" WTF? Looks like PartCover doesn't handle spaces in the --target-args well. Or am I missing some quotes somewhere? Has anyone gotten something like to to work?

    Read the article

< Previous Page | 431 432 433 434 435 436 437 438 439 440 441 442  | Next Page >